Aspergillus L14-OE::laeA2 and application thereof in producing cyclic tripeptides

Abstract

The application discloses a kind of aspergillus L14-OE::laeA2 and application in the production of cyclic tripeptide compound, the aspergillus L14-OE::laeA2 fermentation product isolated by the aspochracin yield is 175mg / L, the yield of JBIR-15 is 100mg / L, the yield of sclerotiotide C is 25mg / L.Three kinds of compound yield are far higher than the compound yield in other literature report, and separation process is simple and economic.Cyclic tripeptide compound can be used to prepare antifungal activity medicine, antioxidant activity medicine, tumor cell activity inhibiting medicine and antitumor drug.At 10 μM concentration, JBIR-15 and sclerotiotide C have 11.78% and 21.09% inhibition rate on human hepatoma cell strain Hep-G2 respectively.

Description

(I) Technical Field

[0001] This invention belongs to the field of microbial pharmaceuticals and relates to an engineered Aspergillus sp. L14-OE::laeA2 that produces cyclic tripeptide compounds (JBIR-15, aspochacin, sclerotiotide C), its construction method, and its applications. (II) Background Technology

[0002] In recent years, marine fungi have become a hot research topic in marine-derived natural product research, with many bioactive compounds discovered in their fermentation metabolites. As a member of the filamentous fungi family, *Aspergillus niger* possesses a rich biosynthetic gene cluster, enabling it to control the production of numerous secondary metabolites, mainly including six structural types: pyranones, alkaloids, amides, cyclic peptides, polyketides, and sterols. These compounds have significant medicinal value and enormous potential applications in agriculture and medicine.

[0003] Most biosynthetic gene clusters in filamentous fungi are silent under laboratory culture conditions, possessing a high potential for producing novel or high-yield compounds. Genome mining strategies (including regulation of transcription factors, promoter engineering, and heterologous expression) have been successfully developed and introduced in recent years to activate silent / low-expressed biosynthetic gene clusters for the discovery of novel or high-yield fungal secondary metabolites. The production of secondary metabolites is controlled by a complex gene regulatory network, including global regulation. LaeA, the first global regulator in filamentous fungi, was first discovered in *Aspergillus nidulans* in 2004 and plays a significant coordinating role in fungal development and secondary metabolism.

[0004] Cyclic lipopeptides are widely found in the metabolites of marine tunicates, sponges, algae, fungi, and bacteria. The structure of aspochracin-type cyclic tripeptides typically includes a unique macrocycle and a polyketide side chain. For the macrocycle, the most common feature is a twelve-membered ring (composed of alanine-valine-ornithine) or a thirteen-membered ring (composed of alanine-valine-lysine). Only 15 aspochracin-type cyclic tripeptides are obtained from natural sources, and their structures differ mainly in the polyketide side chain, amino group composition, and the level of n-methylation of the amino acid moiety, exhibiting varying antifungal, anti-inflammatory, and antioxidant activities. According to literature review, extremely low mammalian toxicity and recognized insecticidal activity (in silkworms and American moths) are two major characteristics of aspochracins. The metabolite aspochracin found in Aspergillus ochraceus has the highest potency (64 mg / L). The highest potency values ​​of JBIR-15, discovered in Aspergillus sclerotiorum Sp080903f04, and sclerotiotide C, discovered in Aspergillus sclerotiorum PT06-1, were 1.48 mg / L and 0.13 mg / L, respectively. JBIR-15 has been reported to have anti-Candida albicans activity (MIC = 30 μg / ml). However, the yields of existing biosynthetic methods are all low.

[0005] To date, there are no reports of strains producing high levels of JBIR-15, aspochacin, and sclerotiotide C-cyclic lipopeptides, and studies on their bioactivity are also limited. A global regulatory factor mining strategy may be an effective approach to uncover silent, unknown biosynthetic clusters in fungi and increase the yield of bioactive small molecule compounds. (III) Summary of the Invention

[0006] The purpose of this invention is to provide a high-yield cyclic tripeptide compound, Aspergillus sp. L14-OE::laeA2, and its applications, which solves the problem of low yield of cyclic tripeptide compounds such as JBIR-15, aspochacin, and sclerotiotide C, and discovers new applications for its use in antitumor and antioxidant pharmaceuticals, and is expected to be used as a drug lead compound in industrial production.

[0007] The technical solution adopted in this invention is:

[0008] This invention provides a high-yield cyclic tripeptide compound from Aspergillus sp. L14-OE::laeA2, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M20232057, deposited on October 27, 2023, at Wuhan University, Wuhan, China, 430072, China.

[0009] This invention overexpresses the LaeA fragment gene of the global regulatory factor into the genome of the original strain Aspergillus niger L14 (aspergillus niger symbiotic with sponges in Xinghai Bay, Dalian, Liaoning Province, China), to obtain an engineered strain Aspergillus niger L14-OE::laeA2 that can produce high yields of three cyclic tripeptide compounds: JBIR-15, aspochacin, and sclerotiotide C.

[0010] The specific steps of the method for constructing Aspergillus L14-OE::laeA2 in this invention are as follows:

[0011] (1) Using PCR and double enzyme digestion techniques, the global regulatory factor LaeA fragment gene in Aspergillus niger L14 was obtained, and a recombinant plasmid pCAMBIA-1301:LaeA containing the gene was constructed. The nucleotide sequence of the global regulatory factor LaeA is shown in SEQ ID NO.1.

[0012] (2) The plasmid obtained in step (1) was introduced into E.coli DH5α competent cells, and the transformants were picked and incubated overnight to amplify and extract the plasmid.

[0013] (3) The plasmid obtained in step (2) was introduced into Agrobacterium AGL-1 using the freeze-thaw method, and the plasmid was extracted.

[0014] (4) Under the induction of acetylsuccinone, the plasmid in step (3) was transferred into the genome of Aspergillus niger L14 by Agrobacterium-mediated fungal transformation to obtain the engineered strain Aspergillus L14-OE::laeA2 that produces high levels of JBIR-15, aspochacin, and sclerotiotide C.

[0015] This invention also provides the application of Aspergillus L14-OE::laeA2 in the production of cyclic tripeptide compounds. The application involves fermenting and culturing Aspergillus L14-OE::laeA2, separating and purifying the fermentation broth to obtain cyclic tripeptide compounds. The cyclic tripeptide compounds include compound (I, aspochacin), compound (II, JBIR-15), and compound (III, sclerotiotide C).

[0016]

[0017] The fermentation culture method of Aspergillus L14-OE::laeA2 according to the present invention includes the following steps:

[0018] (1) Inoculate Aspergillus L14-OE::laeA2 into PDA medium and activate it at 30℃ for 3-4 days. Then inoculate it into PDB medium and culture it at 30℃ and 180-200rpm for 3 days to obtain seed liquid.

[0019] (2) The seed liquid is inoculated into Czapek's medium at a volume concentration of 1-5% (preferably 3%) and cultured at 30°C and 180-200 rpm for 15 days to obtain the fermentation broth.

[0020] Preferably, the composition of the PDA culture medium in step (1) is: 20 g / L glucose, 200 g / L potato, 15-18 g / L agar, with distilled water as the solvent and natural pH; the final concentration composition of the PDB seed culture medium is: 200 g / L potato, 20 g / L glucose, with distilled water as the solvent and natural pH.

[0021] Preferably, the composition of the Czapek culture medium in step (2) is: 30 g / L sucrose, 3 g / L sodium nitrate, 0.5 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium chloride, 0.01 g / L ferrous sulfate, 1 g / L dipotassium hydrogen phosphate, with water as the solvent and natural pH.

[0022] The method for separating and purifying the fermentation broth according to the present invention is as follows: the fermentation broth is filtered through eight layers of gauze to separate the bacterial solution from the mycelium. An equal volume of ethyl acetate is added to the bacterial solution for extraction (preferably extracted twice, and the upper extracts are combined). The upper extract is concentrated by rotary evaporation under reduced pressure until it is dry, thus obtaining the crude fermentation extract. The crude extract is dissolved in chromatographic methanol and then diluted with chromatographic methanol. It is then filtered through a 0.22 μm organic filter. The filtrate is isocratically eluted using an analytical column of high performance liquid chromatography with acetonitrile:water at a volume ratio of 35:65 as the mobile phase. The eluents at 6-7 min, 8-9 min, and 10.8-11.2 min are collected. After removing the solvent by rotary evaporation, the eluents are dried at 25 °C to obtain compounds (I), (II), and (III), respectively.

[0023] The high-performance liquid chromatography (HPLC) conditions were as follows: HPLC instrument: UV-VIS; detector: Shimadzu SPD-M40; HPLC pump: Shimadzu LC-20AT; chromatographic conditions: analytical column, C18 column, 4.6×250mm; flow rate: 1.0ml / min; column temperature: 40℃; detection wavelength: 210nm; injection volume: 10μl.

[0024] The present invention also provides the application of the cyclic tripeptide compound prepared by Aspergillus L14-OE::laeA2 in the preparation of drugs with antioxidant activity.

[0025] This invention also provides the application of the cyclic tripeptide compound prepared from Aspergillus L14-OE::laeA2 in the preparation of drugs that inhibit tumor cell activity and antitumor drugs. The tumor cells include the human glial cell line HEB and the human liver cancer cell line Hep-G2.

[0026] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following: This invention constructs an engineered strain capable of high production of JBIR-15, aspochacin, and sclerotiotide C through genetic engineering. The yield of aspochacin isolated from the fermentation products of the engineered Aspergillus L14-OE::laeA2 is 175 mg / L, the yield of JBIR-15 is 100 mg / L, and the yield of sclerotiotide C is 25 mg / L. The yields of these three compounds are far higher than those reported in other literature, and the isolation process is simple and economical.

[0027] The cyclic tripeptide compounds obtained in this invention can be used to prepare drugs with antifungal activity, such as compound JBIR-15, which has an anti-Candida albicans MIC value of 32 μg / ml.

[0028] The cyclic tripeptide compounds obtained in this invention can be used to prepare drugs with antioxidant activity. Compounds JBIR-15, aspochacin, and sclerotiotide C all have moderate antioxidant activity.

[0029] The cyclic tripeptide compounds obtained in this invention can also be used to prepare drugs that inhibit tumor cell activity and anti-tumor drugs, wherein the tumor cells include the human glial cell line HEB and the human liver cancer cell line Hep-G2. At a concentration of 10 μM, JBIR-15 and sclerotiotide C showed inhibition rates of 11.78% and 21.09% against the human liver cancer cell line Hep-G2, respectively. (iv) Description of the attached drawings

[0030] Figure 1 Example 1: Gel electrophoresis image of PCR amplification products after enzyme digestion and purification in step 1; Lane M: DNA marker; Lane 1: PCR product after enzyme digestion and purification.

[0031] Figure 2 Example 1: Step 2, gel electrophoresis image of plasmid pCAMBIA1303-TrpC-Hygro-gpdA-GFP after restriction endonuclease digestion; Lane M: DNA marker, Lanes 1-4: Products after double digestion of plasmid pCAMBIA1303-TrpC-Hygro-gpdA-GFP.

[0032] Figure 3: Validation PCR gel image of overexpression plasmid pCAMBIA-1301:LaeA; Lane M: DNA marker; Lane 1: Validation gel image of the front interface PCR detection of the recombinant plasmid using verify1-F / R as top and bottom primers; Lane 2: Validation gel image of the back interface PCR detection of the recombinant plasmid using verify2-F / R as top and bottom primers.

[0033] Figure 4 : PCR gel image of colonies before and after transformation of plasmid pCAMBIA-1303:LaeA into Agrobacterium AGL-1; M: DNA marker; Lane 1: Original Agrobacterium strain AGL-1; Lanes 2 and 3: Agrobacterium strains successfully inoculated with plasmid.

[0034] Figure 5 The expression level of the LaeA gene in engineered strain L14-OE::laeA2 and wild-type strain L14 was detected by qPCR.

[0035] Figure 6 High-performance liquid chromatography analysis of fermentation products of strain L14-OE::laeA2; (A) is the detection spectrum of fermentation products of the original strain L14; (B) is the detection spectrum of fermentation products of the engineered strain L14-OE::LaeA1.

[0036] Figure 7 ESI-MS negative source image of the cyclic tripeptide aspochracin.

[0037] Figure 8 ESI-MS positive source image of the cyclic tripeptide aspochracin.

[0038] Figure 9 ESI-MS negative source image of cyclic tripeptide JBIR-15.

[0039] Figure 10 ESI-MS positive source image of cyclic tripeptide JBIR-15.

[0040] Figure 11 ESI-MS negative source image of cyclic tripeptide sclerotiotide C.

[0041] Figure 12 ESI-MS positive source image of sclerotiotide C, a cyclic tripeptide.

[0042] Figure 13 : cyclic tripeptide asochracin 1 1H NMR spectrum (in CDCl3).

[0043] Figure 14 : cyclic tripeptide asochracin13 C10 NMR spectrum (in CDCl3).

[0044] Figure 15 : Cyclic tripeptide JBIR-15 1 1H NMR spectrum (in CDCl3).

[0045] Figure 16 : Cyclic tripeptide JBIR-15 13 C10 NMR spectrum (in CDCl3).

[0046] Figure 17 HBMC diagram of cyclic tripeptide JBIR-15 (in CDCl3).

[0047] Figure 18 : sclerotiotide C, a cyclic tripeptide 1 1H NMR spectrum (in CDCl3). (V) Detailed Implementation

[0048] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0049] The culture medium used in the examples:

[0050] (1) PDB medium: 200g / L potato, 20g / L glucose, distilled water as solvent, natural pH.

[0051] (2) PDA medium is PDB medium with 15 g / L agar added.

[0052] (3) Fermentation medium (Czapek's medium): sucrose 30g / L, sodium nitrate 3g / L, sulfuric acid heptahydrate 0.5g / L, potassium chloride 0.5g / L, ferrous sulfate 0.01g / L, dipotassium hydrogen phosphate 1g / L, solvent is water, pH is natural.

[0053] (4) IM liquid culture medium: 2.05 g / L dipotassium hydrogen phosphate, 1.45 g / L potassium dihydrogen phosphate, 0.5 g / L ammonium sulfate, 0.5 g / L magnesium sulfate heptahydrate, 0.15 g / L sodium chloride, 0.066 g / L calcium chloride, 0.00248 g / L ferrous sulfate heptahydrate, 1.8 g / L glucose, 5 mL / L glycerol. Sterilize by moist heat at 121℃ for 20 min. When cooled to 50℃, add 40 mL / L of 1 mol / L 2-(N-morpholine) ethanesulfonic acid aqueous solution and 1 mL / L of 200 mmol / L acetylsuccinone solution (acetylsuccinone is dissolved in dimethyl sulfoxide (DMSO) and sterilized by filtration through a 0.22 μm organic filter membrane).

[0054] (5) IM solid medium is IM liquid medium with 15 g / L agar added.

[0055] (6) LB liquid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, water as solvent, natural pH.

[0056] (7) LB solid medium is LB liquid medium with 20.0 g / L agar powder added.

[0057] (8) YEB liquid culture medium: 5 g / L beef extract, 1 g / L yeast extract, 5 g / L peptone, 5 g / L sucrose, 5 g / L magnesium sulfate heptahydrate, water as solvent, natural pH.

[0058] (9) YEB solid medium is YEB liquid medium with 15g / L agar added.

[0059] (10) Sabouraud liquid medium: peptone 10g / L, glucose 40g / L, water as solvent, pH natural.

[0060] (11) Sabouraud solid medium is Sabouraud liquid medium with 15 g / L agar added.

[0061] The starting strain Aspergillus niger L14 used in the embodiments of the present invention has been disclosed in Genomic and AntiSMASH Analyses of Marine-Sponge-Derived Strain Aspergillus niger L14 Unveiling Its VastPotential of Secondary Metabolites Biosynthesis. Journal of Fungi, 2022, 8(6): 591.

[0062] Example 1: Construction of engineered strain Aspergillus L14-OE::laeA2

[0063] 1. Obtaining the LaeA gene from *Aspergillus niger*: Total RNA was extracted from *Aspergillus niger* L14 using a filamentous fungus RNA extraction kit. Using the reaction system in Table 1, the first strand of cDNA was synthesized via RT-PCR reverse transcription. The obtained cDNA was amplified using primers laea-F / R PCR to extract the LaeA target gene fragment (nucleotide sequence shown in SEQ ID NO.1). Subsequent purification and recovery were performed, and the recovered product was verified using agarose gel electrophoresis. The results are shown in [Table 1]. Figure 1 .

[0064] Primer laea-F: GACTAGTCCTCCAAACAGATGGCT;

[0065] Primer laea-R: GGTCACCTCAAAGTGATGGGC.

[0066] Table 1. RT-PCR reaction system for synthesizing first-strand DNA

[0067]

[0068] 2. Construction of overexpression plasmid pCAMBIA-1301:LaeA:

[0069] The pCAMBIA1303-TrpC-Hygro-gpdA-GFP binary overexpression plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) was digested with SpeI and BstEII restriction endonucleases according to the system in Table 2. The 10199 bp gene fragment was then recovered. The gel electrophoresis image after double digestion is shown in the figure. Figure 2 As shown.

[0070] Simultaneously, the LaeA target gene fragment was recovered after double digestion with SpeI and BstEII restriction endonucleases. The concentration ratios of the two digested products were calculated, and ligation was performed overnight using T4 ligase in the reaction system shown in Table 3. Verification was performed using the verification primers verify-F / R. Verification PCR was performed as follows. Figure 3 The recombinant plasmid pCAMBIA-1301:LaeA, which overexpresses the LaeA gene, was obtained.

[0071] verify1-F: CAGCTTTGCCCGTCTGTCC;

[0072] verify1-R:AAGTCAAAAGGCGCATAGAACTCG.

[0073] verify2-F:CAGGCTTTACCCAAATCGACCA;

[0074] verify2-R: TTTCTCTTAGGTTTACCCGCCAA.

[0075] Table 2. Double enzyme digestion reaction system for plasmids and PCR products

[0076]

[0077] Table 3. T4 DNA Polymerase Reaction System

[0078]

[0079] 3. Construction of engineered Aspergillus strain L14-OE::LaeA1

[0080] The overexpression plasmid from step 2 was amplified in *E. coli* competent cells Dh5α and grown at 37°C in LB solid medium containing 50 μg / mL kanamycin. Transformants were picked and incubated overnight at 37°C and 180 rpm in LB liquid medium. Plasmid was extracted and introduced into *Agrobacterium* AGL-1 using the freeze-thaw method. *Agrobacterium* AGL-1 was activated and amplified using YEB solid and liquid media containing 25 μg / mL rifampicin. PCR verification was performed using Hyg-F / R primers according to the system in Table 4. Figure 4 Show.

[0081] verify-F: GGTTTCCACTATCGGCGAG;

[0082] verify-R:GTCTGTCGAGAAGTTTCTGATCG.

[0083] Table 4 PCR amplification system

[0084]

[0085] 4. Pre-induce Agrobacterium AGL-1, which has been successfully inoculated with plasmid, with IM liquid medium containing 200 μM acetylsyringone. Shake at 28℃ and 180 rpm for 5 h until OD. 600 =0.5. Take a concentration of 1×10. 7 100 μL each of fresh Aspergillus niger L14 (CFU / mL) and Agrobacterium tumefaciens AGL-1 (pre-induced with overexpression plasmid) were mixed and spread evenly on IM solid medium containing 200 μM acetylsyringone and 25 μg / mL rifampin. The mixture was then incubated at 24°C, wrapped in aluminum foil, and protected from light for 48 h to perform Agrobacterium-mediated transformation of Aspergillus niger. Nitrocellulose membranes were used for transfer. After 48 h, the membrane was transferred to PDA medium containing 250 μg / mL hygromycin and 200 μg / mL cefotaxime sodium and incubated at 28°C for 3–7 days.

[0086] A mutant strain with very stable passages was selected, and its LaeA gene expression level was subjected to real-time quantitative PCR according to the system in Table 5. The results are as follows. Figure 5 The results showed that its LaeA gene was overexpressed nearly tenfold compared to the wild-type strain L14. This mutant strain is the engineered strain Aspergillus niger L14-OE::laeA2.

[0087] Table 5. qPCR reaction system

[0088]

[0089] Example 2: Fermentation of engineered strain Aspergillus L14-OE::laeA2

[0090] (1) Activation culture: The engineered strain Aspergillus L14-OE::laeA2 was inoculated into PDA slant medium and cultured in a 30℃ incubator for 3-4 days to obtain the activated strain;

[0091] (2) Seed culture: Pick an inoculation loop of bacterial cells from the activated colonies in step (1) and inoculate them into PDB medium. Culture in a shaker at 200 rpm and 30°C for 3 days to obtain seed culture.

[0092] (3) Fermentation culture: The seed liquid obtained in step (2) was inoculated into 25L of Czapek medium at an inoculation rate of 30mL / L and cultured on a shaker at 200rpm and 30℃ for 15 days to obtain a fermentation mixture.

[0093] Example 3: Extraction, separation and identification of compounds

[0094] 1. Extraction and separation of compounds

[0095] 30 L of the fermentation mixture prepared in Example 2 was filtered through eight layers of gauze to separate the bacterial solution from the mycelium, and the bacterial solution was collected. An equal volume of ethyl acetate was added to the bacterial solution, and extraction was performed. The upper extract was collected. This process was repeated twice, and the extracts were combined. The extract was concentrated to a dry state by rotary evaporation under reduced pressure to obtain the crude fermentation extract.

[0096] All crude extract was dissolved in 12 mL of chromatographic methanol, and 20 μL of the extract solution was taken out and diluted with chromatographic methanol. The solution was then filtered through a 0.22 μm organic filter. The filtrate was analyzed by high-performance liquid chromatography (HPLC). The results are shown in the figure below. Figure 6 In section B, under the same conditions, the fermentation broth of the original Aspergillus L14 was prepared and analyzed by high-performance liquid chromatography (HPLC). The results are shown in [Figure B]. Figure 6 A.

[0097] High-performance liquid chromatography (HPLC) detection conditions: HPLC instrument: UV-VIS; detector: Shimadzu SPD-M40; HPLC pump: Shimadzu LC-20AT; chromatographic conditions: analytical column, C18 column, 4.6 × 250 mm; flow rate: 1.0 mL / min; column temperature: 40 °C; detection wavelength: 210 nm; injection volume: 10 μL. Gradient elution; mobile phase: 10%–100% acetonitrile.

[0098] A 20 μL extract solution was filtered through a 0.22 μm organic filter, and the filtrate was prepared by high-performance liquid chromatography (HPLC). The filtrate was isocratically eluted using an analytical HPLC column with an acetonitrile:water ratio of 35:65 as the mobile phase. Eluents were collected at 6–7 min, 8–9 min, and 10.8–11.2 min. After removing the solvent by rotary evaporation, the eluents were dried at 25 °C to obtain 8.75 mg of compound (I), 5.00 mg of compound (II), and 1.25 mg of compound (III), with yields of 175 mg / L, 100 mg / L, and 25 mg / L, respectively.

[0099]

[0100] 2. Structural identification of compounds

[0101] (1) Physical properties

[0102] Compound I: Yellow oily substance, readily soluble in methanol and dichloromethane.

[0103] Compound II: A yellow oily substance, readily soluble in methanol and dichloromethane.

[0104] Compound III: Yellow oily substance, readily soluble in methanol and dichloromethane.

[0105] (2) Structural identification

[0106] ESI-MS spectra were analyzed using a mass spectrometer (LCQ Fleet, Thermo): The ESI-MS negative source spectrum of compound I is shown below. Figure 7 See the positive source diagram. Figure 8 The ESI-MS negative source pattern of compound II is shown in [reference needed]. Figure 9 See the positive source diagram. Figure 10 The ESI-MS negative source pattern of compound III is shown in [reference needed]. Figure 11 See the positive source diagram. Figure 12 .

[0107] Detection was performed using a nuclear magnetic resonance spectrometer (Advanced III, Bruker). 1 The 1H NMR spectra for compounds I, II, and III are shown in [see figure]. Figure 13 , 15 As shown in Figure 18.

[0108] Detection was performed using a nuclear magnetic resonance spectrometer (Advanced III, Bruker). 13 C10 NMR spectra; results for compounds I and II are shown in […]. Figure 14 , 16 As shown.

[0109] HMBC spectra were detected using an ADVANCE III (Bruker) nuclear magnetic resonance spectrometer. Results for compound II are shown below. Figure 17 As shown.

[0110] The mass spectrometry data for compound I are as follows: ESI-MS spectra at m / z 432.2672 ([M]+) and m / z 431.2638 ([MH]+). + ), m / z 455.2607([M+Na] + A molecular ion peak appears at (), and based on the proton and carbon spectral data, the molecular weight of this compound is determined to be 432, and its molecular formula is C. 23 H 36 N4O4; NMR data attribution is shown in Table 6.

[0111] Table 6: Compound I 1 H-NMR (in CDCl3) and 13 C-NMR (in CDCl3) NMR data and assignment

[0112]

[0113] In summary, based on the comparison with the literature (Cyclic tripeptides from the halotolerant fungus Aspergillus sclerotiorum PT06-1[J]. Journal of Natural Products, 2010, 73(6):1133-7), the structural formula of compound I is determined to be:

[0114]

[0115] The mass spectrometry data for compound II are as follows: ESI-MS spectrum at m / z 417.2486 ([MH)). + ), m / z 441.2455([M+Na] + A molecular ion peak appears at (), and based on the proton and carbon spectral data, the molecular weight of this compound is determined to be 418, and its molecular formula is C. 22 H 34 N4O4; NMR data attribution is shown in Table 7.

[0116] Table 7: Compound II 1 H-NMR (in CDCl3) and 13 C-NMR (in CDCl3) NMR data and assignment

[0117]

[0118]

[0119] In summary, based on the comparison with the literature (JBIR-15, a New aspochracin Derivative, Isolated from a Sponge-Derived Fungus, Aspergillus sclerotiorum Huber Sp080903f04.[J]. Journal of the Agricultural Chemical Society of Japan, 2009, 73(8):1898-1900.), the structural formula of compound II is determined to be:

[0120]

[0121] The mass spectrometry data for compound III are as follows: ESI-MS spectrum at m / z 445.2802 ([MH)). + ), m / z 469.2801([M+Na] + A molecular ion peak appears at (), and based on the proton and carbon spectral data, the molecular weight of this compound is determined to be 446, and its molecular formula is C. 24 H 38 N4O4; NMR data attribution is shown in Table 8.

[0122] Table 8: Compound III 1 H-NMR (in CDCl3) NMR data and assignment

[0123]

[0124]

[0125] In summary, based on the comparison with the literature (Cyclic tripeptides from the halotolerant fungus Aspergillus sclerotiorum PT06-1[J]. Journal of Natural Products, 2010, 73(6):1133-7), the structural formula of compound III is determined to be:

[0126]

[0127] Example 4: Activity Detection

[0128] 1. Antifungal activity against Candida albicans

[0129] Candida albicans ATCC 10231 was used as an indicator strain. It was activated in Sabouraud solid medium at 30°C for 3 days and then amplified in Sabouraud liquid medium at 30°C and 180 rpm for 2 days. The antifungal activity of the indicator bacterial solution was then tested.

[0130] 100 μL of Sabouraud medley medium was added to the outermost ring of the 96-well plate for blank culture to prevent contamination. The first well of the 96-well plate was filled with sample and bacterial culture, with a total solution volume of 200 μL and a sample concentration of 128 μg / mL. The "half-dilution method" was used to adjust the sample concentrations in subsequent wells to 64, 32, 16, 8, 4, 2, 1, 0.5, and 0.25 μg / mL, with three parallel controls for each sample. The plates were incubated at 30°C for 48 hours. The absorbance of the bacterial culture was then measured at 600 nm using a microplate reader, and the minimum inhibitory concentration (MIC) of the compounds was recorded. The samples were compounds I, II, and III, and the control was amphotericin B.

[0131] The results showed that compound II had a MIC of 32 μg / ml against Candida albicans ATCC 10231.

[0132] Table 9: Experimental results of antifungal Candida albicans activity of compounds (I), (II), and (III)

[0133]

[0134] 2. DPPH antioxidant activity assay

[0135] Dissolve 1 mg of solid DPPH in 24 mL of methanol, sonicate for 5 min, and shake thoroughly to ensure homogeneity. Take 1 mL of the prepared DPPH solution and dilute with 0.5 mL of 95% ethanol to achieve an absorbance between 0.6 and 1.0. Prepare a 1 mg / mL sample solution using methanol. When adding the sample, add a small amount gradually, mixing continuously, and observe the fading of the solution. Record the maximum sample volume when the color has largely faded. Based on this maximum volume, set five volumes prior to it to form an arithmetic progression. Perform the final measurement based on the arithmetic progression, requiring three parallel measurements for each volume. The A value can be measured after placing the sample in a 37℃ oven for half an hour. Plot the antioxidant concentration obtained from the experiment on the x-axis and the scavenging rate on the y-axis, and then calculate the linear regression equation. Substitute the scavenging rate of 50% into the equation to obtain the corresponding x-axis value, which is the IC50. 50 Values. Samples were compounds I, II, and III; the control was vitamin C.

[0136] Clearance rate % = ((A0-A) / A0) × 100

[0137] (A0 is the value without sample; A is the value after adding sample)

[0138] The results showed that the IC50 values ​​of compounds (I), (II), and (III) were... 50 The values ​​were 400, 420, and 430 mg / mL.

[0139] Table 10: Experimental results of antioxidant activity of compounds (I), (II), and (III)

[0140]

[0141] 3. Antitumor activity detection

[0142] This experiment used the sulforhodamine B (SRB) colorimetric method to conduct an in vitro tumor cell growth inhibition experiment on the isolated monomeric compounds.

[0143] (1) Tumor cells

[0144] The human brain glial cell line HEB and the human liver cancer cell line Hep-G2 both originated from the Cell Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences.

[0145] Tumor cells in the logarithmic growth phase were selected, digested with trypsin, and then the cell concentration was adjusted to 2 × 10⁶ cells / mL using RPMI 1640 medium containing 10% fetal bovine serum. 4 A cell suspension of tumor cells was obtained by using cells per mL.

[0146] (2) Drugs and reagents

[0147] 0.4% SRB solution: Weigh 0.8g of Sulforhodamine B (SRB), dissolve it in 200mL of 1% acetic acid aqueous solution, and store at room temperature.

[0148] 50% TCA solution: Weigh 50g of trichloroacetic acid (TCA), add water to make up to 100mL, and store at 4℃.

[0149] 10mM Tris-base solution: Weigh 0.6057g of tris(hydroxymethyl)aminomethane (Tris-base), add water to a final volume of 500mL, pH 10.5, and store at 4℃.

[0150] Sample solutions: Compounds I, II, and III prepared in Example 3 were prepared into 200 μM sample solutions using dimethyl sulfoxide (DMSO).

[0151] Control antibiotic solution: The antibiotic 5-fluorouracil (5-FU) was prepared into a 100 μM control antibiotic solution using dimethyl sulfoxide (DMSO).

[0152] (3) Tumor cell viability assay

[0153] The cell suspension of tumor cells listed in Table 11 was seeded at 190 μL per well in a 96-well culture plate and incubated at 37°C with 5% CO2 for 24 h. The culture wells were divided into drug wells, control wells, and blank wells.

[0154] Add 10 μL of sample solution to each drug well to achieve a final drug concentration of 10 μM; add 10 μL of antibiotic solution to each control well to achieve a final drug concentration of 5 μM; add 10 μL of RPMI 1640 medium containing an equal volume of DMSO (10% fetal bovine serum) to each blank well. Incubate the plates at 37°C and 5% CO2 for 3 days. Discard the medium, and gently add 100 μL of pre-chilled 50% TCA solution (4°C) to each well. Let the plates stand for 5 min, then transfer them to 4°C and incubate for 1 h to fix the cells. Discard the fixative, wash five times with distilled water to remove TCA, and air dry for 1 h. Add 80 μL of 0.4% SRB solution to each well and stain at room temperature for 30 min. Discard the stain, wash five times with 1% acetic acid solution to thoroughly remove unbound SRB, and air dry for 1 h. Add 150 μL of 10 mM Trisbase solution to each well to dissolve the cells, and shake for 5 min on a mini shaker (Kylin-Bell Lab instruments). Take a sample from each well and measure the OD value at 570 nm using an M5 microplate reader. Calculate the tumor cell growth inhibition rate according to the formula. The results are shown in Table 11.

[0155] Tumor cell growth inhibition rate (%) = (OD) 对照 -OD 药物 ) / (OD 对照 -OD 空白 )×100%.

[0156] The results showed that at a concentration of 10 μM, JBIR-15 and sclerotiotide C inhibited the human hepatocellular carcinoma cell line Hep-G2 by 11.78% and 21.09%, respectively.

[0157] Table 11: Experimental results of antitumor cell activity of compounds (I), (II), and (III)

[0158]

[0159] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions conceived without inventive effort should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

Claims

1. A high-yielding cyclic tripeptide compound produced by Aspergillus sp. L14-OE::laeA2, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M20232057, deposited on October 27, 2023, at Wuhan University, Wuhan, China, 430072, China.

2. The application of Aspergillus L14-OE::laeA2 as described in claim 1 in the production of cyclic tripeptide compounds, characterized in that, The application involves fermenting Aspergillus L14-OE::laeA2, separating and purifying the fermentation broth to obtain cyclic tripeptide compounds; the cyclic tripeptide compounds include compound (I), compound (II) and compound (III); 3. The application as described in claim 2, characterized in that, The method for fermenting and culturing Aspergillus L14-OE::laeA2 includes the following steps: (1) Inoculate Aspergillus L14-OE::laeA2 into PDA medium and activate it at 30℃ for 3-4 days. Then inoculate it into PDB medium and culture it at 30℃ and 180-200rpm for 3 days to obtain seed liquid. (2) Inoculate the seed culture from step (1) into Czapek's medium at a volume concentration of 1-5%, and culture at 30°C and 180-200 rpm for 15 days to obtain the fermentation broth.

4. The application as described in claim 3, characterized in that, The composition of the Czapek medium in step (2) is: 30 g / L sucrose, 3 g / L sodium nitrate, 0.5 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium chloride, 0.01 g / L ferrous sulfate, 1 g / L dipotassium hydrogen phosphate, with water as the solvent and natural pH.

5. The application as described in claim 2, characterized in that, The method for separating and purifying the fermentation broth is as follows: the fermentation broth is filtered through eight layers of gauze to separate the bacterial liquid from the mycelium. An equal volume of ethyl acetate is added to the bacterial liquid for extraction. The supernatant is then concentrated by rotary evaporation under reduced pressure until it is dry, thus obtaining the crude fermentation extract. The crude extract was dissolved in chromatographic methanol, then diluted with chromatographic methanol, and filtered through a 0.22 μm organic filter. The filtrate was isocratically eluted using an analytical column of high performance liquid chromatography with acetonitrile:water at a volume ratio of 35:

65. The eluents were collected at 6-7 min, 8-9 min, and 10.8-11.2 min. After removing the solvent by rotary evaporation, the eluents were dried at 25 °C to obtain compounds (I), (II), and (III), respectively.

6. The application as described in claim 5, characterized in that, The high-performance liquid chromatography conditions were as follows: Liquid chromatography instrument: UV-VIS; Detector: Shimadzu SPD-M40; High-performance liquid chromatography pump: Shimadzu LC-20AT; Chromatographic conditions: Analytical column, C18 column, 4.6×250mm; Flow rate 1.0ml / min, column temperature 40℃, detection wavelength 210nm, injection volume 10μl.

Images