Primer set for amplifying InDel markers and its application in identifying garlic male fertility and garlic breeding

Abstract

The present invention belongs to the field of biotechnology, and relates to a primer set for amplifying InDel markers and its application in identifying garlic male fertility and garlic breeding. The primer set provided by the present invention can amplify InDel markers related to the male fertile traits of cultivated garlic, so as to identify or assist in identifying the fertility traits of cultivated garlic, and further lay a foundation for the development of garlic cross-breeding.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a primer set for amplifying InDel markers and its application in identifying garlic male fertility and garlic breeding. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or any form of implication that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Garlic (Allium sativum L.) is a plant of the genus Allium in the family Alliaceae, and is a vegetatively propagated vegetable. In the late growth stage of the inflorescence of most garlic varieties, flowers generally do not grow. Although a few garlic varieties can flower, the flower development is incomplete, so most of them cannot form seeds, which limits the improvement of garlic varieties by conventional sexual hybridization. Summary of the Invention

[0004] In order to solve the deficiencies of the prior art, the purpose of the present invention is to provide a primer set for amplifying InDel markers and its application in identifying garlic male fertility and garlic breeding. The primer set provided by the present invention can amplify InDel markers related to the male-fertile traits of cultivated garlic, thereby identifying or assisting in the identification of the fertility traits of cultivated garlic, and further laying a foundation for the development of garlic cross-breeding.

[0005] In order to achieve the above purpose, the technical solution of the present invention is as follows:

[0006] On the one hand, a primer set for amplifying InDel markers, the nucleotide sequences of the primer set are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0007] The primer set designed by the present invention is used to amplify the molecular marker GmfM281. Based on the transcriptome sequencing information of male-fertile garlic material G398 and male-sterile garlic material G390, and combined with Sanger sequencing verification of the genomic DNA sequence, it can identify the fertility of garlic materials G398 and G390.

[0008] On the other hand, an application of the above primer set for amplifying InDel markers in identifying or assisting in the identification of garlic male fertility.

[0009] Since the present invention can identify the male fertility of garlic, it shows good applicability when tested in 46 garlic germplasm resources, and can be used to identify or assist in identifying the male fertility or sterility of the garlic material to be tested. By screening male-fertile garlic materials, the limitation of male sterility on variety improvement through conventional sexual hybridization can be broken.

[0010] In a third aspect, an application of the above primer set for amplifying InDel markers in garlic cross-breeding.

[0011] In a fourth aspect, a kit for identifying or assisting in identifying the male-fertile trait of cultivated garlic, comprising the above primer set for amplifying InDel markers and a solvent.

[0012] The beneficial effects of the present invention are as follows:

[0013] For the first time, the present invention designs the GmfM281 primer set, which can amplify InDel molecular markers related to the fertility of cultivated garlic. By comparing the marker band patterns of male-fertile garlic and male-sterile garlic, it is found that the lengths of their characteristic bands are different, and thus the fertility of cultivated garlic can be identified. The present invention has been experimentally proven that the accuracy rate of identifying male-sterile garlic by the primer set designed by the present invention is relatively high, up to 93.48%, and has good applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0015] Figure 1 Pictures of male-fertile garlic G398 and male-sterile garlic G390 materials used in the embodiments of the present invention.

[0016] Figure 2 Pictures of the amplified sequences of the GmfM281 primer set in male-fertile garlic G398 and male-sterile garlic G390 materials in the embodiments of the present invention.

[0017] Figure 3 Amplified bands of the GmfM281 primer set in male-fertile garlic G398 and male-sterile garlic G390 materials in the embodiments of the present invention.

[0018] Figure 4This is the verification result diagram of the GmfM281 primer set in 46 garlic germplasm resources in the embodiments of the present invention; upper row: lane 1 is Marker 2000, lane 2 is male-fertile garlic G398, lane 3 is male-sterile garlic G390, lanes 4-25 are male-sterile garlic germplasm resources; lower row: lane 1 is Marker 2000, lanes 2-25 are male-sterile garlic germplasm resources. Detailed implementation manners

[0019] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0020] It should be noted that the terms used herein are only for describing specific implementation manners and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0021] In view of the fact that garlic male sterility limits the improvement of varieties through conventional sexual hybridization, the present invention provides a primer set for amplifying InDel markers and its application in identifying garlic male fertility and garlic breeding.

[0022] A typical embodiment of the present invention provides a primer set for amplifying InDel markers, and the nucleotide sequences of the primer set are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0023] In some embodiments, the InDel marker is GmfM281.

[0024] In some embodiments, the characteristic band of the InDel molecular marker of male-fertile cultivated garlic amplified by the primer set is 440-450 bp. Specifically, it is shown in SEQ ID NO.3.

[0025] In some embodiments, the characteristic band of the InDel molecular marker of male-sterile cultivated garlic amplified by the primer set is 720-730 bp. Specifically, it is shown in SEQ ID NO.4.

[0026] Another embodiment of the present invention provides an application of the above primer set for amplifying InDel markers in identifying or assisting in identifying garlic male fertility.

[0027] Specifically, the fertility of garlic is identified by PCR amplification and electrophoresis detection using the above-mentioned primer set for amplifying InDel markers.

[0028] More specifically, the reaction system for PCR amplification includes the garlic DNA to be identified, 2×Taq PCR MasterMix, the above-mentioned primer set for amplifying InDel markers, and ddH 2 O. ddH 2 O is double deionized water.

[0029] More specifically, the procedure for PCR amplification is: pre-denaturation at 92 - 96°C for 4 - 6 min; denaturation at 92 - 96°C for 25 - 35 s, annealing at 55 - 59°C for 25 - 35 s, extension at 70 - 74°C for 55 - 65 s for 1 cycle, 34 - 38 cycles; extension at 70 - 74°C for 2.5 - 3.5 min; preservation at 3 - 5°C.

[0030] More specifically, the process of electrophoresis detection is: using a 1.4 - 1.6% agarose gel, electrophoresis separation at a constant power of 135 - 145 V for 0.9 - 1.1 h, staining with a solution containing 0.4 - 0.6 μg / mL of ethidium bromide (EB) and 1×TBE solution for 10 - 20 min, rinsing with water, and then taking pictures and saving them using a UV gel imaging system for further band pattern statistics.

[0031] The third embodiment of the present invention provides an application of the above-mentioned primer set for amplifying InDel markers in garlic cross-breeding.

[0032] Specifically, the fertility of garlic is identified by PCR amplification and electrophoresis detection using the above-mentioned primer set for amplifying InDel markers, and then the identified male-fertile garlic is subjected to sexual hybridization.

[0033] The fourth embodiment of the present invention provides a kit for identifying or assisting in identifying the male-fertile trait of cultivated garlic, including the above-mentioned primer set for amplifying InDel markers and a solvent.

[0034] In some embodiments, it includes PCR reaction reagents. The PCR reaction reagents may include Taq DNA polymerase, dNTPs, MgCl 2 , reaction buffer, PCR reaction enhancer, optimizer, stabilizer, etc., which can be provided together by a PCR premix.

[0035] In some embodiments, it includes electrophoresis reagents. The electrophoresis reagents may include agarose gel, ethidium bromide, TBE solution, etc.

[0036] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0037] Example 1 Development of InDel Molecular Markers Related to the Fertility of Cultivated Garlic

[0038] 1. Experimental Materials

[0039] The male-fertile garlic G398 is derived from: a self-owned strain of the Vegetable Research Institute of Shandong Academy of Agricultural Sciences.

[0040] The male-sterile garlic G390 is derived from: a self-owned strain of the Vegetable Research Institute of Shandong Academy of Agricultural Sciences.

[0041] The traits of the above-mentioned male-fertile garlic G398 and male-sterile garlic G390 are as Figure 1 shown.

[0042] 2. Experimental Procedures

[0043] 2.1 Plant the male-fertile garlic G398 and male-sterile garlic G390 materials, and take samples of flower buds at the early stage of inflorescence development and before flowering (mixed samples of 10 plants, with 3 replicates). Extract RNA, and detect the RNA concentration and quality by NanoDrop and Agilent2100, which meet the requirements for BGISEQ Transcriptome library construction. Use the DNBSEQ platform for transcriptome sequencing.

[0044] 2.2 The raw data (raw reads or raw data) obtained from transcriptome sequencing is filtered by the software SOAPnuke to remove reads with low quality, adapter contamination, and excessive content of unknown bases N, obtaining Clean reads. Use Bowtie2 to align the clean reads to the garlic reference gene sequence, and then use RSEM to calculate the expression levels of genes and transcripts.

[0045] 2.3 Query and download the gene sequences related to flower development from the official website of Arabidopsis thaliana (https: / / www.arabidopsis.org / index.jsp), perform homologous alignment in the garlic genome to obtain 539 homologous genes, analyze the expression differences of these 539 genes in the inflorescences and flower buds of male-fertile garlic G398 and male-sterile garlic G390 materials, obtain a gene with a large expression difference between the two materials, obtain the DNA sequence information of this gene through in silico cloning of the garlic genome, design primers to amplify the sequences of this gene in male-fertile garlic G398 and male-sterile garlic G390 materials respectively, and it is found by Sanger sequencing that there is an insertion fragment of 281 bp bases in the male-sterile garlic G390 material.

[0046] 2.4 Design a primer set of InDel marker GmfM281 related to the male-fertile trait of cultivated garlic for the 281-bp insertion fragment:

[0047] GmfM281-F: CAACTCCTCCAAAGTCTAAAG (SEQ ID NO.1);

[0048] GmfM281-R: CAAAGATGGTGGGTGTAGC (SEQ ID NO.2).

[0049] Extract the genomic DNA of male-fertile garlic G398 and male-sterile garlic G390 materials. Using the genomic DNA as a template, perform PCR amplification with the GmfM281 primer set and conduct electrophoresis detection.

[0050] The reaction system for PCR amplification is 20 μL, and the components included in the reaction system are as follows: DNA 1.0 μL (100 ng / μL -1 ), 2×Taq PCR Master Mix 10.0 μL (containing Taq DNA polymerase, dNTPs, MgCl 2 , reaction buffer, PCR reaction enhancer and optimizer, and stabilizer), 1.0 μL (5 μM / L) of each upstream and downstream primer, ddH 2 O 7.0 μL.

[0051] The reaction program for PCR amplification is: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 60 s for 1 cycle, 36 cycles; extension at 72 °C for 3 min; preservation at 4 °C.

[0052] The electrophoresis detection process is as follows: Use a 1.5% agarose gel, perform electrophoresis at a constant power of 140 V for 1 h for separation, stain with a solution containing 0.5 μg / mL ethidium bromide (EB) and 1×TBE for 15 min, rinse with water, and then use a UV gel imaging system to take pictures and save for further band pattern statistics.

[0053] The characteristic band of the GmfM281 primer set in male-fertile cultivated garlic G398 is 447 bp, and the characteristic band in male-sterile cultivated garlic G390 is 728 bp, as Figures 2 - 3 shown.

[0054] The amplified sequence of the GmfM281 primer set in garlic G398 is:

[0055] CAACTCCTCCAAAGTCTAAAGGCAACAAAAGGAAAAAAGACAAGGGTCTCAAATATCCAATCATCCATTTTGAATGTGGTTTCCACTATTTATGTTTTGTCTGGATCCACTTATATAAGTTGATTTTTTTTTTGTGTTTTGAAAGGCAAATGAATTAGTCTTGGCTTTCAGAAAAAAAGAAAAATAAGAAGGAAAAAAAAAAAAAAAAAAAAAAACAGTTTATTTATGTTGATCCAAACCAAACATTAATATTTCATACAATTTGTAGCTAGTTGGATGCATTAGTTAGACACACCAACACGAACAACGGAATTGAGTCCGAAAACAACAATTGAAAACAAAGGACTAACCACCAAGTTTCAAATATTATTCCCTTTGTAATATAACCTTCCAAACACATAACTCTCCTTTATGAAAAATGATACATAGCTACACCCACCATCTTTG, as shown in SEQ ID NO.3.

[0056] The amplified sequence of the GmfM281 primer set in garlic G390 is:

[0057] CAACTCCTCCAAAGTCTAAAGGCAACAAAAGGAAAAAAGACAAGGGTCTCAAATATCCAATCATCCATTTTGAATGTGGTTTCCACTATTTATGTTTTGTCTGGATCCACTTATATAAGTTGATTTTTTTTTTGTGTTTTGAAAGGCAAATGAATTAGTCTTGGCTTTCAGAAAAAAAGAAAAATAAGAAGGAAAAAAAAAAAAAAAAAAAAAAACAGTTTATTTATGTTGATCCAAACCAAACAT TAAGGTAGCGTTTGATTTTCGGAAGGGGCACGTTAAGTTGGCGTCCGCGT CGGAAGCGTCCGACGCGAGCATCAATTTGCCCCTTCCGAAACCAAAGCTTGTTTGTGAACCTTTCAGCTCAACCGT TCAACCTTTACCCTATTTTATACCCTTTTATTCCTTTCGTGTGCCCCTTCCTATTCAAAATCAAACACATACCCCT TTCCTTAATTTTCCCCTTCTCCAACCCCTTCGCCATGCCTCTTCCAAATAACCCTTCCTGTTCAAAATCAAACGCA CCCTAATATTTCATACAATTTGTAGCTAGTTGGATGCATTAGTTAGACACACCAACACGAACAACGGAATTGAGTCCGAAAACAACAATTGAAAACAAAGGACTAACCACCAAGTTTCAAATATTATTCCCTTTGTAATATAACCTTCCAAACACATAACTCTCCTTTATGAAAAATGATACATAGCTACACCCACCATCTTTG, as shown in SEQ ID NO.4, where the underlined part is the inserted sequence.

[0058] Example 2 Application of GmfM281 molecular marker as a molecular marker related to the fertility traits of cultivated garlic

[0059] 1. The GmfM281 molecular marker and / or the GmfM281 primer set are used for identifying or assisting in identifying the fertility-related traits of cultivated garlic

[0060] 1. Experimental materials

[0061] Forty-six germplasm resources of cultivated garlic were planted in the core base of the Institute of Vegetables, Shandong Academy of Agricultural Sciences, with normal water and fertilizer management. The fertility of the germplasm resources was investigated when the garlic blossomed, and the results showed that all were male-sterile materials.

[0062] 2. Experimental steps

[0063] The GmfM281 primer set was used to identify the fertility traits of 46 germplasm resources of cultivated garlic: Genomic DNA of garlic was extracted, and using the genomic DNA as a template, PCR amplification was carried out with the GmfM281 primer set and electrophoresis detection was performed.

[0064] The reaction system for PCR amplification was 20 μL, and the reaction system contained the following components: DNA 1.0 μL (100 ng / μL -1 ), 2×Taq PCR Master Mix 10.0 μL (containing Taq DNA polymerase, dNTPs, MgCl 2 , reaction buffer, PCR reaction enhancer and optimizer, and stabilizer), 1.0 μL (5 μM / L) of each upstream and downstream primer, ddH 2 O 7.0 μL.

[0065] The reaction program for PCR amplification was: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 60 s for 1 cycle, 36 cycles; extension at 72 °C for 3 min; preservation at 4 °C.

[0066] The process of electrophoresis detection is as follows: 1.5% agarose gel is used for separation by constant power electrophoresis at 140V for 1h, stained with 1×TBE solution containing 0.5 μg / mL ethidium bromide (EB) for 15 min, rinsed with clear water, and then photographed and saved using an ultraviolet gel imaging system for further band pattern statistics.

[0067] The amplified bands of the GmfM281 primer set for 46 cultivated garlic germplasm resources were counted (the double bands are the band patterns of male sterile materials, and the single bands are the fertile band patterns). As Figure 4 shown, the accuracy rate of this marker is 93.48% (43 / 46). The above experimental results indicate that the GmfM281 molecular marker can be used as a molecular marker for the fertility traits of cultivated garlic and can be used to identify or assist in identifying the fertility traits of cultivated garlic.

[0068] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A primer set for amplifying InDel markers, characterized in that, the nucleotide sequences of the primer set are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively.

2. The primer set for amplifying InDel markers according to claim 1, characterized in that, the characteristic band of the InDel molecular marker of the male-fertile cultivated garlic amplified by the primer set is 440 - 450 bp; or, the characteristic band of the InDel molecular marker of the male-sterile cultivated garlic amplified by the primer set is 720 - 730 bp.

3. An application of the primer set for amplifying InDel markers according to any one of claims 1 - 2 in identifying or assisting in identifying the male fertility of garlic.

4. The application according to claim 3, characterized in that, the male fertility of garlic is identified by using the primer set for amplifying InDel markers through PCR amplification and electrophoresis detection.

5. The application according to claim 4, characterized in that, The reaction system for PCR amplification includes the garlic DNA to be identified, 2×Taq PCR MasterMix, the primer set for amplifying the InDel marker, and ddH 2 O.

6. The application according to claim 4, characterized in that, PCR The amplification procedure is: pre-denaturation at 92 - 96 °C for 4 - 6 min; denaturation at 92 - 96 °C for 25 - 35 s, annealing at 55 - 59 °C for 25 - 35 s, extension at 70 - 74 °C for 55 - 65 s for 1 cycle, 34 - 38 cycles; extension at 70 - 74 °C for 2.5 - 3.5 min; preservation at 3 - 5 °C.

7. The application according to claim 4, characterized in that, The electrophoresis detection process is: using a 1.4 - 1.6% agarose gel, electrophoresis at a constant power of 135 - 145 V for 0.9 - 1.1 h for separation, staining with a solution containing 0.4 - 0.6 μg / mL ethidium bromide (EB) and 1×TBE for 10 - 20 min, rinsing with water, and then using a UV gel imaging system to take pictures and save for further band pattern statistics.

8. An application of the primer set for amplifying InDel markers according to any one of claims 1 - 2 in garlic cross-breeding.

9. The application according to claim 8, characterized in that, the male fertility of garlic is identified by using the primer set for amplifying InDel markers through PCR amplification and electrophoresis detection, and then the identified male-fertile garlic is subjected to sexual hybridization.

10. A kit for identifying or assisting in identifying the male-fertile traits of cultivated garlic, characterized in that, it includes the primer set for amplifying InDel markers according to any one of claims 1 - 2 and a solvent.

11. The kit according to claim 10, characterized in that, it includes PCR reaction reagents.

12. The kit according to claim 10, characterized in that, it includes electrophoresis reagents.

Images