SNP marker and application of a gene regulating cotton bract leaf type

Abstract

This invention discloses an SNP marker for a cotton bract leaf type regulating gene and its application. It belongs to the field of molecular biology technology. The SNP marker of this invention can be amplified using KASP-specific primers as shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7. TM-1 (SEQ ID NO.1) and MD90ne (SEQ ID NO.3) have the same phenotype and genotype, and T582 (SEQ ID NO.2) and MD51ne (SEQ ID NO.4) have the same phenotype and genotype. The marker of this invention co-segregates with the cotton narrow-curled bract gene, exhibiting high specificity and reliable identification. It can efficiently and stably detect the cotton narrow-curled bract gene fg, and rapidly and accurately assist in the selection of cotton with the narrow-curled bract trait. This enables high-throughput screening of this gene in large breeding populations within a short period, effectively improving breeding efficiency and serving cotton molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of plant molecular genetics, specifically to a gene regulating the leaf width of cotton bracts and its KASP molecular marker and application. Background Technology

[0002] Cotton (Gossypium) belongs to the genus Gossypium in the family Malvaceae. As one of the world's most important agricultural and economic crops, cotton plays a vital role in the textile and edible oil industries. The cotton husk is an indispensable modified leaf organ during cotton growth and development. In upland cotton, island cotton, and Asian cotton, flower bud development is generally accompanied by three husks, which fold together to form a triangular shape. These husks protect the young flower buds while also undertaking some photosynthesis. In many plants, husks fall off after the flower buds and flower clusters unfold. However, cotton husks do not gradually wither away after fertilization; they accompany the cotton throughout flowering and boll maturation, until the fibers mature and they wither and fall off along with the boll husk. Therefore, the cotton husk-related trait—narrow, rolled husks—is an important agronomic trait that can be used for selective breeding.

[0003] Narrowly rolled husks, an important insect-resistant trait in cotton, have received attention from various countries and regions since the 1970s. Numerous experiments have shown that cotton with narrowly rolled husks, where the husks are no longer tightly wrapped around the flower buds, allows for a relatively larger amount of insecticide to adhere to the buds. This also prevents boll weevils, bollworms, and pink bollworms from hiding under the husks, thus increasing insecticidal efficiency. Besides improving insecticidal efficiency, narrowly rolled husks also facilitate artificial self-pollination and harvesting, especially since dried husks no longer mix with the fibers during harvesting. Furthermore, as a modified leaf, the husk also contributes to photosynthesis. Measurements show that the photosynthetic intensity of the husk is 20%-28% of that of the leaf; removing the husk can reduce boll weight by 5.7%-18.3%, indicating that the husk makes a significant contribution to increasing boll weight. While the narrow-curled bract gene does not significantly affect the leaf area, specific leaf weight, and chlorophyll content of cotton plants, it leads to wrinkled leaf growth, decreased net photosynthetic rate, smaller bract area, reduced dry matter accumulation, and a decreased allocation rate of organic matter to reproductive organs. Cotton plants exhibiting the narrow-curled bract trait show no significant changes in chlorophyll content, leaf area, or specific leaf weight, but their photosynthetic rate is significantly reduced, their accumulated dry matter is significantly decreased, and the relative percentage of organic matter allocated to reproductive organs is significantly lower. Their bract area is only 63% of that of normal bracts.

[0004] Narrowly curled bracts, a quality trait, have been valued by breeders since their first discovery in Arkansas, USA in 1940. In 1965, Kohel et al. transferred five mutant genes—narrowly curled bracts (fg), cup-shaped leaves (cu), stems without glands (gl1), clustered bolls (cl1), and yellow buds (v1)—into the upland cotton genetic standard line (TM-1), thus creating the recessive multi-marker gene line (T582). In 1983, Endrizzi et al. located the narrowly curled bracts gene on chromosome A03. In the 1990s, with the development of first- and second-generation sequencing technologies, the entire genome of upland cotton TM-1 was sequenced. Breeders have successfully cloned these genes using map-based cloning technology, and the narrowly curled bract gene has been precisely mapped.

[0005] Since there is very little research on cotton husk-related genes and husk growth and development to date, exploring cotton husk-related traits and superior genotypes can not only provide reliable molecular markers for cotton breeding, but also deepen our understanding of the husk growth and development mechanism and further discover the greater application value of husk-related genes. Summary of the Invention

[0006] The main objective of this invention is to address the shortcomings of existing technologies by providing an SNP marker for a cotton bract leaf type regulatory gene and its application.

[0007] In a first aspect, this invention provides an SNP marker for a gene regulating the bract leaf type in cotton. This marker is located on chromosome A03 of upland cotton at position A03:2962980. In mutants, a base transition occurs at this site. When the genotype at this site is GG, the bracts are normal; when the genotype at this site is AA, the bracts are narrow and curled; and when the genotype at this site is G&A, the bract morphology is intermediate (heterozygous). Therefore, this site exhibits G / A polymorphism.

[0008] In a second aspect, the present invention provides the application of the SNP marker of the cotton bract leaf type regulating gene in the identification of the narrow-rolled bract trait in cotton seedlings.

[0009] The specific application is as follows:

[0010] The genotype of the SNP marker mentioned above was detected during the cotton seedling stage. If the genotype of the SNP marker was GG, the cotton husk was wild-type; if the genotype of the SNP marker was G&A, the cotton husk was an intermediate type of wild-type and narrow-curled husk; if the genotype of the SNP marker was AA, the cotton husk was narrow-curled husk.

[0011] Since the detection of the above polymorphisms is completed by KASP genotyping, the present invention also provides KASP test primers for the above SNP markers: fg_3AlleleFAM F; fg_3AlleleHEX F; fg_3Common R.

[0012] fg_3AlleleFAM F:

[0013] GAAGGTGACCAAGTTCATGCTCACCCTCAAATGTTTAGACT(SEQ ID NO.5)

[0014] fg_3AlleleHEX F:

[0015] GAAGGTCGGAGTCAACGGATTCACCCTCAAATGTTTAGACC(SEQ ID NO.6)

[0016] fg_3Common R:

[0017] GAATCGTCTGCAATCACTTTTC(SEQ ID NO.7)

[0018] A third aspect of the present invention provides an application of the SNP marker of the cotton bract leaf type regulating gene in cotton-assisted breeding, specifically:

[0019] By detecting the genotype of the SNP markers mentioned above during the cotton seedling stage, the bract leaf type of cotton can be determined, and cotton seedlings with narrow and rolled bracts can be selected for cultivation, thus shortening the breeding cycle.

[0020] In a fourth aspect, the present invention provides a method for identifying the narrow-rolled bracts of cotton seedlings, specifically:

[0021] The genotype of the SNP marker at the cotton seedling stage was detected. If the genotype of the SNP marker was GG, the cotton husk was wild-type; if the genotype of the SNP marker was G&A, the cotton husk was an intermediate type between wild-type and narrow-curled husk; if the genotype of the SNP marker was AA, the cotton husk was narrow-curled husk. The SNP marker was located at A03:2961992 or at position 1676 of the fg gene.

[0022] This invention also provides a method for detecting the genotype of SNP markers in cotton seedlings, specifically:

[0023] 1) Extract total DNA from cotton seedlings to be tested;

[0024] 2) Standardize the DNA concentration to approximately 10-20 ng / μL;

[0025] 3) Sample loading and mixing preparation: Transfer the diluted DNA to a 96-well PCR plate, adding 2 ddH2O (NTC) molecules per plate as a control. Prepare the PCR system: 0.8 μL of 2x KASP Master mix + Assay (primer mixture), 0.8 μL of DNA, for a total reaction volume of 1.6 μL.

[0026] 4) Add the PCR system to the array tape membrane containing the DNA template;

[0027] The IntelliQube SNP gene detection platform was used to develop a program. The array tape, DNA sample plate, and KASP genotyping mixture were placed into the machine in sequence. The machine was operated to execute the program, which automatically performed the process of dispensing and sealing the array tape with DNA sample dilution solution and KASP genotyping mixture.

[0028] 5) PCR

[0029] PCR reactions can be performed in the IntelliQube machine in SNP genotyping inline mode (single membrane) or in the Hydrocycler machine in SNP genotyping outline mode (multiple membranes) for water bath PCR. The program settings are: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 61-55℃ extension for 60 sec, 10 cycles; 94℃ denaturation for 20 sec, 55℃ extension for 60 sec, 26 cycles.

[0030] 6) Fluorescence data reading and analysis

[0031] After the PCR reaction was completed, fluorescence data were read and analyzed using an IntelliQube machine.

[0032] The fluorescent connectors used FAM for excitation at 485 nm and emission at 520 nm; HEX for excitation at 535 nm and emission at 556 nm; and ROX for excitation at 575 nm and emission at 610 nm. If the fluorescence signal is low or the clustering is scattered after the above reactions, additional cycles can be added before fluorescence reading. The cycling conditions are: denaturation at 94°C for 20 seconds, extension at 57°C for 60 seconds, for 3 cycles.

[0033] The beneficial effects of this invention are: the marker of this invention co-segregates with the cotton narrow-curled bract gene, has high specificity and reliable identification, can efficiently and stably detect the cotton narrow-curled bract gene fg, and can quickly and accurately assist in the selection of cotton narrow-curled bract traits, realize high-throughput screening of this gene in a large breeding population in a short period of time, effectively improve breeding efficiency, and serve cotton molecular breeding. Attached Figure Description

[0034] Figure 1 The sequence alignment results of the TM-1, T582, MD90ne, and MD51ne fg alleles in Example 1 are shown in the figure, which shows the segments with differences in sequence alignment.

[0035] Figure 2 The results of genotyping in the narrow-curled bract phenotype populations of parents TM-1, T582 and F2 using the SNP markers of the present invention and KASP primers in Example 2 are shown. Detailed Implementation

[0036] Example 1: Obtaining SNP sites

[0037] Besides T582, the upland cotton material MD51ne also exhibits a narrow-curled bract phenotype, while upland cotton materials MD90ne and TM-1 have normal bracts. Therefore, in this embodiment, total DNA was extracted from TM-1, T582, MD90ne, and MD51ne, respectively. The DNA concentration was calibrated to 200 ng / μL using a NanoDrop micro-volume biological detector before PCR amplification. The PCR amplification system was prepared as follows: 1 μl of forward primer (10 μM), 1 μl of reverse primer (10 μM), 10 μl of 2x Phanta Max Buffer, 1 μl of dNTP Mix, 1 μl of Phanta Max Super-Fidelity DNA Polymerase, 5 μl of ultrapure water, and 1 μl of template DNA (50 ng / μl). The total volume of the reaction system was 20 μl. The forward primer is fg F: TGGATTTGTTGGCTTCCAAT (SEQ ID NO.8); the reverse primer is fg R: TGGAGTCGTGTTTGGTGACT (SEQ ID NO.9).

[0038] The PCR amplification reaction program was set as follows: 98℃ pre-denaturation for 3 min; 98℃ pre-denaturation for 30 s, 55℃ annealing for 30 s; 72℃ extension for 2 min, 72℃ complete extension for 10 min; 34 cycles.

[0039] After performing gel electrophoresis on the PCR reaction materials, the target band of the correct size was recovered and sequenced.

[0040] The CDS sequences of the fg genes described in TM-1, T582, MD90ne, and MD51ne (wherein the CDS sequence of the fg gene in TM-1 is shown in SEQ ID NO.1, the CDS sequence of the fg gene in T582 is shown in SEQ ID NO.2, the CDS sequence of the fg gene in MD90ne is shown in SEQ ID NO.3, and the CDS sequence of the fg gene in MD51ne is shown in SEQ ID NO.4) were compared in normal husk and narrow-curled husk cotton. Some sequences showing differences are as follows: Figure 1 As shown, compared with T582 and MD51ne, TM-1, MD90ne, and T582, MD51ne, there are a total of 6 SNP sites and 1 three-base deletion mutation (InDel), located at the following gene locations: G 688 -A 688 (Chromosome location A03:2961992), T 803 -C 803 (Chromosome location A03:2962107), T 865 -A 865 (Chromosome location A03:2962169), G 871 -T 871 (Chromosome position A03:2962175), A 1293 -C 1293 (Chromosome location A03:2962597), G 1676 -A 1676 (Chromosome location A03:2962980), InDel location: CAA 1420-1422 Deletion (chromosomal location A03:2963236); subscripts indicate the location in the fg gene of the TM-1 genome. When designing primers around these mutations, G was chosen. 1676 -A 1676 ( Figure 1 Primers with the designation number 7 as genotyping markers are more suitable for experimental requirements (such as GC content); this example selects this marker for verification.

[0041] This marker is located on chromosome A03 of upland cotton, at position A03:2962980. In mutants, the bases at this site undergo a transition. When the genotype at this site is GG, the bracts are normal wild-type; when the site is AA, the bracts are narrow and curled; and when the site is G&A, the bract morphology is intermediate (heterozygous). Therefore, this site exhibits G / A polymorphism.

[0042] Example 2: Application of SNP loci in the identification of narrow-rolled bracts in cotton or in assisted breeding

[0043] G obtained based on Example 1 1676-A 1676 SNP sites, designing KASP test primers:

[0044] fg_3AlleleFAM F(SEQ ID NO.5):

[0045] GAAGGTGACCAAGTTCATGCTCACCCTCAAATGTTTAGACT;

[0046] fg_3AlleleHEX F(SEQ ID NO.6):

[0047] GAAGGTCGGAGTCAACGGATTCACCCTCAAATGTTTAGACC;

[0048] fg_3Common R (SEQ ID NO.7):

[0049] GAATCGTCTGCAATCACTTTTC.

[0050] Using designed KASP primers, polymorphism was detected using KASP technology, and genotyping was performed on normal bracts (G:G), narrow-rolled bracts (A:A), and the F2 generation population. Details are as follows:

[0051] 1) Extract total DNA from the population to be tested: DNA was extracted from F1 and F2 generation plants (recessive homozygotes) of TM-1 and T582 upland cotton materials planted at the Nanjing Jiangpu base in 2015, as well as from the two parents.

[0052] 2) Standardize the DNA concentration to approximately 10-20 ng / μL;

[0053] 3) Sample loading and mixing preparation: Transfer the diluted DNA to a 96-well PCR plate, adding 2 ddH2O (NTC) molecules per plate as a control. Prepare the PCR system: 0.8 μL of 2x KASP Master mix + Assay (primer mixture), 0.8 μL of DNA, for a total reaction volume of 1.6 μL.

[0054] 4) Add the PCR system to the array tape membrane containing the DNA template;

[0055] The IntelliQube SNP gene detection platform was used to develop a program. The array tape, DNA sample plate, and PCR system were placed into the machine in sequence. The machine was operated to execute the program and automatically perform the processes of dispensing and sealing the array tape with DNA sample dilution solution and KASP genotyping mixture.

[0056] 5) PCR

[0057] PCR reactions can be performed in the IntelliQube machine in SNP genotyping inline mode (single membrane) or in the Hydrocycler machine in SNP genotyping outline mode (multiple membranes) for water bath PCR. The program settings are: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 61-55℃ extension for 60 sec, 10 cycles; 94℃ denaturation for 20 sec, 55℃ extension for 60 sec, 26 cycles.

[0058] 6) Fluorescence data reading and analysis

[0059] After the PCR reaction was completed, fluorescence data were read and analyzed using an IntelliQube machine.

[0060] The fluorescent connectors used FAM for excitation at 485 nm and emission at 520 nm; HEX for excitation at 535 nm and emission at 556 nm; and ROX for excitation at 575 nm and emission at 610 nm. If the fluorescence signal is low or the clustering is scattered after the above reactions, additional cycles can be added before fluorescence reading. The cycling conditions are: denaturation at 94°C for 20 seconds, extension at 57°C for 60 seconds, for 3 cycles.

[0061] Genotyping results as follows Figure 2 As shown: The three elliptical dashed boxes represent three different parents and individual plants with the same genotype as those parents. The point closest to the origin is the blank control (NTC), the dashed box closest to the vertical axis represents parent TM-1, the middle dashed box represents the F1 generation, and the dashed box closest to the horizontal axis represents parent T582 and individual plants with the same genotype as parent T582. The arrows within the dashed boxes point to parent T582. Since this experiment used F2 generation individual plants with the narrow-curled bract trait, as... Figure 2 As shown, this population has the same genotype as the parental T582, indicating that this SNP marker co-segregates with the narrow-curled bract trait. These results demonstrate that the KASP marker fg_3 can achieve correct genotyping in both bract parents and their progeny populations, and can serve as a functional molecular marker for the narrow-curled bract trait gene. Applying the SNP marker-assisted breeding technology of this invention allows for early identification during the cotton seedling stage, unaffected by developmental stage or external environment, and eliminates the need for testcross identification of post-transitional types, thus significantly shortening the breeding cycle.

[0062] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The application of a reagent for detecting SNP markers of cotton bract leaf type regulatory genes in the identification of narrow-rolled bract traits in upland cotton seedlings, characterized in that, The SNP marker is located in the gene fg At position 1676, the SNP marker exhibits G / A polymorphism; the gene fg The CDS sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The specific application is as follows: The genotype of the SNP marker mentioned above was detected during the cotton seedling stage. If the genotype of the SNP marker was GG, the cotton husk was wild-type; if the genotype of the SNP marker was G&A, the cotton husk was an intermediate type of wild-type and narrow-curled husk; if the genotype of the SNP marker was AA, the cotton husk was narrow-curled husk.

3. The application according to claim 2, characterized in that, The primers used to detect the genotype of the SNP markers mentioned above during the cotton seedling stage were forward primers. fg _3 AlleleFAM F、 fg _3 AlleleHEX F and reverse primer fg _3 Common R, where the forward primer fg The nucleotide sequence of _3 AlleleFAM F is shown in SEQ ID NO.5; forward primer fg The nucleotide sequence of _3 AlleleHEXF is shown in SEQ ID NO.6; reverse primer fg The nucleotide sequence of _3 Common R is shown in SEQ ID NO.

7.

4. The application of a reagent for detecting SNP markers of cotton husk leaf type regulatory genes in upland cotton cotton-assisted breeding, characterized in that... Specifically: By detecting the genotype of the SNP markers at the seedling stage of upland cotton, the bract leaf type of cotton can be determined, and cotton seedlings with narrow, rolled bracts can be selected for cultivation, thus shortening the breeding cycle; the SNP markers are located in the gene... fg At position 1676, the SNP marker exhibits G / A polymorphism; the gene fg The CDS sequence is shown in SEQ ID NO.

1.

5. A method for identifying the narrow-rolled bracts of upland cotton seedlings, characterized in that, Specifically: Genotypes of SNP markers in upland cotton seedlings were detected. If the genotype of the SNP marker was GG, the cotton husks were wild-type; if the genotype was G&A, the cotton husks were intermediate between wild-type and narrow-curled husks; if the genotype was AA, the cotton husks were narrow-curled husks. The SNP markers were located in the gene... fg The 1676th position of the gene fg The CDS sequence is shown in SEQ ID NO.1.

Images