Morus alba l. leaf aaMYB1 gene and application thereof in increasing flavonoid content of plants

Abstract

The application discloses an AaMYB1 gene of folium artemisiae argyi, and the nucleotide sequence of the AaMYB1 gene is shown as SEQ ID NO. 1. The application also provides primers, vectors, host bacteria and applications, and provides a basis for improving the flavone content of plants.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology technology. More particularly, the present application relates to a folium artemisiae argyi AaMYB1 gene, primer, vector, host bacteria and application. BACKGROUND

[0002] Folium artemisiae argyi is the dried leaf of Artemisia argyi H. Lév. & Vaniot, which has the effects of warming meridian to stop bleeding and dispelling cold to relieve pain. The chemical components in folium artemisiae argyi mainly include flavonoids, terpenes, volatile oils, phenylpropanoids, etc. Flavonoids are a major component in folium artemisiae argyi, and more than 50 kinds of flavonoids have been identified in folium artemisiae argyi, which have multiple pharmacological effects such as anti-inflammatory and anti-tumor.

[0003] The key active ingredients of medicinal plants are important material basis for exerting pharmacological effects and quality evaluation indexes, which can be synthesized and accumulated in different organs such as roots, stems and leaves of plants. Flavonoids are a major component in folium artemisiae argyi, and also an important material basis for exerting pharmacological effects. Flavonoids in folium artemisiae argyi have multiple effects such as anti-inflammatory and anti-tumor. For example, total flavonoids in folium artemisiae argyi can inhibit the proliferation of hepatoma cells and induce apoptosis through multiple proteins. Isofraxidin in folium artemisiae argyi can inhibit the viability and proliferation of neuroglioma cells and induce apoptosis of hepatoma cells, and the related pharmacological mechanism has been explained. In addition, flavonoids in folium artemisiae argyi can also play a certain anti-inflammatory effect by regulating the levels of pro-inflammatory cytokines in macrophages.

[0004] MYB transcription factors are the largest family of transcription factors in higher plants. This family of genes is widely involved in the regulation of plant organ development and secondary metabolite synthesis. Flavonoids are an important class of secondary metabolites in plants, and also a major class of medicinal ingredients in medicinal plants. If the MYB gene can be used to increase the content of flavonoids, it is expected to have high medical and economic value. SUMMARY

[0005] An object of the present application is to provide a folium artemisiae argyi AaMYB1 gene, primer, vector, host bacteria and application, which provides a basis for increasing the content of plant flavonoids.

[0006] In order to achieve these objects and other advantages of the present application, according to one aspect of the present application, a folium artemisiae argyi AaMYB1 gene is provided, and the nucleotide sequence of the folium artemisiae argyi AaMYB1 gene is shown in SEQ ID NO. 1.

[0007] The present application also provides a homologous gene of the folium artemisiae argyi AaMYB1 gene, which is homologous to the folium artemisiae argyi AaMYB1 gene.

[0008] The application also provides primers for amplifying the AaMYB1 gene of the folium artemisiae argyi.

[0009] The application also provides a recombinant vector containing the AaMYB1 gene of the folium artemisiae argyi.

[0010] The application also provides a host bacterium containing the recombinant vector.

[0011] The application also provides an application of the AaMYB1 gene of the folium artemisiae argyi, and cultivating a plant with high flavonoid content.

[0012] Further, the plant is tobacco or the folium artemisiae argyi.

[0013] The application at least includes the following beneficial effects:

[0014] The AaMYB1 gene of the folium artemisiae argyi is cloned in the application, and is genetically transformed into a plant by constructing an overexpression vector, so that the total flavonoid content of the obtained transgenic plant can be significantly improved, and the CHS, CHI, F3H, FLS and F3'H genes in the flavonoid synthesis pathway can be significantly up-regulated, which can be widely applied to improving the flavonoid content in a plant and has a good application prospect for cultivating new germplasm resources of the folium artemisiae argyi.

[0015] Other advantages, objects and features of the application will be partly embodied in the following description, and will be partly understood by those skilled in the art through research and practice of the application. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 An electrophoretogram of the AaMYB1 gene of the folium artemisiae argyi cloned in the application in sections;

[0017] Figure 2 A phylogenetic tree analysis diagram of the AaMYB1 gene of the folium artemisiae argyi cloned in the application;

[0018] Figure 3 A subcellular localization diagram of the AaMYB1 gene of the folium artemisiae argyi cloned in the application;

[0019] Figure 4 An expression level diagram of the AaMYB1 gene of the folium artemisiae argyi cloned in the application in different organs of the folium artemisiae argyi, from left to right, the leaf, the stem and the root;

[0020] Figure 5 A detection electrophoretogram of PCR of the AaMYB1 gene of the folium artemisiae argyi cloned in the application after being transgenically introduced into tobacco K326;

[0021] Figure 6 An expression level analysis diagram of the AaMYB1 gene after the AaMYB1 gene of the folium artemisiae argyi cloned in the application is transgenically introduced into tobacco K326. DETAILED DESCRIPTION

[0022] The application will be further described with reference to the drawings, in which:

[0023] It is to be understood that the terms such as "have", "include" and "comprise" used herein do not exclude the presence of one or more other elements or combinations thereof.

[0024]

[0025] The embodiments of the present application also provide a homologous gene of the Ailanthus altissima AaMYB1 gene, which is homologous to the Ailanthus altissima AaMYB1 gene and can replace the Ailanthus altissima AaMYB1 gene.

[0026] The embodiments of the present application also provide a primer for amplifying the Ailanthus altissima AaMYB1 gene, which is used for cloning the Ailanthus altissima AaMYB1 gene.

[0027] The embodiments of the present application also provide a recombinant vector containing the Ailanthus altissima AaMYB1 gene, which is used for transferring the Ailanthus altissima AaMYB1 gene into a host.

[0028] The embodiments of the present application also provide a host containing the recombinant vector, for example, Agrobacterium, which is used for transferring the Ailanthus altissima AaMYB1 gene into a plant cell.

[0029] The embodiments of the present application also provide an application of the Ailanthus altissima AaMYB1 gene, which is used for breeding a plant with high flavonoid content after the Ailanthus altissima AaMYB1 gene is transferred into a plant cell; preferably, the plant is tobacco or Ailanthus altissima.

[0030] The following is illustrated by specific embodiments.

[0031] <Embodiment 1> provides an obtaining method of cloning the Ailanthus altissima AaMYB1 gene SEQ ID NO. 1, and also provides an amplification primer.

[0032] The obtaining of the Ailanthus altissima AaMYB1 gene sequence comprises the following steps:

[0033] Step one, RNA extraction: total RNA is extracted from fresh young leaves of Ailanthus altissima by using an RNA extraction kit, and pretreated by using RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination. The RNA integrity is analyzed by using 1.5% agarose gel, and the purity and concentration of the RNA are determined by using spectrophotometry.

[0034] Step two, first chain cDNA synthesis: add the following reagents in 0.2 mL PCR tube: 5 μL Total RNA, 1 μL Random Primer p(dN)6(100 pmol), 1 μL RNase-free ddH2O, 70°C warm bath for 5 min, then ice bath for 2 min, centrifuge for 3-5 s. Add reagents: 2.0 μL 5× First-Strand Buffer, 0.25 μL RNase inhibitor, 0.25 μL Reverse Transcriptase, 0.5 μL 10 mmol dNTP, 10.0 μL Total volume, 42°C warm bath for 60 min, 72°C warm bath for 10 min.

[0035] Step three, gene cloning: use LA Taq (TaKaRa, DRR02AG) reagent to detect on PCR instrument (Eppendorf, Germany). Design and synthesize gene-specific primers using Primer 5.0 software,

[0036] F: TTATTATTGAAGGAAAAAACTACTTG (SEQ ID NO.2)

[0037] R: TCCTCTTTATAGCACACAC (SEQ ID NO.3)

[0038] PCR amplification procedure: 94°C for 5 min; 94°C for 30 s, 50°C for 45 s, 72°C for 90 s, 30 cycles; 72°C for 10 min.

[0039] Step four, PCR electrophoresis and recovery: run the PCR product on 1% TAE agarose gel electrophoresis, the results are shown in Figure 1 , recover the target fragment with column type DNA gel recovery kit (Axygen, AP-GX-50), then sequence the recovered fragment, and obtain SEQ ID NO.1 sequence.

[0040] <Example 2> Analysis of the phylogenetic tree of Ailanthus altissima MYB transcription factor AaMYB1 gene nucleotide sequence, and provides a homologous gene of AaMYB1 gene.

[0041] The Ailanthus altissima MYB transcription factor AaMYB1 gene SEQ ID NO. 1 sequence contains 1244 nucleotides. Homology search was performed on NCBI, and phylogenetic tree analysis was performed by MEGA 5.0 software. The method used Neighbor-Joinjing, and bootstrap statistical test was set to 1000. It was found that the gene had high homology with other species MYB genes. Among them, the closest relative was CmMYB of the same family, and the homology reached 96.51%. The results are shown in Figure 2

[0042] <Embodiment 3> Subcellular localization of Ailanthus altissima MYB transcription factor AaMYB1 gene was performed, and a vector and host bacteria were provided.

[0043] Using the AaMYB1 gene sequence obtained by the method of Example 1, the restriction sites of the pC131-YFP vector multiple cloning site and the AaMYB1 gene sequence were analyzed, and EcoRI and SpeI restriction sites were added to the ends of the primers. The target fragment and the vector were double-digested with EcoRI and SpeI, respectively. The target gene AaMYB1 was connected to the pC131-YFP vector by homologous recombination to obtain a fusion vector plasmid, which was transformed into E. coli DH5α competent cells. The PCR amplification primer sequence was designed and synthesized by Primer 5.0 software,

[0044] F: atgggaagatcaccttgttgtgaaaagaatgg (SEQ ID NO. 4)

[0045] R: cataaagacattagaatccaagatatcttgatattcatatt (SEQ ID NO. 5)

[0046] ​The positive clones were screened by PCR amplification and enzyme digestion, and sequencing verification. The sequencing results showed that the target gene was fused with the vector, and the sequence was completely correct. After that, the fusion vector plasmid was transferred into the competent cells of Agrobacterium GV3130 by liquid nitrogen freezing and thawing method. After colony PCR identification was correct, Agrobacterium-mediated transient transformation method was used to transform tobacco K326 leaf. The Agrobacterium cultured overnight was centrifuged and suspended. The suspension was composed of 10 mM MgCl2, 10 mM MES and 100 μM AS. After standing at room temperature for 3 hours, the 4-5 leaf stage tobacco K326 leaf was injected. After 3-5 days of injection, the lower epidermis of tobacco K326 leaf was selected, and the fluorescence signal was observed and photographed by laser scanning confocal microscope (Leica TCS SP8, Germany). The excitation wavelength was 514 nm, and the emission light acceptance wavelength range was 525-575 nm. The results showed that the AaMYB1 gene was subcellularly located in the nucleus.

[0047] <Example 4> The expression difference of AaMYB1 gene in different organs of Artemisia argyi was analyzed.

[0048] Step one, material preparation: fresh root, stem and leaf samples of Artemisia argyi were collected, and the samples were packaged with a self-sealing bag, frozen with liquid nitrogen, and stored in a -80°C ultra-low temperature refrigerator.

[0049] Step two, RNA extraction: total RNA was extracted from the root, stem and leaf of Artemisia argyi using an RNA extraction kit, and pretreated with RNaseFree DNase (Promega, USA) to eliminate genomic DNA contamination. The RNA integrity was analyzed by 1.5% agarose gel, and the RNA content was determined by spectrophotometry.

[0050] Step three, cDNA preparation: AMV first strand cDNA synthesis kit (Roche, Switzerland) was used to synthesize cDNA.

[0051] Step four, primer design: 18S was selected as the endogenous reference gene, and specific primers for qRT-PCR were designed using Primer 5.0 software:

[0052] AaMYB1-F: ACCTATCAACGCCTTCATCAAGTCC (SEQ ID NO. 6)

[0053] AaMYB1-R: TCGTTCGTCTTCTGTGCTGCTTC (SEQ ID NO. 7)

[0054] 18S-F: GCTGTGCAATGCTGACAAGTCTTC (SEQ ID NO. 8)

[0055] 18S-R: ACCCAGTATCAACTCCCGCTGAG (SEQ ID NO. 9).

[0056] Step five, qRT-PCR: The quantitative PCR reagent 2x SG Fast qPCR Master Mix (High Rox, B639273, BBI) was used to detect in StepOne Plus Real-Time PCR instrument (ABI, USA). The amplification program was: 95 ℃ 30 s; 95 ℃ 5 s, 60 ℃ 30 s, 45 cycles; collect data once at an interval of 0.5 ℃ from 65 ℃ to 95 ℃.

[0057] Step six, 2 -ΔΔCT The expression amount of AaMYB1 gene in different organs of A. vulgaris was calculated by the method. The results showed that AaMYB1 gene was expressed in roots, stems and leaves, and the expression amount in the medicinal part of leaves was the highest, and the results are shown in Figure 4

[0058] <Embodiment 5> Research and application of AaMYB1 gene of MYB transcription factor in A. vulgaris.

[0059] I. Transformation of tobacco K326

[0060] (I) Transformation into tobacco K326

[0061] The fusion vector plasmid in Example 3 was transferred into Agrobacterium strain GV3130 by liquid nitrogen freezing and thawing method, and colony PCR detection was performed. The tobacco K326 leaf was cut into small pieces of about 1x1 cm, and the leaf pieces were placed on MS pre-culture medium with the front side down, and pre-cultured for 2 days, then soaked in Agrobacterium suspension containing the expression vector for 5-10 min, and the excess bacterial solution was absorbed with sterile paper, and the leaf pieces were inoculated on MS solid medium with the front side down, and dark cultured for 2 days.

[0062] The tobacco leaf pieces after co-culture were transferred to MS screening medium, and the medium was replaced every 15 days, until green buds were generated. When the buds grew to about 2 cm, they were transferred to MS rooting medium for rooting induction. The seedlings grew to 5-7 cm, and the leaf DNA was extracted for PCR identification, and the positive plants were selected as transgenic tobacco. A total of 14 AaMYB1 positive plants were obtained, and the results are shown in Figure 5

[0063] AaMYB1-F: gtccatcttaacctgcaactc (SEQ ID NO. 10)

[0064] ​​AaMYB1-R: ttcatttggagagaacacgggggac (SEQ ID NO. 11)

[0065] Using the primers of SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9 in Example 4, the target gene was amplified by qRT-PCR, and the specific amplification of the target gene was analyzed by the melting curve method. 18S was used as an endogenous reference gene, and the expression level of the target gene was calculated by 2 -ΔΔCT The significant difference of the gene expression level was analyzed by SPSS 19.0 software. All treatments were set with 3 biological replicates. By detecting the expression level of the target gene in the positive plant overexpressing, the results showed that the expression level of AaMYB1 gene in the positive plant was 8-134 times of the control, and the results were shown in Table 1. Figure 6

[0066] II. Analysis of metabolites of transgenic plants

[0067] The content of total flavonoids in the transgenic tobacco K326 leaves was determined by enzyme labeling method using a plant flavonoid determination kit (Suzhou Mengxi Biological Medicine Technology Co., Ltd.). The results showed that the content of total flavonoids in the transgenic tobacco K326 increased by 12.51% compared with the control. It was shown that AaMYB1 gene played an important role in the biosynthesis of plant flavonoids.

[0068] III. Regulation of AaMYB1 gene overexpression on the expression of plant flavonoid synthesis pathway genes

[0069] The expression level of the genes in the flavonoid biosynthesis pathway was analyzed by the method in Example 4, and it was found that the expression of PAL, C4H, CHS, CHI, F3H, FLS and F3'H genes in the leaves of AaMYB1 transgenic tobacco K326 was up-regulated, and the expression level of CHS, CHI, F3H, FLS and F3'H genes was significantly higher than that of the control, which was 23.9 times, 3.5 times, 14.8 times, 29.4 times and 16.6 times of the control, respectively.

[0070] The number of devices and the scale of processing described herein are used to simplify the description of the present application. Modifications and changes to the AaMYB1 gene of Artemisia argyi and its application in improving the content of plant flavonoids are obvious to those skilled in the art.

[0071] ​While embodiments of the application have been disclosed in connection with the above specification and drawings this description is not intended to limit the scope of the application and many modifications, enhancements, alternatives, and variations will become apparent to those skilled in the art from this disclosure. Accordingly, it is intended that the application not be limited to the described embodiments, but that it include all variations falling within the scope of the claims, and their equivalents.

Claims

1. AaMYB1 gene of Artemisia argyi, characterized in that: The nucleotide sequence of the AaMYB1 gene of Artemisia argyi is shown in SEQ ID NO.

1.

2. A recombinant vector containing the AaMYB1 gene of Artemisia argyi according to claim 1.

3. A host bacteria containing the recombinant vector according to claim 2.

4. The use of the Artemisia argyi AaMYB1 gene according to claim 1, wherein A plant is cultivated to have a high flavonoid content; the plant is tobacco or mugwort.

Images