Fluorescent aptamer sensor based on hybridization chain reaction and application thereof

Abstract

The invention belongs to the field of food safety detection, and particularly relates to a fluorescence aptamer sensor based on a hybridization chain reaction and application of the fluorescence aptamer sensor. The fluorescent aptamer sensor comprises a nucleic acid aptamer probe, a complementary chain probe and hairpin probes, wherein the hairpin probes comprise a first hairpin probe and a second hairpin probe. The high specificity of the nucleic acid aptamer and the signal amplification of the hybridization chain reaction are utilized, so that the selectivity and the sensitivity of AFM1 detection are improved, the kit has the advantages of isothermal amplification, high specificity, high sensitivity, low cost and the like, and the AFM1 can be simply, quickly, sensitively and specifically detected.

Description

Technical Field

[0001] The invention belongs to the field of food safety detection, and in particular relates to a fluorescent aptamer sensor based on hybridization chain reaction and application thereof. Background Art

[0002] Aflatoxin M1 (AFM1) is a hydroxylated metabolite in mammals after they ingest grain or feed contaminated with aflatoxin B1. It is highly carcinogenic and mutagenic, and is identified as a Class I carcinogen by the International Agency for Research on Cancer. It is present in high levels in dairy products. Countries around the world have set limits for AFM1 in dairy products. The EU stipulates that the maximum limit of AFM1 in raw milk is 0.05 μg / kg. Currently, the main methods for detecting AFM1 include high-performance liquid chromatography, liquid chromatography-mass spectrometry, gas chromatography-mass spectrometry, immunoaffinity chromatography, and enzyme-linked immunosorbent assay. Although the chromatographic detection method has high sensitivity and strong stability, the instrument cost is high, the sample pretreatment is complex, and it is not suitable for rapid on-site detection. Although the immunoassay is simple, rapid, and low-cost, the antibody preparation cycle is long. Therefore, there is an urgent need to develop a rapid detection technology for aflatoxin M1 that is highly sensitive, low-cost, and highly practical. Summary of the invention

[0003] The purpose of the present invention is to solve the deficiencies of the prior art and provide a fluorescent aptamer sensor based on hybridization chain reaction to achieve rapid detection of AFM1 contamination in food with high sensitivity, low cost and simple operation. The following technical solutions are specifically adopted:

[0004] A fluorescent aptamer sensor based on hybridization chain reaction comprises a nucleic acid aptamer probe, a complementary chain probe and a hairpin probe, wherein the hairpin probe comprises a first hairpin probe and a second hairpin probe, wherein the sequence of the first hairpin probe is GCTC ACTGA / iBHQ2dT / ACTGCTGGAGATAAGTCTAGGTCTCCAGCAGTA / iCy5dT / GGAT, the sequence of the second hairpin probe is TCTCCAGCAGTATCAGTGAGCTACTGCTGGAGACCTAGACTTA, the sequence of the nucleic acid aptamer probe is ACTGCTAGAGATTTTCCACAT, and the sequence of the complementary chain is TCTCCA GCAGTATCAGTGAGC.

[0005] Among them, the nucleic acid aptamer probe and the complementary chain probe can form a partial double chain. The quenching group BHQ2 modified at the 5' end of the first hairpin probe and the fluorescent group Cy5 modified at the 3' end are close to each other, and the emission spectrum of Cy5 overlaps with the absorption spectrum of BHQ2. Fluorescence resonance energy transfer (FRET) can occur between the two, and the fluorescence of Cy5 is quenched. When the above-mentioned fluorescent aptamer sensor is used in the detection of AFM1, the nucleic acid aptamer probe can specifically recognize and bind to aflatoxin M1, and the nucleic acid aptamer conformation is converted, thereby releasing the complementary chain probe; at room temperature, the complementary chain probe can activate the first hairpin probe to open the hairpin structure, and the activated first hairpin probe and the second hairpin probe self-assemble to form a stable double-chain structure. The Cy5 modified on the first hairpin probe is away from BHQ2, the fluorescence signal is restored, the fluorescence intensity of the system changes, and the AFM1 can be quantitatively detected. The present invention utilizes the high specificity of nucleic acid aptamers and the signal amplification of hybridization chain reaction to improve the selectivity and sensitivity of AFM1 detection, has the advantages of constant temperature amplification, strong specificity, high sensitivity, etc., and can realize simple, rapid, highly sensitive and highly specific detection of AFM1.

[0006] The method for detecting aflatoxin M1 using the fluorescent aptamer sensor based on hybridization chain reaction comprises the following steps:

[0007] (1) dissolving the nucleic acid aptamer probe, the complementary chain probe, the first hairpin probe and the second hairpin probe in a buffer solution to obtain a nucleic acid aptamer probe solution, a complementary chain probe solution, a first hairpin probe solution and a second hairpin probe solution, respectively;

[0008] (2) heating the nucleic acid aptamer probe solution, the first hairpin probe solution and the second hairpin probe solution in step (1) respectively, and cooling them for standby use; the heating temperature is 85° C.-95° C., and the heating time is 5 min;

[0009] (3) incubating the nucleic acid aptamer probe solution obtained in step (2) with the complementary chain probe solution;

[0010] (4) adding the sample solution to be tested to the system obtained in step (3) and incubating with shaking for 1 h;

[0011] (5) Continue to add the buffer solution, the first hairpin probe solution and the second hairpin probe solution, continue to shake and incubate, and then detect the intensity of the fluorescence signal to detect aflatoxin M1 in the sample solution.

[0012] Wherein, in step (1), the concentrations of the nucleic acid aptamer probe solution, the complementary strand probe solution, the first hairpin probe solution and the second hairpin probe solution are all 5 μM. The buffer solution is a Tris-HCl buffer solution with a pH of 7.4.

[0013] Wherein, in step (5), the buffer solution is a Tris-HCl buffer solution, including 300 mM NaCl and 5 mM MgCl2, with a pH of 8.2. The incubation temperature is 37° C., and the incubation time is 3 h.

[0014] Wherein, in step (2), the cooling time is not less than 4 hours.

[0015] Wherein, in step (3), the incubation temperature is 37° C. and the incubation time is 30 min.

[0016] Wherein, in step (4), the incubation temperature is 37°C.

[0017] The beneficial effects of the present invention are as follows: the present invention utilizes the high specificity of nucleic acid aptamers and the signal amplification of hybridization chain reaction to improve the selectivity and sensitivity of AFM1 detection, and has the advantages of constant temperature amplification, strong specificity, high sensitivity, and low cost (nucleic acid aptamer probes, complementary chain probes, and hairpin probes can all be synthesized in vitro, overcoming the disadvantages of long antibody preparation cycle, difficult storage, and high cost, and significantly reducing production costs), and can achieve simple, rapid, highly sensitive, and highly specific detection of AFM1. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shown is a diagram of the HCR reaction system CDNA optimization results;

[0019] Figure 2 The figure shows the principle schematic diagram of the fluorescent aptamer sensor based on hybridization chain reaction for rapid and sensitive detection of aflatoxin M1 in the present invention;

[0020] Figure 3 Shown is the hybridization chain reaction electrophoresis diagram of the present invention;

[0021] Figure 4 Shown are fluorescence spectra of aflatoxin M1 detected by the fluorescent aptamer sensor based on hybridization chain reaction of the present invention under different conditions. DETAILED DESCRIPTION

[0022] The concept and technical effects of the present invention will be clearly and completely described below in conjunction with the embodiments and drawings to fully understand the purpose, scheme and effects of the present invention.

[0023] Example 1: Optimization of complementary chain probe sequence

[0024] The sequence of the optimized complementary chain probe is shown in Table 1; the sequences of the aptamer probe (Aptamer), the first hairpin probe H1, and the second hairpin probe H2 are shown in Table 2.

[0025] Table 1

[0026]

[0027] Table 2

[0028]

[0029] The details are as follows:

[0030] Before opening the cover for the first time, the nucleic acid aptamer probe and complementary chain probe were centrifuged and dissolved in a buffer solution (Tris-HCl buffer, pH 7.4) to prepare a 100 μM stock solution, which was then diluted to a nucleic acid aptamer probe solution and a complementary chain probe solution and stored at 4°C. The nucleic acid aptamer probe solution 5 μM was heated to 95°C and then gradually cooled to room temperature (cooling time was not less than 4h) and kept for later use.

[0031] Then, the nucleic acid aptamer probe solution and complementary chain probe solutions of different sequences (CDNA1 to CDNA10) were added to the centrifuge tubes, mixed thoroughly, and then 5 ng / ml AFM1 was added, reacted at 37°C for 1 h, and then 10 μL Genefinder 100× dye was added, and the fluorescence signal intensity was detected after 10 min.

[0032] from Figure 1 It can be seen that in the optimization process of the complementary chain probe sequence, when CDNA8 is used as a complementary chain probe and hybridized with the nucleic acid aptamer, the fluorescence signal change (ΔF) is most significant after adding AFM1. Therefore, the best complementary chain probe sequence in this experiment is CDNA8.

[0033] Embodiment 2:

[0034] Establishment of a fluorescent aptamer sensor for detecting aflatoxin M1 based on hybridization chain reaction:

[0035] The nucleic acid aptamer probe, complementary chain probe, first hairpin probe and second hairpin probe shown in Table 2 of Example 1 and represented by CDNA8 were centrifuged before opening the cover for the first time, respectively dissolved in a buffer solution (Tris-HCl buffer, pH 7.4) to prepare a stock solution with a concentration of 100 μM, and then diluted to form a nucleic acid aptamer probe solution, a complementary chain probe solution, a first hairpin probe solution and a second hairpin probe solution, respectively, and stored at 4°C for use.

[0036] Then, 5 μM of the nucleic acid aptamer probe solution, 5 μM of the first hairpin probe solution and 5 μM of the second hairpin probe solution were heated to 95° C. and then gradually and slowly cooled to room temperature (cooling time 4 h) and kept for later use.

[0037] Perform the following operations respectively:

[0038] (1) Add Tris-HCl buffer with a pH of 7.4 to the centrifuge tube and react at 37°C for 30 minutes; then add Tris-HCl buffer with a pH of 8.5 and react at 37°C for 1 hour; then add 5 μM of the first hairpin probe solution in Tris-HCl buffer with a pH of 8.2 containing 300 mM NaCl and 5 mM MgCl2 and react at 37°C for 3 hours, and detect the fluorescence signal intensity. The results are as follows: Figure 4 (a) shown.

[0039] (2) Add Tris-HCl buffer with a pH of 7.4 to the centrifuge tube, react at 37°C for 30 minutes, then add Tris-HCl buffer with a pH of 8.5, react at 37°C for 1 hour to obtain a mixed solution; then add 5 μM of the first hairpin probe solution and 5 μM of the second hairpin probe solution to Tris-HCl buffer with a pH of 8.2 and containing 300 mM NaCl and 5 mM MgCl2, react at 37°C for 3 hours, and detect the fluorescence signal intensity. The results are shown in Figure 2. Figure 4 (b) as shown.

[0040] (3) Add 100nM complementary chain probe solution in Tris-HCl buffer at pH 7.4 to the centrifuge tube, react at 37°C for 30min to obtain a mixed solution; continue to add Tris-HCl buffer at pH 8.5, react at 37°C for 1h; continue to add 5μM first hairpin probe solution and 5μM second hairpin probe solution in Tris-HCl buffer at pH 8.2 containing 300mM NaCl and 5mM MgCl2, react at 37°C for 3h, and detect the fluorescence signal intensity. The results are as follows Figure 4 (c) as shown.

[0041] (4) Add 100nM aptamer probe solution and 100nM complementary chain probe solution to the centrifuge tube, react at 37℃ for 30min to obtain a mixed solution; continue to add 5ng / ml AFM1 solution, react at 37℃ for 1h to obtain a mixed solution; continue to add 5μM first hairpin probe solution and 5μM second hairpin probe solution in Tris-HCl buffer with pH 8.2 and containing 300mM NaCl and 5mM MgCl2, react at 37℃ for 3h, and detect the fluorescence signal intensity. The results are as follows Figure 4 (d) as shown.

[0042] (5) Add 100nM nucleic acid aptamer probe solution and 100nM complementary chain probe solution to the centrifuge tube, react at 37℃ for 30min to obtain a mixed solution; continue to add Tris-HCl buffer with a pH of 8.5, react at 37℃ for 1h to obtain a mixed solution; continue to add 5μM of the first hairpin probe solution and 5μM of the second hairpin probe solution in Tris-HCl buffer with a pH of 8.2 and containing 300mM NaCl and 5mM MgCl2, react at 37℃ for 3h, and detect the fluorescence signal intensity. The results are as follows Figure 4 (e) as shown.

[0043] pass Figure 4 From the fluorescence spectrum, it can be concluded that when the AFM1 is present, the fluorescence signal intensity is the largest. Therefore, the fluorescence aptamer sensor based on hybridization chain reaction can effectively quantitatively detect aflatoxin M1 according to the change of fluorescence signal intensity. The specific detection principle is as follows Figure 2 As shown; the hybridization chain reaction electrophoresis diagram is shown Figure 3 shown.

[0044] The above is only a preferred embodiment of the present invention. The present invention is not limited to the above implementation. As long as the technical effect of the present invention is achieved by the same means, it should belong to the protection scope of the present invention. Within the protection scope of the present invention, its technical scheme and / or implementation method can have various modifications and changes.

Claims

1. A fluorescent aptamer sensor based on hybridization chain reaction, characterized in that: It includes a nucleic acid aptamer probe, a complementary chain probe and a hairpin probe, the hairpin probe includes a first hairpin probe and a second hairpin probe, the sequence of the first hairpin probe is GCTCACTGA / iBHQ2dT / ACTGCTGGAGATAAGTCTAGGTCTCCAGCAGTA / iCy5d T / GGAT, the sequence of the second hairpin probe is TCTCCAGCAGTATCAGTGAGCTACTGCTGGAGACC TAGACTTA, the sequence of the nucleic acid aptamer probe is ACTGCTAGAGATTTTCCACAT, and the sequence of the complementary chain is TCTCCAGCAGTATCAGTGAGC.

2. Use of the hybridization chain reaction-based fluorescent aptamer sensor according to claim 1 in detecting aflatoxin M1.

3. A method for detecting aflatoxin M1 using the fluorescent aptamer sensor based on hybridization chain reaction according to claim 1, characterized in that: The following steps are involved: (1) dissolving the nucleic acid aptamer probe, the complementary chain probe, the first hairpin probe and the second hairpin probe in a buffer solution to obtain a nucleic acid aptamer probe solution, a complementary chain probe solution, a first hairpin probe solution and a second hairpin probe solution, respectively; (2) heating the nucleic acid aptamer probe solution, the first hairpin probe solution and the second hairpin probe solution in step (1) respectively, and cooling them for standby use; the heating temperature is 85° C.-95° C., and the heating time is 5 min; (3) incubating the nucleic acid aptamer probe solution obtained in step (2) with the complementary chain probe solution; (4) adding the sample solution to be tested to the system obtained in step (3) and incubating with shaking for 1 h; (5) Continue to add the buffer solution, the first hairpin probe solution and the second hairpin probe solution, continue to shake and incubate, and then detect the intensity of the fluorescence signal to detect aflatoxin M1 in the sample solution.

4. The method according to claim 3, characterized in that In step (1), the concentrations of the aptamer probe solution, the complementary strand probe solution, the first hairpin probe solution and the second hairpin probe solution are all 5 μM.

5. The method according to claim 3, characterized in that: In step (1), the buffer solution is Tris-HCl buffer with a pH of 7.

4.

6. The method according to claim 3, characterized in that In step (5), the buffer solution is a Tris-HCl buffer solution including 300 mM NaCl and 5 mM MgCl2, with a pH of 8.

2.

7. The method according to claim 3, characterized in that In step (2), the cooling time is not less than 4 hours.

8. The method according to claim 3, characterized in that In step (3), the incubation temperature is 37° C. and the incubation time is 30 min.

9. The method according to claim 3, characterized in that: Step (4), the incubation temperature is 37°C.

10. The method according to claim 3, characterized in that Step (5), the incubation temperature is 37°C and the incubation time is 3h.

Images