Promoter of SRPP5 gene of Eucommia ulmoides, plant expression vector containing SRPP5 gene promoter and application thereof

Abstract

The present invention provides a promoter of Eucommia ulmoides SRPP5 gene, a plant expression vector comprising the promoter of the SRPP5 gene, and an application thereof. The present invention studies the expression pattern of the promoter EuSRPP5 in Arabidopsis thaliana, and the promoter EuSRPP5 shows specific activity in specific cells, tissues or organs of Arabidopsis thaliana; the present invention analyzes the expression activity of the promoter EuSRPP5 under methyl jasmonate (MeJA), gibberellin (GA3), and drought treatment, and proves that the promoter activity of Eucommia ulmoides SRPP5 gene is regulated by hormones and drought pathways. The promoter EuSRPP5 of the present invention is of great significance to the study of the expression of Eucommia ulmoides SRPP gene.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a promoter of an SRPP5 gene of eucommia bark, a plant expression vector comprising the promoter of the SRPP5 gene, and applications thereof. Background Art

[0002] Eucommia ulmoides Oliver belongs to the genus Eucommia and is a plant of the Eucommia family. It is a rare and precious medicinal tree species native to my country. In addition to its rich pharmacological value, Eucommia ulmoides also contains a special white filamentous substance - Eucommia ulmoides Gum (EUG). Its unique molecular structure can be applied in biomedicine, aerospace, industrial production, environmental resources and other fields, thus bringing huge economic benefits. Small rubber particle protein (SRPP) is one of the key enzymes in rubber biosynthesis and is very important for the biosynthesis and stability of rubber particles. Previous studies have shown that the SRPP gene is highly expressed in Eucommia ulmoides, and the expression of homologous genes is closely related to the content of Eucommia ulmoides Gum. Therefore, the SRPP gene in Eucommia ulmoides has important research value.

[0003] A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription start point of the structural gene, and the promoter itself is not transcribed. However, some promoters (such as tRNA promoters) are located downstream of the transcription start point, and these DNA sequences can be transcribed. The characteristics of promoters were originally identified by mutations that can increase or decrease the transcription rate of genes. Promoters are like "switches" that determine the initiation and extent of gene expression. Promoters themselves do not control gene activity, but control gene activity, drive and / or regulate the expression of their 3' downstream nucleic acid sequences by binding to transcription factors. However, there are currently no reports on the research on the regulatory elements of the promoter of Eucommia ulmoides SRPP5 (EuSRPP5) gene. Summary of the invention

[0004] The purpose of the present invention is to provide a promoter of the Eucommia ulmoides SRPP5 gene, a plant expression vector comprising the promoter of the SRPP5 gene and applications thereof.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a promoter of the Eucommia ulmoides SRPP5 gene, wherein the promoter is EuSRPP5, and the nucleotide sequence of the EuSRPP5 is shown in SEQ ID NO:1.

[0007] Preferably, factors affecting the promoter regulation include plant hormones and drought.

[0008] Preferably, the plant hormones include methyl jasmonate and gibberellins.

[0009] The present invention also provides primers for amplifying EuSRPP5, wherein the sequence of the upstream primer PrimerF is shown in SEQ ID NO:2; and the sequence of the downstream primer PrimerR is shown in SEQ ID NO:3.

[0010] The present invention also provides a plant expression vector comprising the promoter.

[0011] Preferably, the initial vector of the plant expression vector is pCAMBIA1300-GUS.

[0012] The present invention also provides a method for constructing the plant expression vector, comprising the following steps:

[0013] (1) Amplify the sequence of EuSRPP5;

[0014] (2) The vector pCAMBIA1300-GUS was digested with EcoRI / SalI as restriction sites, and then connected with the sequence of EuSRPP5 to obtain the plant expression vector.

[0015] The present invention also provides the use of EuSRPP5 in starting and / or regulating the expression of Eucommia ulmoides SRPP5 gene.

[0016] The present invention also provides the use of the plant expression vector in starting and / or regulating the expression of Eucommia ulmoides SRPP5 gene.

[0017] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention has studied the expression pattern of promoter EuSRPP5 in Arabidopsis thaliana, and promoter EuSRPP5 shows specific activity in specific cells, tissues or organs of Arabidopsis thaliana; the present invention analyzes the expression activity of promoter EuSRPP5 under methyl jasmonate (MeJA), gibberellin (GA3), and drought treatment, proving that the promoter activity of Eucommia ulmoides EuSRPP5 gene is regulated by hormones and drought pathways. The promoter EuSRPP5 of the present invention is of great significance to the study of Eucommia ulmoides SRPP gene expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the gel electrophoresis image of the promoter EuSRPP5 after cloning.

[0019] Figure 2 This is the map of the pCAMBIA1300-EuSRPP5-GUS recombinant vector.

[0020] Figure 3 This is the gel electrophoresis image of positive clone detection.

[0021] Figure 4 This is the gel electrophoresis image of the promoter EuSRPP5 transgenic Arabidopsis strain;

[0022] M: DNA marker DL6000; a: positive control; b: negative control; c: water control.

[0023] Figure 5 GUS staining images of promoter EuSRPP5 transgenic Arabidopsis at different developmental stages;

[0024] a: the whole plant of seedling in cotyledon stage; b: the whole plant in true leaf stage; c: inflorescence in sexual reproduction stage; d: seed pod in sexual reproduction stage.

[0025] Figure 6 GUS enzyme activity of promoter EuSRPP5 after treatment with MeJA, GA3, and PEG6000.

[0026] Note: Error bars represent standard error of the mean; ** represents extremely significant difference compared with before treatment, p<0.01; * represents extremely significant difference compared with before treatment, p<0.05; ns represents no significant difference. DETAILED DESCRIPTION

[0027] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0028] The present invention clones the upstream regulatory sequence of the Eucommia ulmoides SRPP5 gene to obtain the complete sequence of its promoter basic elements. Subsequently, a bioinformatics analysis is performed on it, and a plant expression vector is constructed, the target fragment is connected to start the expression of the GUS reporter gene, and the recombinant plant vector is used to genetically transform Arabidopsis thaliana, thereby verifying the activity of the promoter. The expression pattern of the EuSRPP5 gene is analyzed, and its GUS activity under the regulation of plant hormones (MeJA methyl jasmonate, GA3 gibberellin) and drought is measured, laying a foundation for studying the expression regulation pattern of the promoter EuSRPP5.

[0029] The main reagents used in the embodiments of the present invention are:

[0030] (1) Escherichia coli solid medium (LB): 10 g / L tryptone + 10 g / L sodium chloride + 5 g / L yeast extract + 7.5 g / L agar powder;

[0031] (2) Escherichia coli liquid medium (LB): 10 g / L tryptone + 10 g / L sodium chloride + 5 g / L yeast extract;

[0032] (3) YEP solid medium: 10 g / L peptone + 10 g / L yeast extract + 5 g / L sodium chloride + 7.5 g / L agar powder;

[0033] (4) YEP liquid medium: 10 g / L yeast extract + 10 g / L peptone + 5 g / L sodium chloride;

[0034] (5) Hygromycin (Hyg) screening medium: 1 / 2MS + 30 g / L sucrose + 30 mg / L hygromycin + 7.5 g / L agar;

[0035] The pCAMBIA1300-GUS plasmid was purchased from Wuhan Boyuan Biotechnology Co., Ltd.

[0036] Example 1 Obtaining the promoter sequence of the target gene

[0037] Eucommia ulmoides genomic DNA was extracted by CTAB method, and specific primers were designed according to the candidate sequence of EuSRPP5 promoter (ID: GWHTAAAL003925) obtained from the Eucommia ulmoides genome database GenomeWarehouse (https: / / bigd.big.ac.cn / gwh / Assembly / 13 / show). The amplified sequence of EuSRPP5 promoter was obtained by PCR amplification experiment, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. Using Eucommia ulmoides genomic DNA as a template, amplification was performed using high-fidelity polymerase, and the amplification system and procedure are shown in Tables 1 and 2.

[0038] Table 1 Promoter EuSRPP5 PCR amplification system

[0039]

[0040] Table 2 Gene promoter PCR reaction procedures

[0041]

[0042] Among them, the two specific primers are:

[0043] PrimerF:

[0044] GAAACAGCTATGACATGAATTCGGGGCTACGTGTGGTTCTC (SEQ ID NO: 2);

[0045] PrimerR:

[0046] CTACAGGACGTAACATGTCGACTCTTGTTTCTTCTTCCTCTTCAC (SEQ ID NO: 3).

[0047] The PCR amplification product was separated in 1% agarose gel for 40 min at a voltage of 220 V to obtain a band of 1475 bp. Figure 1 As shown. The DNA was purified using the OMEGA Agarose DNA Recovery Kit.

[0048] Example 2 Analysis of EuSRPP5 gene promoter sequence

[0049] Relevant predictions were made using the plant cis-acting element database PlantCARE, and it was found that the promoter contained the TGACG-motif (jasmonic acid response element) involved in the response to plant hormones such as methyl jasmonate, the TATC-box of gibberellin response, the abscisic acid response element ABRE; the MYB element involved in the effect of plant drought response; the element ARE required for anaerobic induction; the light response element G-Box; the cis-acting element TC-rich repeats involved in defense and stress response, as well as a large number of TATA-box and CAAT-box, etc.

[0050] Example 3 Construction of pCAMBIA1300-EuSRPP5-GUS recombinant vector

[0051] 1. Construction of fusion expression vector

[0052] According to the map design of the vector pCAMBIA1300-GUS (Wuhan Boyuan Biotechnology Co., Ltd.), EcoRI / SalI was used as the insertion site, and then the vector was digested to obtain the linear fragment of the vector pCAMBIA1300-GUS. The promoter sequence obtained by amplification was connected in vitro with the linear fragment of the vector pCAMBIA1300-GUS after digestion by homologous recombination. The digestion system is shown in Table 3, and the connection system is shown in Table 4.

[0053] Table 3 Enzyme digestion system of vector

[0054]

[0055] Table 4 Homologous recombination system

[0056]

[0057] 2. Transformation of Ligation Products

[0058] Sterilize the clean bench for 30 minutes, take out 100 μL of DH5α competent cells from the -80℃ ultra-low temperature refrigerator, put it on ice, and pre-cool it for 10 minutes; take out an Ep tube, mark it, put it on ice, and add 80 μL of competent cells (operate on ice); then add 10 μL of the ligation product, mix it with a pipette, and put it in an ice bath for 30 minutes; after the ice bath, put it in a constant temperature water bath at 42℃ for 90 seconds, then quickly put it in ice cubes and ice it. Bathe for 2 minutes; pipette 500 μL of LB liquid culture medium without kan (kanamycin) into the Ep tube, mix well, and place it in a shaker at 160 rpm and 37°C for 1 hour; take out the Ep tube at the end of the shaker, centrifuge at 2000-3000 rpm for 5 minutes, discard 300 μL of the supernatant, gently pipette and mix the remaining bacterial liquid, add it to the LB solid culture dish containing Kan, spread it evenly with a sterile applicator, and after drying, place it in a 37°C constant temperature incubator for 16-20 hours.

[0059] 3. Identification of fusion expression vector

[0060] The transformed single colony was shaken and then used for bacterial liquid PCR identification. The bacterial liquid PCR system and reaction conditions are shown in Tables 5 and 6. Then the positive bacterial liquid identified by bacterial liquid PCR was sequenced, and the correctly sequenced bacterial liquid was mixed with 50% sterile glycerol and stored in a -80°C ultra-low temperature refrigerator.

[0061] Table 5 Single colony detection PCR system

[0062]

[0063] Table 6 PCR reaction conditions for single colony detection

[0064]

[0065] The upstream primer for colony PCR is PG215F2, and the downstream primer is PBI121-GUS-R. The sequence is as follows:

[0066] PG215F2:5'-ACAACGATTCAAGTTTTGTTTG-3'(SEQ ID NO:4)

[0067] PBI121-GUS-R: 5'-CGCGATCCAGACTGAATGC-3' (SEQ ID NO: 5).

[0068] The sequencing result is shown in SEQ ID NO: 1. The sequencing result shows that the promoter sequence in the obtained pCAMBIA1300-EuSRPP5-GUS cloning vector is correct. The recombinant vector map and agarose gel electrophoresis verification are shown in Figure 2 shown.

[0069] SEQ ID NO:1:

[0070] >PG251-24_M1300R_TSS20210426-027-05356_F09,PG251-24_PG215F2_TSS20210426-027-05356-01_C06,PG251-24_PBI121GUS-R_TSS20210426-027-05356_A10

[0071] GCCTTGCTCAGTGTGTGGATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACATGA

[0072] ATTC GGGCTACGTGTGGTTCTCATTCATCGTCCAAACCGTCACCCTTATAAATATCTTTTTTATTTT

[0073] ATTTTATATATATATATATATATCAGCGTTGTCCTATCCAAAAAAATTAGTTTATTCGGAATGCGTTCT

[0074] TCTCAACAAATACTTTTCCGCAGATTCGAACTCCGAATTTTATAAATTCCTCAACTGCTTTAATTA

[0075] AAATATATGTTGCCGCTGAGTATAAAATATGTATTTTGGTTTATCAACTTTTTTTTTTAAGGAAGGT

[0076] AAATGTATTATAAAATTTCTCTAGCTTTTCTAACTTTAAAACAAATATTGGAAAAAACATTTAAGTT

[0077] ATTATTATTATTTTTTTTACTAAATAAGGACATGTTGAAGAAGAAATTGTATTCTAGATCTTGCAAA

[0078] AAAATGGGCTACAAATCTCGAGATTCGAACTTGAGATTCACTTTTAAGTTACTAATAATGTAACTC

[0079] CAAATATGGTCAAGATTAGGAAAAATTATATTTTCGTCCCTATAATATAGGGTGGGTTTGCATGTGC

[0080] CCTCTAATTATACATTTAATTTCTCAAATTTTATATATATTTTAATTCTTTAAAATTAAAATATTATTA A

[0081] TAATTTTAGATAAATATTGAATTTTTTCAACGTGCGGCCTTTCAATGTAGATATTTTTGTTATTTTAT

[0082] TACTTCAATAAATATAATGTTTATTTTTTTAACAACGATTCAAGTTTTGTTTGTTTATCATTATTAATT

[0083] AGAGAAATAGTTAATGTTAAAAAAATATTAAGAAAAAATATTTTAGATTTAGAGGAATGATAAAA

[0084] CGACAAAATATACTTATTAAAAGGTTGGTTGAGCATTGTTCATGTTTTTTGATCTAAAATTATTAAT

[0085] ATTTTTATTTTTTATTTTATAGAATTGAAATAAATGTGAAATTTGAGATGACGTTTATTTGTACTCCC

[0086] AATAAAATGGGAAATAAATTTTATTTTCGTTATGGAATATTTTGAAAATAGAATCGCATTTGCTAAC

[0087] GATAATATTTTAAAAATATTTTAATAATTTAAGCTTGAAATATATATAGGGGAAGAGAGAAGAAAAT

[0088] AAAGTTGTTTACGGTTGGTGGCTATCGTGGTGGTTGTTCTTAATTTTATGGGAGCAAAGATTTTTT

[0089] TATTTCTCAAATTCTTAAAAAGTTACAGAATTATTCTTAAGACATTAAAAATATTGGAGAATAGAA

[0090] ATATCTTACCAAACATATATTTGTATATTAATTCTGAGACGAAGAATAAAAAAGTAAGTTGTGAAAT

[0091] ACAAATGTGTCATTGTTTAAATATTATGAACCAATTAAACACCCAAATTATTTGTGAGGACCAAAA

[0092] ATGTCGTTATCCCATAAATCAATACTATAACATTGATTAGTGCCGAAGCCTACGAAGGGGGAGTGA

[0093] GAGAGTTAGAGAGAAGAAGAAGAGAGAGAGAGAGAGAGCGAGTTAGAGAGTGAAGAGGAAG

[0094] AAGAACAAGA GTCGACATGTTACGTCCTGTAGAAACCCCAACCCGGAATAAGGGTCATGTC

[0095] In this step, primer synthesis was completed by Beijing Qingke Biotechnology Co., Ltd., and sequencing was completed by Wuhan Transduction Biological Laboratory Co., Ltd.

[0096] Example 4: Introduction of pCAMBIA1300-EuSRPP5-GUS recombinant plasmid into Agrobacterium

[0097] Take 100 μL of LBA4404 Agrobacterium competent cells stored in a -80°C ultra-low temperature freezer and place them on ice to melt; add 20-40 μL of the recombinant plasmid pCAMBIA1300-EuSRPP5-GUS to the competent cells and mix gently with a pipette; place the competent cells containing the recombinant plasmid on ice for 30 minutes, then transfer them to liquid nitrogen and freeze them for 5 minutes; then place them in a 37°C water bath for 5 minutes to thaw the cells; add 1 mL of YEP liquid culture medium without any antibiotics to the tube, and then place it in a constant temperature shaking incubator for shaking culture for 5 hours (28°C, 200 rpm / min).

[0098] The cultured bacterial solution was centrifuged at 4°C, 5000 rpm / min for 1 min, the supernatant was discarded, and 0.1 mL of YEP liquid medium (Rif-100 mg / L and Kan-100 mg / L) was added to rehydrate the bacterial cells;

[0099] The above bacteria were evenly spread on a YEP solid plate containing Rif (50 mg / L) and Kan (100 mg / L) using a sterilized applicator, and allowed to stand for several minutes until the bacterial solution was completely absorbed. The culture dish was sealed with a sealing film and then placed in a 28°C biochemical incubator for 2 to 3 days. A single colony was picked and kept for later use.

[0100] Example 5 Agrobacterium-mediated genetic transformation of target gene promoter EuSRPP5 into Arabidopsis

[0101] 1. Planting Columbia Wild-type Arabidopsis

[0102] Evenly spread wild-type Arabidopsis seeds in a culture dish containing moist filter paper, and then place in a 4°C refrigerator for 2 days to vernalize the seeds. Sow the vernalized seeds in a flower pot, cultivate them with nutrient soil, water them and place them in an artificial climate chamber, cultivate them under the conditions of 23°C, 65% humidity, and 16h / 8h light / darkness in the photoperiod, and water them once every 4 to 5 days. When the Arabidopsis plants grow 3 to 4 cm terminal inflorescences, cut off the terminal inflorescences to promote the growth of leaf inflorescences. After a large number of inflorescences grow, the infection experiment can be carried out. Before infection, cut off the pods of Arabidopsis that have already bolted and the flowers that have been pollinated, leaving only the flowers that are about to bloom.

[0103] 2. Agrobacterium infection of wild-type Arabidopsis

[0104] In the clean bench, use a pipette to draw 15-20 μL of the Agrobacterium liquid of LBA4404 containing the recombinant plasmid (stored in a -80°C ultra-low temperature refrigerator) and drop it on the solid YEP medium containing Rif (50 mg / L) and Kan (100 mg / L), use a sterile inoculation loop to streak the plate, then seal the culture dish with a sealing film, and place it upside down in a 28°C biochemical incubator in the dark for 2-3 days;

[0105] Select a single colony and inoculate it into 10 mL YEP liquid medium (containing Rif 50 mg / L, Kan 100 mg / L), and place it in a constant temperature shaking incubator in the dark for 24 h (28°C, 200 rpm / min);

[0106] Take 1 mL of the above bacterial solution and inoculate it into 30-40 ml YEP liquid medium (containing Rif 50 mg / L, Kan 100 mg / L) for expansion culture, place it in a constant temperature shaking incubator in the dark for 4-5 h (28°C, 200 rpm / min), and then measure the OD value with a UV spectrophotometer until the OD600 value reaches 0.8-1.2;

[0107] In a clean bench, transfer the cultured bacterial solution to a 50 mL sterile centrifuge tube, centrifuge for 10 min (4°C, 5000 rpm / min), and discard the supernatant.

[0108] Resuspend the bacterial precipitate fully with MS resuspension solution added with silwet-77, the concentration of silwet-77 in the MS resuspension solution is 0.02%;

[0109] All inflorescences of wild-type Arabidopsis thaliana were infected with bacterial solution for 30-60 seconds, and then covered with plastic wrap to maintain humidity greater than 90%, and cultured at 25°C in the dark for 24 hours. After dark culture, the plastic wrap was removed, and then cultured at 23°C, humidity of 65%, and a photoperiod of 16h / 8h light / dark.

[0110] The infection cycle was 7 days, with a total of 3 times of infection, during which the infection steps and conditions were the same as the first time. After all the infection processes were completed, the Arabidopsis seedlings were continued to be cultured at 23°C with 16h / 8h light / darkness until they set seeds;

[0111] Gently rub the ripe pods onto a clean white paper, and place the collected clean seeds into a dry centrifuge tube and store them in a refrigerator at 4°C.

[0112] 3. Screening of transgenic Arabidopsis plants

[0113] In the clean bench, the collected seeds were disinfected with 75% ethanol for 30 seconds, and washed with sterile water 2-3 times, 1 minute each time; then the surface was disinfected with 10% sodium hypochlorite solution for 30 seconds, and washed with sterile water 4-5 times, 1 minute each time, and then the seeds were evenly spread on the screening medium containing hygromycin (30 mg / L) resistance, and then placed in a refrigerator at 4°C for 2-3 days to vernalize the seeds. After vernalization, the plate was taken out and placed at 23°C, 16h / 8h light / dark culture for 10-14 days, and the color of the young shoots and leaves was observed. Green leaves are positive transgenic Arabidopsis plants;

[0114] Transplant the surviving positive plants into nutrient soil and culture them at 23°C with 16h / 8h light / darkness. When the plants are about 20 days old, use the CTAB method to extract Arabidopsis genomic DNA and perform PCR detection;

[0115] The T0 generation transgenic Arabidopsis positive plants obtained after PCR detection were cultured under the same culture conditions to collect T0 generation seeds. The T0 generation seeds were screened using 30 mg / L hygromycin resistance medium to obtain T1 generation transgenic Arabidopsis positive plants;

[0116] After the T1 generation plants were confirmed by PCR, they were cultured continuously, and then T1 generation seeds were collected from individual plants and screened using a 30 mg / L hygromycin resistance screening medium. T2 generation transgenic Arabidopsis positive plants were obtained by PCR testing as well.

[0117] The T2 generation Arabidopsis positive plants were harvested individually to obtain T3 generation seeds, and then 50 seeds were taken from each strain for screening on hygromycin resistance medium, and the screening results of T3 generation Arabidopsis positive plants were recorded;

[0118] All positive Arabidopsis plants of the T3 generation grew normally on the 30 mg / L hygromycin resistance screening medium without separation, and after PCR detection, homozygous transgenic positive plants of the T3 generation were obtained;

[0119] After obtaining the T3 generation homozygous transgenic Arabidopsis positive strains of the promoter EuSRPP5, they were further cultured and used as subsequent experimental materials.

[0120] Example 6 Identification of transgenic Arabidopsis plants

[0121] Extract DNA from transgenic Arabidopsis plants and perform PCR detection. Design specific primers for the hygromycin resistance gene:

[0122] F-GAGCATATACGCCCGGAGTC, (SEQ ID NO:6)

[0123] R-CAAGACCTGCCTGAAACGA. (SEQ ID NO:7)

[0124] The PCR amplification reaction system and reaction procedure are the same as those in Tables 1 and 2. The PCR reaction products were detected by electrophoresis using 1% agarose gel, with wild-type Arabidopsis plant DNA and water as controls. The gel electrophoresis results are shown in Figure 3 As shown. Figure 3 The results showed that a total of 11 transgenic positive Arabidopsis strains were obtained.

[0125] Example 7 Analysis of the expression pattern of promoter EuSRPP5

[0126] The T3 Arabidopsis transformed with pCAMBIA1300-EuSRPP5-GUS was stained. The transformed Arabidopsis resistant roots, stems, leaves, flowers, and seed pods were placed in an appropriate amount of GUS staining solution at 37°C overnight. The tissues were then immersed in 75% alcohol until the green color of the tissues faded, and photographed using a stereo microscope. The results are shown in Figure 2. Figure 4 shown.

[0127] Figure 4 It was shown that GUS staining was obvious in the seedlings of transgenic plants at the cotyledon stage; as the plants grew, the GUS staining of the true leaves was also deep, and the cotyledons continued to stably express activity, but GUS expression in the roots was unstable; after the sexual reproductive organs developed, the inflorescence and its lateral leaves expressed GUS activity, and mature seed pods and seeds also had GUS expression activity.

[0128] according to Figure 4 The experimental results show that the stems, leaves, flowers and seed pods of Arabidopsis thaliana transformed by Agrobacterium tumefaciens containing the recombinant vector pCAMBIA1300-EuSRPP5-GUS all show blue color, and there is almost no blue color in the roots. This indicates that the promoter of the present invention can drive the GUS gene to express stably in Arabidopsis thaliana except for unstable expression in the roots, and there is no obvious difference in the degree of staining, indicating that the promoter EuSRPP5 has certain tissue specificity in Arabidopsis thaliana.

[0129] Example 8 Analysis of the expression activity of promoter EuSRPP5 under methyl jasmonate (MeJA), gibberellin (GA3), and drought treatment

[0130] First, T3 homozygous transgenic Arabidopsis plants that were grown for about 30 days and had relatively consistent GUS staining were selected for treatment experiments. 1mmol / L MeJA solution, 1mmol / L GA3 solution and 20% PEG6000 solution were used to spray the plants (PEG6000 treatment simulated drought stress) until the leaves of the plants were completely wet and water droplets fell from the leaves. The plants were cultured in an artificial climate chamber at 23°C and 16h / 8h light / darkness, and then samples were taken at 0h, 3h, 6h, 12h, and 24h, respectively. The samples were quickly frozen in liquid nitrogen and stored in an ultra-low temperature refrigerator at -80°C. The GUS enzyme was then extracted using a β-GUS enzyme-linked immunosorbent assay kit (purchased from Shanghai ELISA Co., Ltd.) to determine the activity, and then the expression activity of the promoter EuSRPP5 was analyzed. The results are shown in Figure 5. Figure 5 The results showed that the expression activity of EuSRPP5 was the strongest at 6h after the above three treatments, and decreased after 6h. Taking 0h as the control, the enzyme activity increased significantly by 1.68 times and 2.30 times after MeJA and GA3 treatment, respectively; after 20% PEG6000 induced drought stress, the expression of EuSRPP5 increased significantly by 1.57 times at 6h.

[0131] The above results indicate that endogenous hormones MeJA, GA3 and drought regulation can drive the expression of GUS activity of EuSRPP5, further indicating that the promoter activity of EuSRPP5 gene in Eucommia ulmoides is regulated by hormones and drought pathways.

[0132] From the above examples, it can be seen that the present invention provides a promoter of the Eucommia ulmoides SRPP5 gene, a plant expression vector comprising the SRPP5 gene promoter and its application. The promoter EuSRPP5 of the present invention is of great significance to the study of the expression of the Eucommia ulmoides SRPP gene.

[0133] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The promoter of Eucommia ulmoides SRPP5 gene, characterized in that The promoter is EuSRPP5, and the nucleotide sequence of EuSRPP5 is shown in SEQ ID NO:

1.

2. The promoter according to claim 1, characterized in that Factors that affect the regulation of the promoter include plant hormones and drought.

3. The promoter according to claim 2, characterized in that The plant hormones include methyl jasmonate and gibberellins.

4. Primers for amplifying EuSRPP5, characterized in that: The sequence of the upstream primer PrimerF is shown in SEQ ID NO:2; the sequence of the downstream primer PrimerR is shown in SEQ ID NO:3; and the nucleotide sequence of the EuSRPP5 is shown in SEQ ID NO:

1.

5. A plant expression vector, characterized in that: Comprising the promoter according to claim 1.

6. The plant expression vector according to claim 5, characterized in that The initial vector of the plant expression vector is pCAMBIA1300-GUS.

7. The method for constructing the plant expression vector according to claim 6, characterized in that: The following steps are involved: (1) Amplify the sequence of EuSRPP5; (2) The vector pCAMBIA1300-GUS was digested with EcoRI / SalI as restriction sites, and then connected with the sequence of EuSRPP5 to obtain the plant expression vector.

8. Use of EuSRPP5 in initiating and / or regulating the expression of Eucommia ulmoides SRPP5 gene, characterized in that: The nucleotide sequence of EuSRPP5 is shown in SEQ ID NO:

1.

9. Use of the plant expression vector according to claim 5 in initiating and / or regulating the expression of Eucommia ulmoides SRPP5 gene.

Images