A kind of avermectin B1a aptamer and its screening method and application

Abstract

The present invention belongs to the technical field of antibiotic detection, and specifically relates to an avermectin B1a aptamer and a screening method and application thereof. The nucleic acid sequence of the avermectin B1a aptamer includes a sequence as shown in SEQ ID NO.1. The avermectin B1a aptamer has a dissociation constant of 63.13±8.91nM, has a strong affinity for avermectin B1a, and can specifically recognize avermectin B1a.

Description

Technical Field

[0001] The invention belongs to the technical field of antibiotic detection, and specifically relates to an avermectin B1a aptamer and a screening method and application thereof. Background Art

[0002] Avermectin is a macrolide antibiotic. Due to its high efficiency, broad spectrum, and unique mechanism of action, it is widely used not only in field crops, but also in livestock such as pigs, cattle, and sheep, and aquatic products such as grass carp and shrimp. However, avermectins are toxic to the human body. Mild poisoning can cause headaches, vomiting, and other symptoms, while severe cases can endanger life and cause death. my country's Ministry of Agriculture and Rural Affairs has clearly stipulated the maximum residue limit values ​​of avermectins in various foods.

[0003] Avermectin is divided into two categories, A and B, each containing four components, among which B1a has the strongest anti-insect activity and accounts for the highest proportion in the drug (≥90%). At present, the commonly used detection methods for avermectin B1a are chromatography and enzyme-linked immunosorbent assay; among them, chromatography has high sensitivity and good reproducibility, but the instrument is expensive and the operation is cumbersome; the disadvantage of the immunoassay is that there are batch differences in antibodies and cross-reactions are prone to occur. Therefore, it is necessary to develop a detection method with low cost, high specificity and high sensitivity.

[0004] Aptamer-based detection is a new detection technology. Due to its advantages of simple operation, high sensitivity, miniaturization, and easy automation, it has been widely used in drug screening and targeting, food safety testing, disease diagnosis, and environmental monitoring. Aptamers are functional single-stranded DNA or RNA fragments selected from random oligonucleotide libraries through an in vitro evolution process called systematic evolution by ligand exponential enrichment (SELEX). They are regarded as "chemical antibodies" and are chemically synthesized by standard methods. They can recognize targets with high affinity and specificity. Unlike antibodies that need to be synthesized by biological systems, nucleic acid aptamers have certain thermal folding capabilities and can be chemically modified according to the detection standards of target molecules.

[0005] Therefore, it is necessary to develop an aptamer that can specifically recognize avermectin B1a. Summary of the invention

[0006] In view of the above problems, the present invention aims to obtain the aptamer Seq1 by combining graphene oxide exponential enrichment systematic evolution of ligands (GO-SELEX) and capillary electrophoresis exponential enrichment systematic evolution of ligands (CE-SELEX) in vitro screening. Seq1 can specifically recognize avermectin B1a. After truncating Seq 1, the obtained Seq 1-1 has a higher affinity and can better recognize avermectin B1a.

[0007] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0008] In one aspect, the present invention provides an avermectin B1a aptamer, the nucleic acid sequence of which includes the sequence shown in SEQ ID NO.1.

[0009] Another aspect of the present invention provides a method for screening the above-mentioned avermectin B1a aptamer, comprising: combining GO-SELEX with CE-SELEX to screen the avermectin B1a aptamer.

[0010] In another aspect, the present invention provides a detection reagent for avermectin B1a, comprising the above-mentioned avermectin B1a aptamer.

[0011] In another aspect, the present invention provides a detection kit for avermectin B1a, comprising the above detection reagent.

[0012] In another aspect, the present invention provides a sensor for detecting avermectin B1a, which comprises the above-mentioned avermectin B1a aptamer.

[0013] In another aspect, the present invention provides a use of the above-mentioned avermectin B1a aptamer, the above-mentioned detection reagent, the above-mentioned detection kit or the above-mentioned detection sensor in detecting avermectin B1a.

[0014] The beneficial effects of the present invention include at least: the dissociation constant of the avermectin B1a aptamer provided by the present invention is 63.13±8.91nM, it has a strong affinity for avermectin B1a, and can specifically recognize avermectin B1a. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Different incubation ratios of graphene oxide GO and ssDNA;

[0016] Figure 2 Different incubation times of graphene oxide GO and ssDNA;

[0017] Figure 3 Comparison of the affinity between the ssDNA library and avermectin B1a in each screening round;

[0018] Figure 4 Homology analysis of nucleic acid aptamers;

[0019] Figure 5 The affinity of aptamer Seq1 was evaluated by capillary electrophoresis;

[0020] Figure 6 The affinity of aptamer Seq2 was evaluated by capillary electrophoresis;

[0021] Figure 7The affinity of aptamer Seq5 was evaluated by capillary electrophoresis;

[0022] Figure 8 The affinity of aptamer Seq1-1 was evaluated by capillary electrophoresis;

[0023] Fig. 9 This is the specificity evaluation of aptamer Seq1-1, and *** in the figure represents p < 0.001;

[0024] Fig.10 The relationship between the visual color and absorbance change (ΔA) of the sensing solution and the amount of avermectin B1a added, where the inset shows the absorbance change of the sensing solution under low concentration avermectin B1a conditions. DETAILED DESCRIPTION

[0025] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0026] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0027] The embodiment of the present invention provides an avermectin B1a aptamer, the nucleic acid sequence of which includes the sequence shown in SEQ ID NO.1.

[0028] It should be noted that the sequence shown in SEQ ID NO.1 is a specific binding sequence for avermectin B1a, which is obtained by truncating the original aptamer Seq 1 that was screened out. The aptamer Seq 1 also has a strong affinity for avermectin B1a, with a dissociation constant of 69.84±10.22nM, and has a strong recognition ability for avermectin B1a. Therefore, in the present invention, as long as the sequence includes the sequence shown in SEQ ID NO.1, it has a strong recognition ability for avermectin B1a. It should also be noted that the sequence of the untruncated aptamer Seq 1 is

[0029] "P1-GGTAGTGGGAATGTCCCAAAGCTGTACATCACGGTGCCTT-P2", wherein P1 can be "5'GGACAGGACCACACCCAGCG3', and P2 can be "5'GGCTCCTGTGTGTCGCTTTGT3'".

[0030] Another embodiment of the present invention provides a method for screening the above-mentioned avermectin B1a aptamer, comprising: combining GO-SELEX with CE-SELEX to screen the avermectin B1a aptamer.

[0031] In some specific embodiments, the screening method comprises: (1) designing a library and primers, (2) using graphene oxide to preliminarily screen out a library with specificity, and then screening out a library with stronger specificity through reverse screening and positive screening, and then screening out a library with stronger specificity through CE-SELEX, and screening out library sequences with lower homology and enrichment ≥2.74%; (3) screening out a sequence with the smallest dissociation constant, and truncating it to obtain the avermectin B1a aptamer according to claim 1.

[0032] In some specific embodiments, in step (1) of the above screening method, the library sequence is "5'GGACAGGACCACACCCAGCG-N40-GGCTCCTGTGTGTCGCTTTGT3'", N40 refers to 40 bases of random A, T, C, G nucleotides, representing 25% A, 25% T, 25% C, 25% G; the primers include a forward primer and a reverse primer, the forward primer is "5'GGACAGGACCACACCCAGCG3', and the reverse primer is "5'TTTTTTTTTTTTTTTTTT / iSp9 / ACAAAGCGACACACAGGAGCC3'".

[0033] It should be noted that iSp9 is an intermediate modification, which refers to the use of Spacer 9 for intermediate modification. Spacer 9 is a linker chain composed of triethylene glycol, which can establish a distance between oligonucleotides to avoid steric hindrance, reduce adverse interactions between groups, and increase flexibility. 21 Ts and Spacer 9 are designed in the reverse primer to facilitate the separation of polymerase chain reaction (PCR) products by denaturing polyacrylamide gel electrophoresis (PAGE).

[0034] It should be noted that GO-SELEX is particularly suitable for the screening of small molecule target aptamers. Graphene oxide can adsorb free ssDNA that is not bound to the target through π-π stacking, and there is no covalent binding between graphene oxide and the target, thereby better retaining the original structure of the target molecule, but the screening cycle is longer. CE-SELEX is an efficient aptamer screening method. Compared with traditional SELEX, it has the advantages of short cycle, high sensitivity and low cost. It can also be used directly to determine affinity constants, which helps to monitor the enrichment of ssDNA in each round of selection. However, CE-SELEX has a small injection volume, low library capacity, and limited diversity of the initial library. Therefore, the combination of GO-SELEX and CE-SELEX can overcome some difficulties in the screening process and improve the success rate of aptamer screening.

[0035] Another embodiment of the present invention provides a detection reagent for avermectin B1a, including the above-mentioned avermectin B1a aptamer. It should be noted that the above-mentioned avermectin B1a aptamer can be added with an auxiliary detection reagent to detect avermectin B1a, and the auxiliary detection reagent includes a buffer solution, a color developing solution or a diluent, etc., which can be selected according to actual conditions.

[0036] Another embodiment of the present invention provides a detection kit for avermectin B1a, which includes the above detection reagent. It should be noted that the above detection reagent can be prepared into a portable detection kit, and the form of the detection kit is known in the art, such as a reagent bottle containing the reagent, an instruction manual describing the method of use, etc.

[0037] Still another embodiment of the present invention provides a sensor for detecting avermectin B1a, which includes the above-mentioned avermectin B1a aptamer.

[0038] In some specific embodiments, the above-mentioned avermectin B1a detection sensor also includes nano-ruthenium.

[0039] Still another embodiment of the present invention provides a use of the above-mentioned avermectin B1a aptamer or the above-mentioned detection reagent or the above-mentioned detection kit or the above-mentioned detection sensor in detecting avermectin B1a.

[0040] It should be noted that nanozymes have attracted much attention due to their excellent thermal stability, easy preparation, low cost, catalytic activity of multiple enzymes and adjustable activity. Functional oligonucleotides contain many negatively charged phosphate backbones and positively charged bases, which can interact with some nanozymes of specific shapes, thereby changing their catalytic activity. For example, ssDNA can inhibit the catalytic effect of MnO2 nanosheets. Based on this principle, a colorimetric biosensor for detecting T4 polynucleotide kinase has been developed. Ruthenium, as a platinum group transition metal, shows very excellent catalytic behavior and has high peroxidase mimetic activity. In the present invention, ssDNA nucleic acid aptamers are used to regulate the peroxidase mimetic activity of nanoruthenium, and an aptamer-based colorimetric sensor is developed for highly sensitive and selective detection of avermectin B1a.

[0041] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0042] 1. Preparation of nucleic acid aptamers that specifically recognize avermectin B1a

[0043] (I) Library and primer design

[0044] The initial random ssDNA library and primers were chemically synthesized in vitro, and their sequences are as follows:

[0045] (1) Library

[0046] 5'GGACAGGACCACACCCAGCG-N40-GGCTCCTGTGTGTCGCTTTGT 3', wherein N40 refers to 40 bases of random A, T, C and G nucleotides, representing 25% A, 25% T, 25% C and 25% G.

[0047] (2) Primer

[0048] Forward primer: 5'GGACAGGACCACACCCAGCG 3',

[0049] Reverse primer: 5'TTTTTTTTTTTTTTTTTTTT / iSp9 / ACAAAGCGACACACAGGAGCC 3'.

[0050] (II) Optimization of the ratio and time of incubation of ssDNA and graphene oxide

[0051] Graphene oxide was used to separate ssDNA bound to and not bound to avermectin B1a. Before separation, the ratio and time of graphene oxide adsorption of ssDNA were first optimized to achieve the best graphene oxide separation conditions. Specifically, the reaction time of graphene oxide and ssDNA was fixed, and the mass ratio of graphene oxide to ssDNA was set to 0:1, 50:1, 100:1, 150:1, 200:1, and 300:1 (m:m) for incubation, with 3 parallels for each group. After incubation at 25°C, the supernatant was obtained by centrifugation at 20,000g, and the ssDNA concentration was measured using a BioTek Epoch ultra-microplate spectrophotometer.

[0052] The results are as follows Figure 1 As shown, when the mass ratio of graphene oxide to ssDNA is 200:1 (m:m), the ssDNA concentration has approached 0, indicating that ssDNA is basically completely adsorbed, so 200:1 is selected as the optimal mass ratio.

[0053] The incubation ratio of ssDNA to graphene oxide was fixed (200:1), and the incubation time was set to 0 min, 20 min, 40 min, 60 min, 80 min and 100 min, respectively, with 3 parallels in each group. The supernatant obtained by centrifugation after incubation was used to measure the ssDNA concentration using a BioTek Epoch ultra-microplate spectrophotometer.

[0054] The results are as follows Figure 2 As shown, with the increase of incubation time, the ssDNA concentration in the supernatant after incubation continued to decrease. At 60 minutes, the ssDNA was basically completely adsorbed, so the incubation time of 60 minutes was selected for subsequent experiments.

[0055] (III) Screening

[0056] (1)1-2 rounds of screening (GO-SELEX)

[0057] (a) Separation of unbound ssDNA

[0058] Before each round of incubation, the ssDNA library was dissolved in tris(hydroxyamino)methane-glycine-potassium (1×TGK) (25mM Tris-HCl, 192mM glycine, 5mM KH2PO4, pH 8.3) binding buffer, denatured at 95°C for 10min, immediately placed in an ice bath for 10min, and then equilibrated at room temperature for 10min to allow a large amount of ssDNA in the library to fold into complex and diverse three-dimensional structures. The random library was mixed with avermectin B1a and incubated on a shaker at 25°C until avermectin B1a and ssDNA library interacted for 2h. Graphene oxide was added and incubated at 25°C for 60min to adsorb ssDNA that was not bound to avermectin B1a. After centrifugation at 20000g for 30min to remove graphene oxide, the supernatant was used as a PCR amplification template.

[0059] The amount of ssDNA random library added in the first round of screening was 2 nmol, and the amount of library added in rounds 2-4 was 200 pmol; the amount of avermectin B1a added in each round was 2 nmol; the mass ratio of graphene oxide to ssDNA was 200:1 for adsorption, and the conditions were 25°C for 1 h.

[0060] (b) PCR amplification

[0061] Because the ssDNA content in the collected complex is low, a large amount of template needs to be amplified by PCR; PCR conditions: total volume 1000μL, 100μL 10×PCR Buffer, 40μL forward primer (10μM), 40μL reverse primer (10μM), 160μL dNTPs (2.5mM), 5μL Takala Taq DNA polymerase, add H2O to 1000μL. PCR conditions: 98℃ pre-denaturation for 1min, 98℃ denaturation for 10s, 55℃ annealing for 30s, 72℃ extension for 1min, 22 cycles and 72℃ final extension for 7min

[0062] min.

[0063] (c) Separation and purification of PCR products

[0064] Denaturing PAGE gel electrophoresis was used to prepare the sub-library ssDNA for the next round of SELEX from the PCR double-stranded product. The PCR-amplified DNA products were separated by electrophoresis in a 12% denaturing PAGE gel, and the desired gel was cut and transferred to a 5mL centrifuge tube. The desired gel was placed in a dialysis bag and electrodialyzed in a 0.25×TBE electrophoresis solution. The resulting electrodialyzed solution was centrifuged and concentrated to about 500μL. 1 / 10 volume of 3M sodium acetate solution, 1 / 100 volume of 1M magnesium chloride solution, 5μL of 1mg / mL linear acrylamide, and 3 volumes of anhydrous ethanol were added to the concentrate and placed at -80℃ for 30min to precipitate the DNA. The supernatant was discarded and washed three times with 75% ethanol. After drying, the secondary nucleic acid library was obtained for subsequent screening.

[0065] (2) The 3rd and 4th rounds of reverse screening + forward screening (GO-SELEX)

[0066] Reverse screening: Denature the secondary nucleic acid library at 95℃ for 10min, and immediately place it in an ice bath for 10min. Add 2nmol of a mixture of Clenbuterol, Enrofloxacin, Erythromycin A, Virginiamycin M1, and Tetracycline to the ssDNA, and incubate it on a shaker at 25℃ for 2h. Add graphene oxide, incubate at 25℃ for 60min; centrifuge at 20000g for 30min; at this time, the ssDNA that is not bound to the reverse screening material will bind to the graphene oxide through the stacking effect of π-π bonds, adsorb on the graphene oxide and enter the precipitate, while the ssDNA bound to the reverse screening material will not bind to the graphene oxide and remain in the solution.

[0067] Positive screening: add 2 nmol of avermectin B1a to the precipitate, make up to 300 μL with 1×TGK, incubate on a shaker at 25°C for 2 hours, and the nucleic acid aptamer with high affinity to avermectin B1a will bind to avermectin B1a. Avermectin B1a changes the spatial structure of ssDNA, allowing ssDNA to dissociate from the graphene oxide precipitate and remain in the solution. Therefore, the supernatant is used as a template for PCR amplification, and the PCR product is separated and purified, and the obtained ssDNA secondary library can be used for the next round of screening.

[0068] (3) 5th to 7th rounds of positive screening (CE-SELEX)

[0069] 50 μg / mL of avermectin B1a was incubated with 5 μM secondary library solution at 25°C for 60 min, the mixture was injected at 50 mbar pressure for 10 s, and the separation voltage was set to 25 kV; the aptamers bound to avermectin B1a were collected in an injection bottle pre-filled with 20 μL of deionized water (as a PCR template); each round of CE-based complex separation was performed 5 times to obtain sufficient PCR templates, and the PCR products were separated and purified, and the prepared ssDNA secondary library could be used for the next round of screening.

[0070] (IV) Determination of the number of screening rounds

[0071] Capillary electrophoresis was used to evaluate the affinity of the ssDNA in each round of the sub-library, and the change in the peak area of ​​ssDNA after the addition of avermectin B1a was used to characterize the change in affinity after each round of screening; the peak area change percentage RA (%) = (I0-I1) / I0×100%, where I0 is the peak area of ​​5 μM ssDNA, and I1 is the peak area of ​​ssDNA after adding different concentrations of avermectin B1a. The larger the RA, the stronger the affinity of ssDNA to avermectin B1a.

[0072] The results are as follows Figure 3 As shown, the graphene oxide method was used for forward screening in rounds 1-2. In the second round, the initial enrichment was performed and the affinity increased. In the third round, the anti-screening target was added, and the affinity decreased slightly. However, in the fourth round, even the anti-screening did not hinder the increase in affinity. In rounds 5-7, efficient CE-SELEX was performed, and ssDNA that could bind to avermectin B1a was rapidly enriched. In the seventh round, the affinity no longer increased, indicating that the ssDNA that could bind to avermectin B1a tended to be saturated. Therefore, the screening was terminated in the seventh round.

[0073] (V) Cloning and sequencing

[0074] The ssDNA obtained in the seventh round of screening was amplified by PCR, and after gel excision, recovery and purification, high-throughput sequencing was performed. The top 15 sequences with the highest enrichment are shown in Table 1. The base composition of each sequence was calculated using the software DNAMAN 8.0 (Lynnon Biosoft, USA). It was found that the content of guanine (G) and cytosine (C) was generally high, indicating that the secondary structure of these sequences was relatively stable. In addition, the enrichment of the top 5 sequences was not less than 2.74%, among which Seq 1 had the highest enrichment, reaching 15.37%. Homology analysis was performed using DNAMAN software ( Figure 4 ), the 15 sequences were divided into three families, and the homology of the three families was 47%, 60% and 52%, respectively. In each family, Seq 1, Seq 2 and Seq 5 with the highest enrichment were selected for synthesis.

[0075] Table 1 The top 15 sequences with the highest enrichment

[0076]

[0077]

[0078] (VI) Affinity characterization of candidate nucleic acid aptamers

[0079] The equilibrium dissociation constant K of aptamers Seq 1, Seq 2, and Seq 5 was calculated. d Different concentrations of avermectin B1a were added to 5 μM ssDNA, and the affinity was expressed by the percentage change in the peak area (RA) of ssDNA. The nonlinear saturation curve of RA changing with the concentration of avermectin B1a was fitted using the software GraphPadPrism 8 to obtain the dissociation constant. Figure 5 , Figure 6 and Figure 7 As shown, the K values ​​of aptamers Seq 1, Seq 2, and Seq 5 are d The values ​​were 69.84±10.22nM, 116.9±20.3nM and 230.9±65.45nM, respectively. Among them, the K d The smallest value indicates the highest affinity.

[0080] (VII) Truncation of aptamer Seq 1 and its affinity evaluation

[0081] Relevant studies have shown that not all nucleotide sequences on the aptamer are involved in the process of the aptamer recognizing and binding to the target. In the design and application of nucleic acid aptamer sensors, redundant nucleotide sequences may interfere with the binding of the aptamer to the target, thereby affecting the construction effect of the sensor. Generally speaking, the sequence of the primer binding region will not enhance or restrict the binding characteristics of the aptamer, but will only minimally participate in the overall structure formation of the aptamer. Therefore, the candidate aptamer sequence Seq 1 with higher affinity was truncated, and the primer binding sequences P1 and P2 of Seq 1 were removed, leaving only the middle sequence, which was named Seq1-1 (5'GGTAGTGGGAATGTCCCAAAGCTGTACATCACGGTGCCTT3', as shown in SEQ ID NO.1). The affinity was evaluated, and the results are as follows: Figure 8 , compared with the original truncation, the K of Seq 1-1 d (63.13±8.91nM) value is lower and the affinity is higher.

[0082] 50 μg / mL of clenbuterol, enrofloxacin, erythromycin A, tetracycline, virginiamycin M1, and avermectin B1a were added to 5 μM ssDNA and incubated at room temperature for 60 min. The specificity of aptamer Seq1-1 was tested by capillary electrophoresis. The larger the RA, the stronger the specificity. Fig. 9 As shown, aptamer Seq 1-1 was significantly specific to avermectin B1a (p<0.001).

[0083] 2. Colorimetric detection of peroxidase mimicking activity of ruthenium nanoparticles (Ru NPs) regulated by oligonucleotides

[0084] (I) Sensor sensitivity test

[0085] The aptamer Seq 1-1 was dissolved in 1×TGK buffer, denatured violently at 95°C for 10 min, and then placed on ice for 10 min for the next study. 10 μL of Ru NPs solution (50 μg / mL) and 10 μL of Seq1-1 (12 μM) solution were placed in a 1.5 mL centrifuge tube and mixed thoroughly, and then incubated at 25°C for 30 min; 10 μL of different concentrations of avermectin B1a were added and incubated at 25°C for 30 min; 4 μL of H2O2 (800 mM), 4 μL of 3,3',5,5'-tetramethylbenzidine (TMB, 21 mM) and 100 μL of NaAc buffer (pH 4, 20 mM) were added to the above mixture, and H2O was added to 200 μL to obtain a catalytic reaction system. The absorbance of each system at 652 nm was measured, and ΔA (652 nm) was calculated, wherein ΔA = A1 (avermectin B1a standard solution, 652 nm) - A0 (blank, 652 nm); 10 μL H2O was used to replace the avermectin B1a standard solutions of different concentrations in the blank control.

[0086] Ru NPs have high peroxidase mimetic activity, catalyzing TMB and H2O2 to show blue. The oxidation product of TMB has a characteristic absorption peak at 652nm. After Ru NPs bind to the aptamer, the activity is inhibited, the absorbance decreases, and the blue color becomes lighter. After adding avermectin B1a, the aptamer relieves the inhibitory effect on the catalytic activity of Ru NPs, the absorbance increases, and the solution is blue.

[0087] The results are as follows Fig.10 As shown, the sensor has a good linear relationship in the range of 6.25nM-100nM, and the linear regression equation is y=0.003231x+0.02186(R 2=0.9911), and the minimum detection limit of avermectin B1a calculated by 3σ / slope was 5.86nM, which was lower than the maximum residue limit of meat, milk, and fruits and vegetables stipulated by the Ministry of Agriculture and Rural Affairs of China, indicating that the method established in the present invention can be used for the quantitative detection of avermectin B1a.

[0088] (II) Spike recovery test

[0089] Different concentrations of avermectin B1a were added to milk and tomatoes, and the spike recovery experiment was carried out using the aptamer-based nanoruthenium colorimetric method. As shown in Table 2, the spike recovery rates of different concentrations of avermectin B1a in milk and tomatoes were between 92.86% and 101.49%, and the RSD was between 2.27% and 6.45%. The above results show that the established sensor has good practicality and can be used for the residual detection of avermectin B1a in milk and tomatoes.

[0090] Table 2 Spiked detection of avermectin B1a in milk and tomatoes

[0091]

[0092] In summary, the present invention combines CE-SELEX and GO-SELEX technologies to prepare a high affinity and specific avermectin B1a nucleic acid aptamer Seq 1, and obtains Seq 1-1 with higher affinity by truncation. Nanoruthenium colorimetric experiments confirm that aptamer Seq 1-1 can be applied to visual detection of avermectin B1a, and it is time-consuming, simple to operate, and has a low detection limit. This technology provides new ideas and methods for the development and application of aptamers and the detection of avermectin B1a.

[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. An avermectin B1a aptamer, characterized in that: Its nucleic acid sequence is shown in SEQ ID NO.

1.

2. A detection reagent for avermectin B1a, characterized in that: It includes the avermectin B1a aptamer according to claim 1.

3. A detection kit for avermectin B1a, characterized in that: The method comprises the detection reagent according to claim 2.

4. A sensor for detecting avermectin B1a, characterized in that: It includes the avermectin B1a aptamer according to claim 1.

5. The avermectin B1a detection sensor according to claim 4, characterized in that: Also includes nano-ruthenium.

6. Use of the avermectin B1a aptamer according to claim 1, the detection reagent according to claim 2, the detection kit according to claim 3, or the detection sensor according to claim 4 or 5 in detecting avermectin B1a.

Images