Alpha-galactosidase mutant and use thereof

By performing site-directed amino acid mutations on α-galactosidase to improve its catalytic performance, the problem of low extraction efficiency of isorubin was solved, achieving the goal of high-efficiency production of isorubin and reducing production costs.

CN117925579BActive Publication Date: 2025-10-24NANJING TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311749836.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-19
Publication Date
2025-10-24
Estimated Expiration
2043-12-19

AI Technical Summary

Technical Problem

The extraction process of isoxophytic glycosides in existing technologies is complex and inefficient, and chemical synthesis methods are not yet mature, making efficient production difficult.

Method used

Isorhodoglycosides were produced by modifying the amino acid sequence of α-galactosidase derived from Anoxybacillus vitaminiphilus through site-directed saturation mutagenesis, thereby enhancing its enzyme activity in catalyzing the reverse hydrolysis of glycerol and D-galactose.

Benefits of technology

It significantly improves the conversion rate of isorhodophycoside, reduces production costs, and has important application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117925579B_ABST
    Figure CN117925579B_ABST
Patent Text Reader

Abstract

The application discloses a kind of high specific activity alpha-galactosidase mutant and application thereof.The alpha-galactosidase AgaV derived from Anoxybacillus vitaminiphilus is used as template, amino acid mutation is carried out by using molecular biology technology, a kind of mutant with improved catalytic efficiency is obtained, including A55N, G530C, P579Y and N580Q.The mutant has high catalytic efficiency, and the efficiency of catalyzing synthesis of ectocarpin with D-galactose and glycerol as substrates is improved by 1.5-2.0 times, which is beneficial to reduce the cost of ectocarpin synthesis, improve the conversion efficiency of using the enzyme to produce ectocarpin, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of functional gene modification technology, and particularly relates to a kind of alpha-galactosidase mutant and its application. BACKGROUND

[0002] Galactosyl-glycerol is an alcohol-soluble galactoside composed of D-galactosyl and glycerol, which exists in many red algae and seaweeds. Alpha-D-galactosyl-glycerol and beta-D-galactosyl-glycerol are widely used in cosmetics, health products, food and drugs. Generally, alpha-D-galactosyl-glycerol has two enantiomeric forms: erythro-galactoside and isoerythro-galactoside, which mainly play the role of anti-osmotic pressure in algal cells, and also have the effects of chemical antioxidant, anti-inflammatory, immune regulation and free radical scavenging. Studies have shown that isoerythro-galactoside is the main photosynthetic product of red algae, and red algae (Neptune and Porphyra) have been confirmed to contain high concentrations of isoerythro-galactoside.

[0003] At present, there is no chemical synthesis method for isoerythro-galactoside, which is mainly obtained from red algae by alcohol extraction process. However, this method has the problems of complex extraction process and low efficiency.

[0004] Using alpha-galactosidase to catalyze the reverse hydrolysis reaction of glycerol and D-galactose to synthesize isoerythro-galactoside has the advantages of high atom economy and low cost, and combining protein engineering to improve the enzyme activity of alpha-galactosidase is of great significance to improve the yield of isoerythro-galactoside. SUMMARY

[0005] The present application rationally modifies alpha-galactosidase derived from Anoxybacillus vitaminiphilus by site-directed saturation mutation, and obtains a series of alpha-galactosidase mutants, which can be used as biological catalysts to catalyze the reverse hydrolysis reaction of substrate glycerol and D-galactose to produce isoerythro-galactoside and improve the conversion rate of isoerythro-galactoside.

[0006] The specific technical solutions of the present application are as follows:

[0007] An alpha-galactosidase mutant has A55, P579, G530, N580 mutations based on the amino acid sequence shown in SEQ ID NO: 1, and one or more of the four sites are saturated mutated to other 19 kinds of amino acids or single-point mutated to other specific amino acids.

[0008] Preferably, the alanine at position 55 is mutated to asparagine, the proline at position 579 is mutated to tyrosine, the glycine at position 530 is mutated to cysteine, and the asparagine at position 580 is mutated to glutamine. Another object of the present application is to provide a DNA molecule encoding the alpha-galactosidase mutant of the present application.

[0009] Another object of the present invention is to provide an expression vector for an α-galactosidase mutant, which expresses the α-galactosidase mutant described herein. The expression vector contains a DNA molecule encoding the α-galactosidase mutant described herein. The expression vector is a plasmid, a bacteriophage, a virus, or a host cell.

[0010] The host cell is a prokaryotic cell or a eukaryotic cell, and can be Escherichia coli, yeast, Bacillus, Lactobacillus, Aspergillus or Trichoderma, preferably Escherichia coli.

[0011] Another object of the present invention is to provide the use of the aforementioned α-galactosidase mutant, its DNA molecule, or its expression vector in catalyzing the synthesis of isorhodoside, specifically, catalyzing the synthesis of isorhodoside using D-galactose and glycerol as substrates.

[0012] The advantages of the present invention are as follows:

[0013] This study uses α-galactosidase AgaV from Anoxybacillus vitaminiphilus (nucleotide sequence shown in SEQ ID NO: 2) as a template. Surface hydrophobic amino acids were mutated to hydrophilic amino acids, while channel hydrophilic amino acids were mutated to hydrophobic amino acids. This prevents water molecules from entering the active pocket of the enzyme, thereby increasing the synthetic activity of α-galactosidase while reducing its hydrolytic activity. This study defines amino acids with a solvent-accessible surface area greater than 70% as surface amino acids. The computer software Discovery Studio 2019 was used to predict the mutation free energy (ΔG). Mutants with negative ΔG values ​​had no negative impact on protein structural stability. The following mutation sites were ultimately selected: A55 and P579. These two hydrophobic amino acids were mutated to hydrophilic amino acids, aiming to increase the protein's surface water binding capacity and reduce water molecule entry into the active pocket. The enzyme activity and relative conversion rate of isorhodopsin synthesis of each mutant were evaluated. Furthermore, caverWeb 2.0 was used to analyze the possible pathways connecting substrates to the catalytic center. The hydrophilic amino acids in the pathways were identified as G530 and N580. Saturation mutations were performed on these two mutation sites, and the enzyme activity and relative conversion rate of the mutants for synthesizing isorhodoside were examined. The results showed that some mutants at sites A55, G530, and N580 had excellent properties with high catalytic efficiency, and the efficiency of catalyzing the synthesis of isorhodoside using D-galactose and glycerol as substrates was increased by 1.5-2.0. The mutant G530C showed the most significant increase in the conversion rate of isorhodoside, which was twice that of the original enzyme. The present invention is beneficial to reducing the cost of high-yield synthesis of isorhodoside, improving the conversion efficiency of isorhodoside produced using the enzyme, greatly reducing production costs, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings, which form a part of this application, are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification. The illustrations are given for the purpose of explaining the application and do not constitute an improper limitation to the application.

[0015] Figure 1 Surface amino acids of alpha-galactosidase AgaV for modification strategy.

[0016] Figure 2 Substrate channel and surrounding amino acids of alpha-galactosidase AgaV.

[0017] Figure 3 SDS-PAGE map of alpha-galactosidase AgaV and mutants.

[0018] Figure 4 Relative enzyme activity of the mutants described in the application.

[0019] Figure 5 Relative conversion rate of original enzyme and mutants described in the application to synthesize iso-frondoside. DETAILED DESCRIPTION

[0020] In order for those skilled in the art to better understand the application scheme, the application will be further described below in combination with the drawings and examples. It should be noted that the present embodiment is only used to explain the application, and is not a limitation on the scope of the application. Obviously, the described embodiment is only a part of the embodiment of the application, and not all the embodiments. Based on the embodiment of the application, all other embodiments obtained by those skilled in the art without creative labor should belong to the scope of protection of the application.

[0021] Example 1 Determination of key amino acids for improving alpha-galactosidase AgaV catalytic synthesis of iso-frondoside and construction of alpha-galactosidase AgaV mutants

[0022] The alpha-galactosidase AgaV selected by the application can catalyze the synthesis of iso-frondoside by reverse hydrolysis reaction of D-galactose and glycerol. Studies have shown that alpha-galactosidase as a glycoside hydrolase mainly catalyzes the hydrolysis reaction of glycoside compounds. In the presence of water, alpha-galactosidase tends to catalyze the hydrolysis reaction, and the product of reverse hydrolysis synthesis will also participate in the hydrolysis reaction as a substrate. Therefore, the application mutates the surface hydrophobic amino acid of alpha-galactosidase to hydrophilic amino acid; mutates the channel hydrophilic amino acid to hydrophobic amino acid to reduce the entry of water molecules into the enzyme active pocket, so as to reduce the hydrolysis activity of alpha-galactosidase and improve its synthesis activity.

[0023] The present application defines the amino acid with a solvent accessible surface area greater than 70% as a surface amino acid. The mutation free energy ΔG is predicted using computer software Discovery Studio 2019. The mutation results of the surface amino acid are as follows by screening under the two conditions of a solvent accessible surface area greater than 70% and a negative ΔG:

[0024] 1. A55H, A55N, A55S, A55R, A55T, A55K, A55Y, A55C, A55Q;

[0025] 2. P579Y;

[0026] The above mutants are constructed. The construction method is as follows, and the primers used are shown in the following table:

[0027] Primer Sequence (5' to 3') A55H-F TGGATCGCCATTTCAGCCCGAATCCGGAACCG SEQ ID NO: 3 A55N-F GGATCGCAATTTCAGCCCGAATCCGGAACCGG SEQ ID NO: 4 A55S-F TTCCTGGATCGCAGCTTCAGCCCGAATCCGGAA SEQ ID NO: 5 A55R-F TTCCTGGATCGCCATTTCAGCCCGAATCCGGAA SEQ ID NO: 6 A55T-F TTCCTGGATCGCACCTTCAGCCCGAATCCGGAA SEQ ID NO: 7 A55K-F GGATCGCAAATTCAGCCCGAATCCGGAACCGG SEQ ID NO: 8 A55Y-F GGATCGCTATTTCAGCCCGAATCCGGAACCGG SEQ ID NO: 9 A55C-F TGGATCGCTGTTTCAGCCCGAATCCGGAACCG SEQ ID NO: 10 A55Q-F TTCCTGGATCGCCAGTTCAGCCCGAATCCGGAA SEQ ID NO: 11 A55-R GCGATCCAGGAACTGCAGTTTGCGCGGCAT SEQ ID NO: 12

[0028] The pET-28a(+) plasmid with the sequence of the alpha-galactosidase AgaV gene is used as a template, the mutation primer pair is used, and the full plasmid is amplified to obtain the site-directed mutation sequence. The PCR product is treated with Dpn I for enzyme digestion, and after the template digestion is completed, the heat shock method is used to transform into the E. coli competent cells E. coli BL21(DE3), and is coated on the LB agar plate containing 100 μg / ml kanamycin sulfate, and is cultured at 37°C overnight. The mutation result is verified by sequence determination completed by Anhui General Biological Company. The mutant is constructed using conventional PCR technology, the alpha-galactosidase AgaV expression vector is used as a template for full plasmid amplification to introduce mutations, and each mutant obtained is verified by sequencing to be successfully constructed. 2. The possible channels for connecting substrates to the catalytic center are analyzed using caverWeb2.0, and two mutation sites G530 and N580 are screened. The two mutation sites are saturatedly mutated, and the method disclosed by Bin Wu (Biotechnology for Biofuels, 2018, 11:20) is used to construct a recombinant plasmid containing SEQ ID NO: 2. The sequence shown in SEQ ID NO: 2 is used as a template, the corresponding mutation primers designed as follows are used, the full plasmid is amplified to obtain the site-directed mutation sequence, and the primers used are as follows:

[0029] The codons corresponding to different amino acids are as follows: TGT (Cys), GAT (Asp), GAA (Glu), TTT (Phe), GGC (Gly), CAT (His), ATT (Ile), AAA (Lys), CTG (Leu), ATG (Met), AAT (Asn), CCG (Pro), CAG (Gln), CGT (Arg), TCA (Ser), ACA (Thr), GTT (Val), TGG (Trp), TAT (Tyr).

[0030] Primer Sequence (5' to 3') G530-F CGGCGGCNNKGGCCGCTTCGATCCGGGCA SEQ ID NO: 13 G530-R ATCGAAGCGGCCMNNGCCGCCGCTGCAGCTTTC SEQ ID NO: 14 N580-F CGTTCCGNNKCATCAGGTTCATCGCGTTACCA SEQ ID NO: 15 N580-R CCTGATGMNNCGGAACGGCGCTAACATGGGCG SEQ ID NO: 16

[0031] The PCR reaction system is as follows:

[0032]

[0033] The PCR program is set as follows:

[0034]

[0035] 2-5 step cycles for 30 times.

[0036] After the whole plasmid amplification is completed, 2 μL of the PCR product is taken for nucleic acid electrophoresis verification. After the verification is completed, DpnI digestion enzyme is used to degrade the initial template.

[0037] The digestion system is as follows:

[0038] PCR product 1 μL

[0039] DpnI enzyme 1 μL

[0040] 10×QuickCut Buffer 2 μL

[0041] The digestion program is as follows:

[0042] 37°C, 30 min.

[0043] After the digestion is completed, the PCR product is transformed into E. coli competent cells E. coli BL21 (DE3) by heat shock method, and is coated on a LB agar plate containing 100 μg / ml kanamycin sulfate, and is cultured at 37°C for 14-16 h. The mutation result is verified by sequence determination (completed by Anhui General Biological Company), and the corresponding mutant is obtained.

[0044] Fermentation expression of the recombinant α-galactosidase mutant in E. coli in Example 2

[0045] The specific expression method is as follows:

[0046] (1) The mutants constructed in Example 1 and the original enzyme α-galactosidase AgaV were inoculated into 30 mL of LB liquid medium containing 100 μg / mL kanamycin sulfate, respectively, and incubated at 37°C, 180 rpm overnight to prepare seed liquid.

[0047] (3) The fermentation liquid after induction was centrifuged at 12 000 rpm for 20 min, and the supernatant was discarded. The bacterial cells were resuspended and washed with 50 mM Na2HPO4-KH2PO4 (pH 7.5) buffer, centrifuged at 12 000 rpm for 20 min, and the supernatant was discarded. The bacterial cells were resuspended again with the buffer, and then were broken by ultrasonic. The broken liquid was centrifuged at 12 000 rpm for 20 min, and the supernatant was detected by SDS-PAGE electrophoresis. The concentration of the concentrated gel was 4%, and the concentration of the separation gel was 12.5%. The sample was mixed with the loading buffer at a ratio of 3:1, and was reacted in a boiling water bath for 5 min for loading electrophoresis. The electrophoresis instrument was set to an initial voltage of 120 V, and the voltage was increased to 230 V when the sample moved to the separation gel, and the electrophoresis was ended when the sample moved to the bottom of the electrophoresis tank.

[0048] The SDS-PAGE electrophoresis results of the crude enzyme liquid of each mutant of the α-galactosidase AgaV are shown in Figure 2 The molecular weight of the target protein is 80 kDa, and there is an obvious band at 80 kDa in each lane of the electrophoretogram, indicating that the target protein is successfully expressed in each mutant.

[0049] Example 3: α-galactosidase enzyme activity determination method

[0050] The enzyme activity of each mutant of the α-galactosidase AgaV was determined by using pNPG as the substrate. A 10 mM pNPG solution was prepared by using KH2PO4-Na2HPO4 buffer (50 mM, pH 7.5), as the substrate solution. In the enzyme-labeled plate, 240 μL of the substrate solution and 10 μL of the appropriately diluted enzyme liquid were added, and the reaction was carried out in the enzyme marker instrument at a reaction temperature of 35°C and a reaction time of 10 min. The absorbance value was measured at 410 nm. The control used 10 μL of the inactivated enzyme liquid with the same dilution factor.

[0051] Definition of enzyme activity unit: the amount of enzyme required to catalyze the hydrolysis of 1 μmol of pNPG to generate pNP per minute at 35°C and pH 7.5.

[0052] The method for preparing the pNP standard curve is as follows:

[0053] Accurately weigh 0.139 g of pNP, dissolve with KH2PO4-Na2HPO4 buffer (50 mM, pH 7.5), and dilute the prepared mother liquor with KH2PO4-Na2HPO4 buffer to prepare pNP solutions of different concentrations. Add 10 μL of buffer to the enzyme-labeled plate, then add 240 μL of pNP standard solution of different concentrations in turn, and measure the absorbance at 410 nm with an enzyme marker. Take the concentration of the standard substance as the abscissa (X) and the absorbance as the ordinate (Y). Draw a standard curve, and the equation is: Y = 5.51X + 0.077, R 2 = 0.9980.

[0054] Example 4 Determination of enzyme activity of each mutant of α-galactosidase

[0055] Referring to the method of Example 3, the enzyme activity of each mutant and the original enzyme of α-galactosidase AgaV was determined with pNPG as the substrate. The relative enzyme activity of each mutant is shown in Table 1. Figure 4 Among them, when the alanine at position 55 is mutated to threonine and the proline at position 579 is mutated to tyrosine, the enzyme activity is increased by 2.5 times; when the glycine at position 530 is mutated to proline, the enzyme activity is increased by 2.3 times compared with the wild type; when the asparagine at position 580 is mutated to cysteine, aspartic acid, glutamic acid, leucine, glutamine and serine, the enzyme activity is increased to different degrees, and when it is mutated to aspartic acid, the enzyme activity is increased by about 2 times. The enzyme activity of the remaining mutants is decreased or similar compared with the wild type.

[0056] Example 5 Application of α-galactosidase mutants and wild type in preparation of porphyranoside

[0057] Method: Equal amounts of enzyme solution of wild type and different mutant types of α-galactosidase induced and expressed in different reactors were added, and equal amounts of 3 mmol D-galactose and 30 mmol glycerol dissolved in 50 mM KH2PO4-Na2HPO4 (pH 7.5) buffer were added to each group, and the final concentration of α-galactosidase was 18% (V / V). The reaction was carried out at 35°C

[0058] for 24 h.

[0059] The reaction solution was filtered by microporous filter after being diluted properly, and the reaction condition was analyzed by liquid phase detection. The liquid phase detection used Bio-Rad Aminex HPX-87H chromatographic column (300 mm*7.8 mm), the injection amount was 20 μL, the mobile phase was 5 mM H2SO4, the flow rate was 0.4 ml·min-1; the column temperature was 50 DEG C, and the differential refractive index detector was used for detection. The peak time of porphyra glycoside was 14.2 min, the peak time of galactose was 15.1 min, and the peak time of glycerol was 20.6 min.

[0060] Results: The detection results are shown in Table 1. Figure 5 As shown in Table 1, the results show that, except A55N, P579Y, G530C, N580Q, the conversion rate of other mutants to porphyra glycoside is not significantly improved. The conversion rate of mutants A55N, P579Y, G530C and N580Q to generate porphyra glycoside is improved to different degrees compared with wild type, the conversion rate of A55N, P579Y, N580Q is 1.5-1.6 times of wild type, the conversion rate of G530C to substrate D-galactose and glycerol to generate porphyra glycoside is 2.0 times of wild type, which will produce huge economic benefits for the production of porphyra glycoside, and has important popularization value.

[0061] The above only describes the preferred embodiments of the present application, and is not used to limit the present application, any modification, equivalent replacement, improvement, etc. within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. An α-galactosidase mutant, characterized in that, The mutant is a mutant of the amino acid sequence shown in SEQ ID NO: 1 with G530C mutation.

2. A DNA molecule, characterized in that, The DNA molecule encodes the alpha-galactosidase mutant of claim 1.

3. An expression vector of an α-galactosidase mutant, characterized by, The alpha-galactosidase mutant of claim 1 is expressed.

4. The expression vector of claim 3, wherein, The DNA molecule of claim 2 is expressed.

5. The expression vector of claim 4, wherein, The expression vector is a plasmid or a virus.

6. A host cell expressing the α-galactosidase mutant of claim 1, wherein, The host cell is a prokaryotic cell or a eukaryotic cell.

7. The host cell of claim 6, wherein, The host cell is selected from the group consisting of Escherichia coli, yeast, Bacillus, Lactobacillus, Aspergillus, or Trichoderma.

8. Use of the alpha-galactosidase mutant of claim 1 in catalyzing synthesis of isoagarose.

Citation Information

Patent Citations

  • Alpha-galactosidase and expression and purification method thereof

    CN101845425A

  • Alpha-galactosidase mutant Gal27B-A16 and coding gene and application thereof

    CN107988185A