A polygenetic breeding method for three-line sterile lines of soft-aromatic rice based on low amylose content

Abstract

The present invention relates to the field of rice breeding, and in particular to a poly-breeding method for a three-line sterile rice with low amylose content and soft fragrance. The method comprises the following steps: a hybrid of an excellent maintainer material Zhenshan 97B and Zaoxiang No. 1 with an early growth period and strong fragrance to obtain an F1 generation as parent A; a hybrid of the maintainer material Xieqingzao B and Bo B with rice blast resistance, good rice quality, fragrance and good stigma exposure to obtain an F1 generation as parent B; and a rice material with an amylose content of about 15%, a reduction value of more than 5.0 and strong fragrance to be bred as parent C through full-process tracking of independently developed functional molecular markers. The sterile rice variety finally bred has good rice quality and appearance, is soft and delicious, and does not go stale when cold, thereby meeting the market demand for fragrant and soft rice products.

Description

Technical Field

[0001] The present invention relates to the field of rice breeding, and in particular to a poly-breeding method of a three-line male sterile line of soft-aromatic rice with low amylose content. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop that feeds more than half of the world's population. my country is a major producer and consumer of rice, so rice plays a vital role in food production and security in my country and even the world. One of the keys to hybrid rice breeding is the selection of sterile lines. Sterile lines with excellent comprehensive traits are an important condition for pairing hybrid rice varieties with good yield, high rice quality and good taste. With the continuous pursuit of a better life by consumers, the demand for rice has shifted from "eating enough" to "eating deliciously and eating well". However, the efficient selection of rice sterile lines with highly targeted quality indicators has always been a difficult problem in breeding.

[0003] Low amylose content is key to a soft and glutinous rice texture and improved quality. The three-line sterile line of soft and fragrant rice was developed based on low amylose content, taking into account both the reduction value and aroma indicators. Summary of the Invention

[0004] The present invention aims to provide a method for the polymorphic breeding of three-line sterile lines of rice with low amylose content and soft aroma. The rice bred has good appearance, is soft and smooth, and tastes good, and does not revert to old rice, thus meeting the market demand for fragrant and soft rice products.

[0005] To achieve the purpose of the present invention, a method for poly-breeding of three-line sterile lines of soft-aromatic rice with low amylose content is provided, comprising the following steps:

[0006] A method for poly-breeding of a three-line sterile line of soft-aromatic rice with low amylose content, comprising the following steps:

[0007] (1) The F1 generation obtained by hybridizing the excellent maintainer material Zhenshan 97B with Zaoxiang No. 1, which has an early growth period and strong fragrance, is used as parent A. The F1 generation obtained by hybridizing the maintainer intermediate materials Xieqingzao B and Bo B, which are resistant to rice blast, have good rice quality, fragrance, and good stigma exposure, is used as parent B. Parent A and parent B are hybridized to obtain the F1 generation;

[0008] (2) Planting the F1 generation and harvesting F2 seeds;

[0009] (3) Planting F2 seeds, expanding the breeding sample size, extracting DNA of comprehensive phenotypic superior lines, using three primers designed by ourselves to perform molecular marker-assisted selection of homozygous single plants carrying three genes, including low amylose gene, aroma gene, and reduction value gene, and harvesting F3 seeds;

[0010] (4) Planting F3 seeds, using three primers designed by ourselves to track the whole process for molecular marker assistance, selecting homozygous single plants carrying three genes, including low amylose gene, aroma gene, and reduction value gene, and cross-breeding with Zhenshan 97A to harvest BC1F1 seeds;

[0011] (5) Planting BC1F1 seeds, selecting strains with strong resistance, good plant and leaf shape, moderate growth period, and good fruit set rate, and harvesting BC1F2 seeds per plant; planting for multiple generations, using three primers designed by ourselves to perform molecular marker-assisted selection to track low-amylose genes, aroma genes, and reduction value genes, directing the best selection and breeding, gradually eliminating, and harvesting seeds with strong comprehensive resistance and excellent agronomic traits per plant;

[0012] (6) Continuously plant the homozygous seeds with strong resistance, carrying the low amylose gene, the aroma gene, and the reduction value gene, and then continuously backcross and replace them with Zhenshan 97A for 8-9 generations. Each generation must be tested, and only the plants homozygous for the three genes can be selected for the next generation of breeding; the rice quality index of the families after 8-9 generations of continuous breeding is tested to screen out the sterile line and the maintainer line pairs whose comprehensive agronomic traits of the parents are consistent;

[0013] (7) Select the sterile line with ideal plant and leaf morphology, good color change, and high natural outcrossing rate, and then carry out targeted index identification to select the homozygous seeds with a polymerized amylose content of about 15%, a subtraction value of more than 5.0, and a strong aroma, which are the target plant lines of three-line sterile rice.

[0014] It is further described that the parent A contains a low-amylose gene and an aroma gene; the parent B contains a low-amylose gene and a reduced-consumption value gene.

[0015] It is further described that the low amylose gene is Wx, the fragrance gene is fgr, and the reduction value gene is alk.

[0016] Further explanation, in step (5), the agronomic traits include plant height below 65 cm, effective ears per plant ≥16, average number of grains per ear ≥200, and 1000-grain weight less than 23 grams; the strong resistance means no high susceptibility to pests and diseases such as rice blast, bacterial blight and brown planthopper.

[0017] Further explanation, in step (6), the agronomic traits include plant height below 65 cm, effective ears per plant ≥16, average number of grains per ear ≥200 and 1000-grain weight less than 23 g, stigma exposure rate of more than 85%, similar plant height, flowering period difference of no more than half an hour, vigorous growth and strong tillering ability.

[0018] Further explanation: in step (4) and step (5), the three primers designed by ourselves are:

[0019] The primer sequences of the low-amylose gene are as follows:

[0020] Wx-EE F: CAGCGTGGCAGCCGGAGG;

[0021] Wx-EE R:AGAATGTGCTCCTGGGCC;

[0022] The primer sequences of the scent gene are as follows:

[0023] Fgr-KK F:TCCCCGCAGCGGCAGCTCTT;

[0024] Fgr-KK R:CAACTACCTAAGCGTCAAG;

[0025] The primer sequences for subtracting the alk gene are as follows:

[0026] Alk-SS F: CCGGCCCTGCTTTACGACG;

[0027] Alk-SS R:CACCGGCCTCGGGTGGACG.

[0028] It is further explained that in step (7), the ideal standard for the plant and leaf morphology of the sterile line is moderate plant and leaf type distribution, average plant height below 65 cm, average effective number of ears per plant above 16, green leaves, and no premature aging and yellowing; good color change means that the leaf color changes from green to golden yellow at the end of filling, and the overall plant has green branches and waxy stems; the natural outcrossing rate is above 85%.

[0029] It is further explained that in step (6), the molecular detection of rice quality indicators adopts the Ministry of Agriculture and Rural Affairs NY / T593-2013 to conduct edible rice variety quality detection.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The present invention breeds a rice strain with an amylose content of about 15%, a subtraction value of 5.0 or more, and a strong aroma, and the rice strain is a sterile rice variety. In the breeding process, the molecular marker-assisted breeding technology is used to screen rice that carries low amylose genes, aroma genes, and subtraction value genes at the same time, which can quickly and accurately improve the existing rice variety traits. Specifically, the F1 generation (Zhenshan 97B×Zaoxiang No. 1 Selection) obtained by hybridizing the excellent maintenance line material Zhenshan 97B with the early growth period and strong aroma Zaoxiang No. 1 Selection is used as the female parent, and hybridized with the excellent individual plants of the F1 generation of the maintenance line intermediate material (Xieqing Zao B×Bo B) that are resistant to rice blast, good rice quality, fragrant, and have good stigma exposure as the male parent to obtain a hybrid of (Zhenshan 97B×Zaoxiang No. 1 Selection)×(Xieqing Zao B×Bo B), plant the F1 material, eliminate false and inferior hybrids, and plant a total of 4885 F2 generation plants; the population selects excellent individual plants from the F4 generation and Zhenshan 97A was testcrossed and bred, eliminating families with microscopic staining exceeding 0.5%. After nine generations of backcrossing and substitution breeding and molecular testing of rice quality indicators, each generation was tested. Molecular marker-assisted selection (MAS) using three custom-designed primers was used to track low-amylose, aroma, and subtractive value genes. Only plants homozygous for these three genes were selected for the next generation of breeding. Gradually eliminated, pairs of sterile and maintainer lines were identified, each with consistent agronomic traits from both parents. The maternal pairing exhibited strong heterosis, a moderate growth period, and excellent rice quality. Selected backcross lines were further backcrossed and expanded. The selected BC11F1 material, with ideal plant and leaf morphology, good color veraison, and a high natural outcrossing rate, became the target three-line sterile rice line. The resulting F1 pairing exhibited strong heterosis, excellent grain appearance, and soft, smooth, and sticky rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The results of some low-amylose gene Wx typing in this example are as follows

[0033] Figure 2 The result of typing the fragrance gene as fgr

[0034] Figure 3 The subtraction value gene is the alk genotyping result. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are merely for the purpose of explaining the present invention and are not intended to limit the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0036] Example 1:

[0037] A method for poly-breeding of a three-line sterile line of soft-aromatic rice with low amylose content, comprising the following steps:

[0038] (1) The F1 generation obtained by hybridizing the excellent maintainer material Zhenshan 97B with Zaoxiang No. 1, which has an early growth period and strong fragrance, is used as parent A. The F1 generation obtained by hybridizing the maintainer intermediate materials Xieqingzao B and Bo B, which are resistant to rice blast, have good rice quality, fragrance, and good stigma exposure, is used as parent B. Parent A and parent B are hybridized to obtain the F1 generation;

[0039] The parent A contains a low-amylose gene and a fragrance gene; the parent B contains a low-amylose gene and a reduced-consumption value gene; the low-amylose gene is Wx, the fragrance gene is fgr, and the reduced-consumption value gene is alk;

[0040] (2) Planting the F1 generation and harvesting F2 seeds;

[0041] (3) Planting F2 seeds, expanding the breeding sample size, extracting DNA of comprehensive phenotypic superior lines, using three primers designed by ourselves to track the entire process and perform molecular marker-assisted selection of homozygous single plants carrying three genes, including low amylose gene, aroma gene, and reduction value gene, and harvesting F3 seeds;

[0042] (4) Planting F3 seeds, using three primers designed by ourselves to track the whole process for molecular marker assistance, selecting homozygous single plants carrying three genes, including low amylose gene, aroma gene, and reduction value gene, and cross-breeding with Zhenshan 97A to harvest BC1F1 seeds;

[0043] (5) Planting BC1F1 seeds, selecting strains with strong resistance, good plant and leaf shape, moderate growth period, and good fruit set rate, and harvesting BC1F2 seeds per plant; planting for multiple generations, using three primers designed by ourselves to track the low-amylose gene, aroma gene, and reduction value gene throughout the whole process, directing the best selection and breeding, and gradually eliminating them, and harvesting seeds with strong comprehensive resistance and excellent agronomic traits per plant. The specific indicators are plant height below 65 cm, 1000-grain weight within 23 grams, and no high susceptibility to pests and diseases such as rice blast, bacterial blight, and brown planthopper;

[0044] (6) Continuously plant and obtain homozygous seeds with strong resistance, carrying three genes including low amylose gene, aroma gene and reduction value gene, and then continuously backcross and replace with Zhenshan 97A for 8-9 generations. Each generation must be tested, and only plants with three genes homozygous can be selected for the next generation of breeding. After 8-9 generations of continuous breeding, the rice quality index of the family is tested to screen out the sterile line and the maintenance line paired materials with the same comprehensive agronomic traits of the parents. The comprehensive agronomic trait index here is plant height below 65 cm, effective ears per plant ≥16, average number of grains per ear ≥200, and thousand-grain weight less than 23 grams, stigma exposure rate of more than 85%, similar plant height, flowering period difference of no more than half an hour, vigorous growth, and strong tillering ability;

[0045] (7) The sterile lines with ideal plant and leaf morphology (moderate plant and leaf distribution, average plant height below 65 cm, average effective number of panicles per plant above 16, green leaves, no premature aging and yellowing), good color change (leaf color changes from green to golden at the end of grain filling, and the whole plant has green branches and waxy stems), and natural outcrossing rate of more than 85% were selected for targeted index identification. Homozygous seeds with a polymerized amylose content of about 15%, a subtraction value of more than 5.0, and a strong aroma were selected. The F1 representatives of the paired groups showed strong dominance, good rice appearance, soft and delicious rice, and no reversion to cold rice. These were the target sterile rice varieties.

[0046] In steps (3), (4) and (5), the three independently designed molecular markers. In the present invention, the above three genes (Wx, Fgr, Alk) are all subjected to SNP amplification using PARMS technology. The low-amylose gene is Wx, the fragrance gene is fgr, and the subtraction value gene is alk, all of which are known rice genes. All primers are designed and verified according to the internal sequence of the gene. The PCR product is rapidly detected in an enzyme-labeled instrument containing three fluorescence detection channels: FAM, HEX, and ROX. The fluorescence intensity signal value is read, and then the fluorescence signal value file is analyzed by SNPdecoder (http: / / www.snpway.com / snpdecoder01 / ) software to obtain the FAM and HEX fluorescence signal intensities amplified for each sample, and each signal point is output graphically. Finally, according to the fluorescence signal intensity, genotyping is automatically performed to obtain the genotype results, see Figure 1 、 Figure 2 、 Figure 3 .

[0047] The primers for the above three genes (Wx, Fgr, Alk) are:

[0048] The primer sequences of the low-amylose gene are as follows:

[0049] Wx-EE F: CAGCGTGGCAGCCGGAGG;

[0050] Wx-EE R:AGAATGTGCTCCTGGGCC;

[0051] The primer sequences of the scent gene are as follows:

[0052] Fgr-KK F:TCCCCGCAGCGGCAGCTCTT;

[0053] Fgr-KK R:CAACTACCTAAGCGTCAAG;

[0054] The primer sequences for subtracting the alk gene are as follows:

[0055] Alk-SS F: CCGGCCCTGCTTTACGACG;

[0056] Alk-SS R:CACCGGCCTCGGGTGGACG.

[0057] Specifically, the process of the poly-breeding of the three-line male sterile line of soft-fragrant rice with low amylose content in this embodiment is as follows:

[0058] At the end of May 2005, at the rice experimental base in Xixiangtang District, Nanning City, Guangxi Province, the F1 generation (Zhenshan 97B×Zaoxiang No. 1 Selection), obtained by hybridizing the excellent maintainer material Zhenshan 97B with the early growth period and strong fragrance Zaoxiang No. 1 Selection, was used as the female parent, and hybridized with the excellent individual plants of the F1 generation of the maintainer intermediate material (Xieqing Zao B×Bo B), which was resistant to rice blast, had excellent rice quality, fragrance and good stigma exposure, as the male parent, to obtain the hybrid of (Zhenshan 97B×Zaoxiang No. 1 Selection)×(Xieqing Zao B×Bo B).

[0059] In September 2005, F1 materials were planted at the experimental base of the Rice Research Institute of Guangxi Academy of Agricultural Sciences in Nanning to eliminate false and inferior hybrids; in March 2006, a total of 4,885 F2 generation plants were planted at the rice experimental base in Xixiangtang District, Nanning City and Luoxiang Township, Jinxiu County, Laibin City; F2 generation plants were planted to expand the breeding sample size, and DNA of excellent lines with comprehensive phenotypes was extracted. According to the breeding goal of a three-line sterile line of soft-fragrant rice with low amylose content, three primers designed by ourselves were used to perform molecular marker-assisted selection on 4,885 DNA samples, and the plants carried low amylose genes, fragrance genes, and attenuation value genes. Finally, 128 homozygous single plants for the three genes were obtained, and 128 corresponding single plants (F3) were harvested. The population selects excellent individual plants from the F4 generation. The excellent individual plants are selected by molecular marker-assisted selection of F4 generation DNA samples using three primers designed by themselves. The plants carry low amylose gene, fragrance gene and attenuation value gene. Finally, there are three-gene homozygous individual plants with plant height below 65 cm, 1000-grain weight within 23 grams, and no high susceptibility to diseases and insect pests such as rice blast, bacterial blight and brown planthopper, and are test-crossed with Zhenshan 97A. Since September 2007, the maintainer seeds have been divided into two. One part is planted with the corresponding sterile line material in the rice experimental base in Xixiangtang District, Nanning City, and the other part is planted in Qiongwu Village, Luoxiang Township, Jinxiu County, Laibin City, a natural induction base for rice blast. Until the late season of 2012, shuttle breeding was carried out in the two places. Six plants were randomly selected from each plot every season for microscopic examination, and microscopic staining was strictly eliminated. More than 0.5% of the families have undergone 9 generations of backcross substitution breeding and molecular testing of rice quality indicators. Each of these 9 generations must be tested using three primers designed by themselves for molecular marker-assisted selection to track low-amylose genes, aroma genes, and reduction value genes. Only plants homozygous for the three genes are selected for the next generation of breeding and gradually eliminated. The comprehensive agronomic traits of the parents are plant height below 65 cm, effective ears per plant ≥16, average number of grains per ear ≥200, 1000-grain weight less than 23 grams, stigma exposure rate of more than 85%, similar plant height, flowering period difference of no more than half an hour, vigorous growth, and strong tillering ability. The sterile line and maintainer line pairs are screened out. The female parent group has strong hybrid vigor, the combination has a moderate growth period, and the rice quality is excellent. In May 2013, the backcross lines selected in 2012 were further selected for backcross expansion and reproduction. The BC lines selected in September 2013 11The F1 material, plot numbered M686, exhibited ideal plant and leaf morphology (moderate plant and leaf distribution, average plant height under 65 cm, average number of effective panicles per plant exceeding 16, green leaves without premature aging and yellowing), good color change (leaf color changes from green to golden yellow at the end of grain filling, with green branches and waxy stems overall), and a natural outcrossing rate exceeding 85%. Targeted indicator identification was performed on the maintainer line of the family line. Homozygous seeds with a polymerized amylose content of approximately 15%, a subtraction value of 5.0 or above, and a strong aroma were selected as the target three-line sterile rice line. Hybrids from the target three-line sterile rice line exhibited strong fertility, good appearance, and soft, smooth, and sticky rice.

[0060] The selected target three-line sterile rice line exhibits stable agronomic traits, with an average plant height of 61 cm, moderately distributed plant and leaf shape, vigorous growth, and strong tillering ability. Its leaf sheaths are green, with white auricles, leaf margins, stigmas, and palea tips. Its flag leaf is wide and upright, measuring 25 cm long and 1.75 cm wide. Its panicle length is 20.5 cm. The average number of effective panicles per plant is 16, with an average number of grains per main panicle of 216. Its 1,000-grain weight is 23.0 g, its grain length is 10.3 mm, its grain length-to-width ratio is 4.3, and its stigma exsertion rate is 86.2%, with a bilateral exsertion rate of 27.5%.

[0061] Rice quality test report of the fragrant and soft target strain three-line sterile rice and maintainer line: According to the test of the Rice and Product Quality Supervision, Inspection and Testing Center of the Ministry of Agriculture and Rural Affairs, the rice quality indicators of the target strain three-line sterile rice maintainer line are: brown rice rate 82.2%, polished rice rate 72.3%, whole polished rice rate 54.9%, grain length 7.1mm, length-to-width ratio 3.3, chalky rice rate 3%, chalkiness 0.7%, transparency level 1, alkali consumption value level 5.2, gel consistency 70mm, amylose content 16.0%, meeting the Ministry of Agriculture and Rural Affairs NY / T593-2013 "Quality of Edible Rice Varieties" standard level 3.

[0062] The above description is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this field, it is possible to make several improvements and changes without departing from the creative concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. A method for poly-breeding of three-line sterile lines of soft-aromatic rice with low amylose content, characterized in that: The following steps are involved: (1) The F1 generation obtained by hybridizing the excellent maintainer material Zhenshan 97B with Zaoxiang No. 1, which has an early growth period and strong fragrance, is used as parent A. The F1 generation obtained by hybridizing the intermediate maintainer materials Xieqingzao B and Bo B, which are resistant to rice blast, have good rice quality, fragrance, and good stigma exposure, is used as parent B. Parent A and parent B are hybridized to obtain the F1 generation; (2) Planting the F1 generation and harvesting F2 seeds; (3) Plant F2 seeds, expand the breeding sample size, extract DNA of comprehensive phenotypic superior lines, use three primers designed by ourselves to perform molecular marker-assisted selection of homozygous single plants carrying the low amylose gene, aroma gene, and reduction value gene, and harvest F3 seeds; (4) Planting F3 seeds, using molecular markers assisted by three primers designed by ourselves, selecting homozygous plants carrying the low-amylose gene, aroma gene, and attenuation value gene, and cross-breeding them with Zhenshan 97A to harvest BC1F1 seeds; (5) Planting BC1F1 seeds, selecting strains with strong resistance, good plant and leaf shape, moderate growth period, and good fruit set rate, and harvesting BC1F2 seeds per plant; planting for multiple generations, using three primers designed by ourselves to perform molecular marker-assisted selection to track low-amylose genes, aroma genes, and reduction value genes, directing the best selection and breeding, gradually eliminating, and harvesting seeds with strong comprehensive resistance and excellent agronomic traits per plant; (6) Continuously plant the homozygous seeds with strong resistance carrying the low amylose gene, aroma gene, and reduction value gene, and then continuously backcross and replace them with Zhenshan 97A for 8-9 generations. Each generation must be tested, and only plants homozygous for the three genes can be selected for the next generation of breeding; the rice quality index of the families after 8-9 generations of continuous breeding are tested to screen out the sterile line and maintainer line pairs with the same comprehensive agronomic traits of the parents; (7) Select the sterile line with ideal plant and leaf morphology, good color change, and high natural outcrossing rate, and then carry out targeted index identification with the matching maintainer line. Select the homozygous seeds with a polymerized amylose content of 15%, a reduction value of 5.0 or above, and a strong aroma, which are the target plant lines of three-line sterile rice.

2. The method for polymer breeding according to claim 1, wherein: The parent A contains a low-amylose gene and a fragrance gene; the parent B contains a low-amylose gene and a reduced-consumption value gene.

3. The method for polymer breeding according to claim 1, wherein: The low-amylose gene is Wx, the fragrance gene is fgr, and the reduction value gene is alk.

4. The method for polymer breeding according to claim 1, wherein In step (5), the agronomic traits include plant height below 65 cm, effective ears per plant ≥16, average number of grains per ear ≥200, and 1000-grain weight less than 23 grams; the strong resistance refers to no high susceptibility to rice blast, bacterial blight, and brown planthopper pests.

5. The method for polymer breeding according to claim 1, wherein In step (6), the agronomic traits include plant height below 65 cm, effective ears per plant ≥16, average number of grains per ear ≥200, thousand-grain weight less than 23 g, stigma exposure rate of more than 85%, similar plant height, flowering period difference of no more than half an hour, vigorous growth, and strong tillering ability.

6. The method for polymer breeding according to claim 1, wherein: In steps (3), (4) and (5), the three self-designed primers are: The primer sequences of the low-amylose gene are as follows: Wx-EE F: CAGCGTGGCAGCCGGAGG; Wx-EE R:AGAATGTGCTCCTGGGCC; The primer sequences of the scent gene are as follows: Fgr-KK F:TCCCCGCAGCGGCAGCTCTT; Fgr-KK R:CAACTACCTAAGCGTCAAG; The primer sequences for subtracting the alk gene are as follows: Alk-SS F: CCGGCCCTGCTTTACGACG; Alk-SS R:CACCGGCCTCGGGTGGACG.

7. The method for polymer breeding according to claim 1, wherein: In step (7), the ideal standard for the plant and leaf morphology of the sterile line is that the plant and leaf type is moderately distributed, the average plant height is less than 65 cm, the average number of effective ears per plant is more than 16, the leaves are green, and there is no premature aging and yellowing; the good color change means that the leaf color changes from green to golden at the end of filling, and the whole plant has green branches and waxy stems; the natural outcrossing rate is more than 85%.

8. The method for polymer breeding according to claim 1, wherein: In step (6), the molecular detection of rice quality indicators is performed using the Ministry of Agriculture and Rural Affairs NY / T593-2013 to detect the quality of edible rice varieties.

Images