A snp molecular marker for identifying the genetic sex of procambarus clarkii and application thereof

By developing SNP molecular markers and primers to identify the genetic sex of redclaw crayfish, the problem of uncontrollable sex has been solved, enabling parthenocarpic breeding and farming of redclaw crayfish and improving economic benefits.

CN117904268BActive Publication Date: 2025-11-07SOUTH CHINA AGRICULTURAL UNIVERSITY +1

Patent Information

Application Number
CN202410098573.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-24
Publication Date
2025-11-07
Estimated Expiration
2044-01-24

AI Technical Summary

Technical Problem

Current technology cannot efficiently control the sex of redclaw crayfish, making it impossible to achieve asexual breeding and affecting breeding and farming efficiency.

Method used

A SNP molecular marker was developed to detect the genotype at the 43 bp position of the redclaw crayfish. Using primers 1941343-F and 1941343-R, male individuals were identified as GG homozygous and female individuals as GA heterozygous, achieving 100% genetic sex identification.

Benefits of technology

This has enabled the successful one-sex breeding of redclaw crayfish, increased the economic benefits for farmers, met the market demand for female crayfish, and promoted the healthy development of the redclaw crayfish industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117904268B_ABST
    Figure CN117904268B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker for identifying the genetic sex of Procambarus clarkii, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID No. 1, and a male individual is shown as GG homozygote at the 43th base position of the nucleotide sequence of the SNP molecular marker, and a female individual is shown as GA heterozygote at the 43th base position of the nucleotide sequence of the SNP marker. The application further discloses primers and kits for detecting the SNP molecular marker, and application of the reagents, primers and kits for detecting the SNP molecular marker in genetic sex identification of the Procambarus clarkii. The SNP marker is closely related to the genetic sex, and can be used for conveniently and quickly identifying the genetic sex of the Procambarus clarkii in the process of family breeding and unisexual breeding of the Procambarus clarkii, and provides a theoretical basis for identification of sex-reversed individuals in the breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of aquatic animal molecular markers, and particularly relates to a SNP molecular marker for identifying the genetic sex of Cherax quadricarinatus and application thereof. BACKGROUND

[0002] Cherax quadricarinatus, also known as Australian freshwater lobster, is an animal of Crustacea, Decapoda, Parastacidae and Parastacus. The body color of Cherax quadricarinatus is generally brown-green, the exoskeleton is smooth, the trunk is divided into cephalothorax and abdomen, and the mouth is relatively narrow. Four dorsal spines are divided on the back of the cephalothorax, which can be used as a structure for distinguishing the same genus of Cherax quadricarinatus, and is the origin of the Chinese name of four-spine Cherax quadricarinatus. The head has three pairs of antennae, which are obviously longer than the body itself. The chest has five pairs of legs, and the first pair is differentiated into a larger claw. The distal end of the male Cherax quadricarinatus has no calcification on the upper edge, and has a bright red to red membrane patch, and the female Cherax quadricarinatus does not have the structure, which can be used as a structure for distinguishing the sex of the population in the breeding period. The shrimp species has high adaptability, mixed diet, early maturity, good meat quality, high meat yield, and is highly recognized by the market, and has high development potential in the market.

[0003] The average meat yield of the male Cherax quadricarinatus is 34.6%, and the average meat yield of the female Cherax quadricarinatus is 28.4%. There is a great difference in growth rate between the male and the female, and the male grows faster than the female. The slow growth rate of the female Cherax quadricarinatus leads to a decrease in the breeding efficiency of the Cherax quadricarinatus, and the male Cherax quadricarinatus is more popular in the market. At the same time, in the breeding field, compared with other economically cultured shrimps, the Cherax quadricarinatus has a small clutch size (100-600 per tail), and does not have an advantage. In large-scale breeding, the female Cherax quadricarinatus has a great gap in the breeding and preservation field due to the high female to male ratio of 3:1. Farmers need more female Cherax quadricarinatus to meet the demand for seedlings. However, there is no efficient technology for controlling the sex of Cherax quadricarinatus at present, and the genetic sex of Cherax quadricarinatus cannot be identified in early stage, so as to meet the demand of the market and the breeding field.

[0004] Therefore, the sex-specific marker is a key tool for the healthy, sustainable and rapid development of the red-kemp crayfish breeding industry, and is a specific DNA marker usually only present in the heterogametic sex. The single nucleotide polymorphism (SNP) is a nucleic acid sequence polymorphism caused by the change of a single nucleotide base, and a molecular marker based on this property is closely associated with the sex. Therefore, the development and application of the sex-specific marker can more favorably achieve the monosex breeding of the red-kemp crayfish, improve the economic benefits of the red-kemp crayfish breeders, and have important significance and value for the breeding and breeding of the red-kemp crayfish. SUMMARY

[0005] The first object of the present application is to provide a SNP molecular marker for identifying the genetic sex of the red-kemp crayfish, primers and a kit for detecting the SNP molecular marker.

[0006] The object of the present application is also to provide the application of the reagent, the primer or the kit for detecting the above-mentioned SNP molecular marker in the identification of the genetic sex of the red-kemp crayfish.

[0007] The last object of the present application is a method for identifying the genetic sex of the red-kemp crayfish.

[0008] The above-mentioned first object of the present application can be realized by the following technical scheme: a SNP molecular marker for identifying the genetic sex of the red-kemp crayfish, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID No. 1, the male individual is shown as GG homozygote at the 43bp base position in the nucleotide sequence of the SNP molecular marker, and the female individual is shown as GA heterozygote at the 43bp base position in the nucleotide sequence of the SNP marker.

[0009] The SNP molecular marker for identifying the genetic sex of the red-kemp crayfish provided by the present application aims to solve the problem that the sex of the red-kemp crayfish before the breeding period cannot be controlled, so that the monosex breeding of the red-kemp crayfish cannot be achieved, and further the breeding, breeding and economic benefits of the breeders of the red-kemp crayfish are affected.

[0010] The sex-specific marker of the present application is a SNP marker for identifying the genetic sex of the red-kemp crayfish, and the genetic sex of the red-kemp crayfish can be successfully identified by the SNP molecular marker, which provides a theoretical basis for the identification of sex-reversed individuals in the subsequent monosex breeding process.

[0011] The present application also provides a primer for detecting the SNP molecular marker, the primer comprising a forward primer 1941343-F and a reverse primer 1931343-R, the sequence of the forward primer 1941343-F is shown in SEQ ID No. 2, and the sequence of the reverse primer 1941343-R is shown in SEQ ID No. 3.

[0012] The nucleotide sequence of the primer is specifically as follows:

[0013] 1941343-F: 5'-TGCTTCACACATTTGGTGGT-3';

[0014] 1941343-R: 5'-TCCATGTGAGCAGAGTGGAC-3'.

[0015] The 43bp base position of the nucleotide sequence of the SNP marker obtained by the forward primer 1941343-F and the reverse 1941343-R is G / C at the F / R end for a male individual, and the F / R end trait shows GG / CC homozygosity, and is A / T at the F / R end for a female individual, and the F / R end trait shows GA / CT heterozygosity, which is consistent with the ZZ / ZW female heterogametic sex determination mode of the red claw crayfish.

[0016] The application further provides a kit for detecting the SNP molecular marker, and the kit comprises the primer.

[0017] The above second object of the application can be achieved by the following technical scheme: application of a reagent for detecting the above SNP molecular marker in genetic sex identification of the red claw crayfish.

[0018] The application further provides application of the above primer or the above kit in genetic sex identification of the red claw crayfish.

[0019] The genetic sex of the red claw crayfish can be successfully identified by the SNP molecular marker, wherein the genetic sex of the red claw crayfish can be successfully identified by the SNP marker, the success rate of the SNP marker in identifying female and male red claw crayfish is 100%, the SNP marker can be used as a molecular marker for genetic sex identification of the red claw crayfish, thereby guiding the breeding and monosex culture of the red claw crayfish, achieving all-male or all-female culture of the red claw crayfish, and improving the economic benefits of the breeders.

[0020] The above last object of the application can be achieved by the following technical scheme: a method for genetic sex identification of the red claw crayfish, comprising the following steps: extracting genomic DNA of a red claw crayfish to be detected, performing PCR amplification on the genomic DNA by using the above primer, obtaining the SNP molecular marker, and performing sequencing and sequence alignment analysis on the SNP molecular marker, wherein the 43bp base position of the nucleotide sequence of the SNP marker is GG homozygosity for a male individual, and the 43bp base position of the nucleotide sequence of the SNP marker is GA heterozygosity for a female individual.

[0021] The SNP molecular marker is located at position 43 of the nucleotide sequence shown in SEQ ID No. 1, the genotype of the SNP molecular marker in a male individual is homozygote GG, and the genotype of the SNP molecular marker in a female individual is heterozygote GA.

[0022] Alternatively, the PCR amplification reaction program is as follows: 98 DEG C, pre-denaturation for 5 min; 98 DEG C, denaturation for 5 s, 55 DEG C, annealing for 5 s, 72 DEG C, extension for 20 s, 38 cycles; finally, 72 DEG C, extension for 1 min. The program control of the PCR amplification reaction of the present application is convenient, and the amplification effect is good.

[0023] As a preferred embodiment of the present application, the sequencing is Sanger sequencing.

[0024] Preferably, the present application is to entrust Guangzhou Qikeli Biological Technology Co., Ltd. to carry out Sanger sequencing, and use 3730Xl sequencing platform for high-throughput sequencing during sequencing, and use the magnetic bead purification method of MCLAB Company for purification.

[0025] As a preferred embodiment of the present application, the sequence alignment analysis uses SnapGene software.

[0026] The present application uses SnapGene software for sequence alignment analysis, which is simple to operate, easy to use, and has good analysis effect.

[0027] The present application has the following advantages: the SNP marker of the present application is a SNP marker closely related to genetic sex, which can be used to conveniently and quickly identify the genetic sex of Procambarus clarkii in the process of family breeding and monosex breeding of the Procambarus clarkii, and provides a theoretical basis for identification of sex-reversed individuals in the breeding process; wherein the success rate of the SNP marker in identifying the genetic sex of the Procambarus clarkii is 100%, which is a very effective molecular marker, and can be used to further guide the family breeding of the Procambarus clarkii and the progress of monosex breeding, so that the monosex breeding of the Procambarus clarkii is feasible, and is conducive to the development of the Procambarus clarkii industry. BRIEF DESCRIPTION OF DRAWINGS

[0028] The present application will be further described below with reference to the accompanying drawings and examples.

[0029] Figure 1 is a result graph of bidirectional sequencing of a male individual in Example 1 of the present application;

[0030] Figure 2 is a result graph of bidirectional sequencing of a female individual in Example 1 of the present application;

[0031] Figure 3 is a comparison result graph of random sampling of a male sex population in Example 2 of the present application;

[0032] Figure 4 Figure 2 shows the results of a comparison of randomly sampled female populations in Example 2 of the present application. DETAILED DESCRIPTION

[0033] The technical solutions of the present application will be described in detail below with specific examples, so that those skilled in the art can better understand and implement the technical solutions of the present application. The following examples and drawings are only used for illustrative purposes and should not be construed as limiting the present application. Unless otherwise specified, the reagents or materials used in the examples are obtained from commercial channels. Unless otherwise specified, the experimental instruments used are conventional laboratory instruments.

[0034] To better illustrate the present application, the following examples are provided. It should be emphasized that the following examples are only for the purpose of explaining the present application and should not be construed as limiting the essential scope or content of the present application.

[0035] Example 1

[0036] 1. Construction of genomic library

[0037] First, genomic DNA was extracted from 40 male and 40 female individuals of known gender of Procambarus clarkii. Second, the genomic DNA was digested with restriction enzymes and added with P1 adapters, which contain primer sequences required for amplification, Illumina sequencing primer binding site sequences, and short tag sequences to distinguish different samples. Second, the samples with different P1 adapters were mixed together and physically broken into 300-700 bp sequences. Then, P2 adapters were added and finally the RAD tags were enriched by PCR amplification.

[0038] 2. Bioinformatics analysis of next-generation sequencing data

[0039] The sequencing data was split into Raw Reads and Clean Reads after quality control processing. The Stacks software was used to split the sequencing data based on the barcode and enzyme cutting site information during library construction, obtaining Raw Reads for each sample. To eliminate the influence of sequencing errors on the results, further quality filtering was performed on the Raw Reads to obtain Clean Reads. The BWA software was used to align the Clean Reads to the reference genome using the mem algorithm, followed by variant detection, and finally the SNP was gender marked and screened, mainly using the following four methods for gender marker searching:

[0040] (1) Based on the phenotype information, the SNP and phenotype association analysis was performed based on the commonly used GWAS method, the sites with small p values were screened, the markers associated with genetic sex were obtained, verified, and the associated genes were recorded;

[0041] (2) Based on phenotypic information, the samples were divided into two groups, the Fst value between the two groups was calculated, and sites with Fst close to 1 were screened for verification.

[0042] (3) No missing data is allowed within the group and all samples have the same typing, which is used as the intragroup normalized typing. Then, the intergroup differential sites are screened and verified.

[0043] (4) A certain percentage of missing data is allowed within a group and the consistency rate of all sample typing is higher than 0.8. After normalization within the group, the differential sites between groups are screened and verified.

[0044] The final result requires that the markers remain unchanged in the same sex with little variation in the opposite sex, have significant differences in variation between opposite sexes, and have alleles that are close to one group. The results are then verified by the groups with the closest GWAS association.

[0045] 3. Validation analysis of sex-specific SNP loci

[0046] Ten male and ten female redclaw crayfish were selected, and their genomes were extracted. Using batch-designed primers, all candidate SNP sites ranked within the top 20 were amplified. The PCR amplification products of each individual were sent to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger sequencing, and sequence alignment analysis was performed using GeneSnap software.

[0047] Depend on Figure 1 and Figure 2 It can be seen that:

[0048] At the 43 bp position of the nucleotide sequence described in SEQ ID No. 1, all female individuals showed GA heterozygote behavior, while male individuals showed GG homozygote behavior. This is consistent with the sex determination mechanism of ZZ / ZW female heterogamous pairing in redclaw crayfish. The primer pair used is as follows:

[0049] 1941343-F: 5'-TGCTTCACACATTTGGTGGT-3';

[0050] 1941343-R: 5'-TCCATGTGAGCAGAGTGGAC-3'.

[0051] SEQ ID No. 1 sequence (211bp):

[0052] TGCTTCACAC ATTTGGTGGT AATATAGTAG ATTTAGCCCATTRCTAGTTT TCTTGTTTACATTTGTGAAT CTGAGCCAGATTACTCAATT AATACTGTAT ATTTTGTGAC AACTTCACGCTTATCGTATAATTGTTAATA ATTGTTAACC CGGGTGGAGTAAACAGTTAT CTGGTGGAGCCGTGAGCATATGTCCACTCTGCTCACATGG A.

[0053] R = G / A or G / G;

[0054] Male individual genetic sequence:

[0055] TGCTTCACAC ATTTGGTGGT AATATAGTAG ATTTAGCCCA TT[G / G]CTAGTTT TCTTGTTTACATTTGTGAAT CTGAGCCAGATTACTCAATT AATACTGTAT ATTTTGTGAC AACTTCACGC

[0056] TTATCGTATA ATTGTTAATA ATTGTTAACC CGGGTGGAGTAAACAGTTAT CTGGTGGAGCCGTGAGCATA TGTCCACTCTGCTCACATGG A.

[0057] Female individual genetic sequence:

[0058] TGCTTCACAC ATTTGGTGGT AATATAGTAG ATTTAGCCCG TT[G / A]CTAGTTT TCTTGTTTACATTTGTGAAT CTGAGCCAGATTACTCAATT AATACTGTAT ATTTTGTGAC AACTTCACGC

[0059] TTATCGTATA ATTGTTAATA ATTGTTAACC CGGGTGGAGTAAACAGTTAT CTGGTGGAGCCGTGAGCATA TGTCCACTCTGCTCACATGG A.

[0060] Example 2

[0061] Implementation of SNP markers in an expanded population

[0062] To further verify the reliability of the above results, redclaw crayfish populations with different genetic backgrounds were selected for verification.

[0063] (1) Sample processing: muscle tissue of redclaw crayfish was dissected and the genomic DNA of redclaw crayfish was extracted using the DNA extraction kit of Beijing Jinsha Biotechnology Co., Ltd. The quality of the extracted DNA was tested by agarose gel electrophoresis and nucleic acid quantification instrument, and DNA with good quality and integrity was selected for use.

[0064] (2) PCR amplification: Take 1 μL of the above sample for PCR amplification. The PCR reaction system is 25 μL, including: 9.5 μL of 2×PCR GSMix, 1 μL each of forward and reverse primers, and 12.5 μL of deionized water.

[0065] 1941343-F: 5'-TGCTTCACACATTTGGTGGT-3';

[0066] 1941343-R: 5'-TCCATGTGAGCAGAGTGGAC-3'.

[0067] The PCR amplification program was as follows: 98℃ pre-denaturation for 5 min; 38 cycles including: 98℃ denaturation for 5 s, 55℃ annealing for 5 s, 72℃ extension for 20 s; final extension at 72℃ for 1 min, and storage at 4℃.

[0068] (3) Sequencing analysis: The PCR products were sent to Guangzhou Qingke Biotechnology Co., Ltd. for bidirectional sequencing. If a single peak appeared at the 43 bp of the F end of the sequencing peak diagram and showed GG homozygote (the complementary strand trait is CC), it was determined to be male. If an overlapping peak appeared and showed GA heterozygote (the complementary strand trait is CT), it was determined to be female.

[0069] Peak plot analysis was performed on all redclaw crayfish populations of known sexes. Figure 3 , Figure 4 It can be seen that the sex-related SNP markers screened by this invention have a 100% success rate in identifying males and females, and can be used as molecular markers and methods for sex identification of redclaw crayfish.

[0070] Therefore, compared with the prior art, the beneficial effects of the present invention are as follows: The SNP marker of the present invention is a SNP marker related to genetic sex. The genetic sex of redclaw crayfish can be successfully identified through the SNP marker, providing a theoretical basis for the identification of sex-reversed individuals in the subsequent parthenocarpy breeding process; wherein, the SNP marker has a 100% success rate in identifying the sex genotype of redclaw crayfish, and can be used as a molecular marker for genetic sex identification of redclaw crayfish, thereby guiding the breeding and farming of redclaw crayfish, realizing parthenocarpy breeding of redclaw crayfish, implementing all-male or all-female farming of redclaw crayfish, and improving the economic benefits of farmers.

[0071] It is worth emphasizing that, although the above described embodiments describe in detail certain specific implementations of the application, this does not mean that the patentable scope of the application is limited thereto. In fact, for the expert in the field, various modifications and optimizations can still be made to it without departing from the basic idea and principles of the application, all of which should be considered as being within the scope of protection of the application.

Claims

1. A SNP molecular marker for identifying the genetic sex of Procambarus clarkia, characterized in that: The nucleotide sequence of the SNP molecular marker is shown as SEQ ID No. 1, and the male individual is represented by GG homozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker, and the female individual is represented by GA heterozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker.

2. The use of the reagent for detecting the SNP molecular marker of claim 1 in the genetic sex identification of red-knobbed macrobrachium, characterized in that: The reagent is a primer, the sequence of the primer is shown as SEQ ID No. 2-SEQ ID No. 3, and the male individual is represented by GG homozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker, and the female individual is represented by GA heterozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker.

3. A method for identifying the genetic sex of a Procambarus clarkia, characterized by The method comprises the following steps: The genomic DNA of the red-kemp crayfish to be tested is extracted, the genomic DNA is subjected to PCR amplification by using the primers shown as SEQ ID No. 2-SEQ ID No. 3, the SNP molecular marker SEQ ID No. 1 related to the gender of the red-kemp crayfish is obtained, and the SNP molecular marker is subjected to sequencing and sequence alignment analysis, and the male individual is represented by GG homozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker, and the female individual is represented by GA heterozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID No. 1, and the male individual is represented by GG homozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker, and the female individual is represented by GA heterozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker. The reagent is a primer, the sequence of the primer is shown as SEQ ID No. 2-SEQ ID No. 3, and the male individual is represented by GG homozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker, and the female individual is represented by GA heterozygote at the 43rd base position of the nucleotide sequence of the SNP molecular marker.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker for identifying hereditary sex of cherax quadricarinatus as well as primer pair and application thereof

    CN114480602A

  • PCR amplification primer, kit and identification method for rapidly identifying hereditary sex of cherax quadricarinatus

    CN114645083A

Cited By

  • Primer group for detecting SNP (Single Nucleotide Polymorphism) molecular marker remarkably related to reproductive capacity character of cherax quadricarinatus and application of primer group

    CN122012751A

  • A primer set for detecting a SNP molecular marker significantly related to the reproductive trait of procambarus clarkii and application thereof

    CN122012751B