Promoter of Neolamarckia cadamba Sucrose Transporter Gene NcSUT1 and Its Application

Abstract

The present invention discloses the promoter of Neolamarckia cadamba sucrose transporter gene NcSUT1 and its application. The promoter sequence of 2015 bp upstream of the NcSUT1 gene was cloned from Neolamarckia cadamba. Cis-acting element analysis found that it contains multiple core promoter elements such as TATA-box and CAAT-box, as well as stress response, phytohormone and light response elements. According to the positions of the promoter functional elements, expression vectors of the full-length promoter and 6 5'-terminal deletion fragments were constructed. The results showed that the promoter fragment from -1377 bp to -1 bp upstream of NcSUT1 could drive the expression of LUC in tobacco leaves, and the fragment from -669 bp to -1 bp had the strongest promoter activity. Transgenic Arabidopsis analysis showed that the NcSUT1 promoter could drive the expression of GUS in the parts rich in vascular tissues in tissues such as leaf veins and roots, petals, anthers, filaments, flower stalks, siliques, funicles, and fruit pod stalks of seedlings, and the expression was specific. The present invention not only provides candidate sequences for screening promoters specifically expressed in vascular parts, but also can accurately achieve the germplasm innovation and genetic improvement of fast-growing forest trees.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and particularly relates to the promoter of Neolamarckia cadamba sucrose transporter gene NcSUT1 and its application. Background Art

[0002] Sucrose is the main form of transportation and storage of carbon assimilation products in photosynthesis of most plants. It is mainly produced in the "source" leaf tissue and most of it reaches the "sink" tissue through long-distance transportation in the phloem. Sucrose transporters (SUT) play an important role in this process. Neolamarckia cadamba is an important tropical fast-growing timber tree species in South China and also an ideal material for studying the mechanism of rapid wood growth. Its rapid growth requires a large amount of carbohydrates synthesized in the source tissue and transported to the sink tissue. The ability of photosynthesis and carbohydrate transport is the key factor for the rapid growth of Neolamarckia cadamba. As one of the main carbon sources, sucrose not only provides energy for the growth and development of trees, but also provides relevant substrates for metabolic processes such as the synthesis of cell wall components such as lignin and cellulose during wood formation. Therefore, SUT responsible for sucrose transport may play an important role in the rapid growth and wood formation of Neolamarckia cadamba. Existing studies have shown that SUT regulates different growth and development processes in herbaceous plants, but there are few reports on its regulatory role in the wood development and formation process of woody plants.

[0003] Promoters are generally located upstream of genes and are a segment of DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. They contain various cis-acting elements, and trans-acting factors can bind to them to synergistically complete the regulation of gene expression at the transcriptional level and participate in plant growth, development, and stress response processes. In the early stage, our research group identified and cloned 5 Neolamarckia cadamba NcSUT genes through bioinformatics analysis. Preliminary analysis of the expression pattern and function found that NcSUT1 may be involved in the vascular development and wood formation process of Neolamarckia cadamba and can be used as an important candidate gene for the rapid growth trait of wood. However, the current regulatory mechanism of the NcSUT1 gene is not clear. Summary of the Invention

[0004] Aiming at the deficiencies of the existing technology, the present invention provides the promoter of Neolamarckia cadamba sucrose transporter gene NcSUT1 and its application. The present invention cloned the promoter of Neolamarckia cadamba NcSUT1 and analyzed its function, and obtained a promoter that is specifically expressed in the vascular parts of plants, which can provide a basis and candidate genes for the genetic improvement of the rapid growth trait of forest trees and wood quality, and accelerate the cultivation of new germplasms of high-quality fast-growing broad-leaved forest trees.

[0005] Therefore, the first object of the present invention is to provide the Neolamarckia cadamba sucrose transporter gene NcSUT1 promoter, whose nucleotide sequence is shown as the 639-2015th bases, 923-2015th bases, 1347-2015th bases or 1698-2015th bases of SEQ ID NO.1.

[0006] The second object of the present invention is to provide an expression vector containing the above-mentioned Neolamarckia cadamba sucrose transporter gene NcSUT1 promoter.

[0007] The third object of the present invention is to provide the application of the above-mentioned Neolamarckia cadamba sucrose transporter gene NcSUT1 promoter or an expression vector containing the Neolamarckia cadamba sucrose transporter gene NcSUT1 promoter in plant genetic improvement.

[0008] Preferably, the above application is the application of the Neolamarckia cadamba sucrose transporter gene NcSUT1 promoter in constructing transgenic plants with specific expression in the vascular parts of plants.

[0009] Preferably, the plant is Neolamarckia cadamba or Arabidopsis thaliana.

[0010] The present invention has the following advantages compared with the prior art:

[0011] The present invention has cloned the Neolamarckia cadamba sucrose transporter gene NcSUT1 promoter, analyzed its cis-acting elements through bioinformatics, and clarified its sequence characteristics. The present invention has also provided a method for verifying the promoter activity and an idea for finding the key cis-acting elements of the promoter by constructing an expression vector of the NcSUT1 promoter, confirmed the specificity of the NcSUT1 promoter in vascular part expression, and provided an effective basis for its application in forest tree breeding practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 For the cloning of the full-length Neolamarckia cadamba NcSUT1 promoter.

[0013] Figure 2 For the distribution of some cis-acting elements of the full-length Neolamarckia cadamba NcSUT1 promoter.

[0014] Figure 3 For the full-length Neolamarckia cadamba NcSUT1 promoter and 6 promoter fragments with 5'-end deletions; Figure a is a schematic diagram of the positions and lengths of the full-length Neolamarckia cadamba NcSUT1 promoter and 6 promoter fragments with 5'-end deletions, and Figure b is the band size of the amplification of the full-length Neolamarckia cadamba NcSUT1 promoter and 6 promoter fragments with 5'-end deletions.

[0015] Figure 4Analysis of the activity of LUC driven by different - length promoter fragments of Neolamarckia cadamba NcSUT1; Figures a - g are the analysis of the activity of LUC driven by different - length promoter fragments of Neolamarckia cadamba NcSUT1A - G respectively, where EV is an empty vector without a promoter (negative control), and Figure h is a schematic diagram of the comparative analysis of the activity of LUC driven by different - length promoter fragments of Neolamarckia cadamba NcSUT1A - G in the same tobacco leaf.

[0016] Figure 5 GUS histochemical analysis of the Neolamarckia cadamba NcSUT1 promoter transformed into Arabidopsis thaliana; Figure a is the GUS staining of 3 - day - old seedlings, Figure b is the GUS staining of 7 - day - old seedlings, Figure c is the GUS staining of the inflorescence of 35 - day - old plants, Figure d is the GUS staining of pods at 6 DAF, and Figure e is the GUS staining of seeds at 15 DAF. Detailed implementation methods

[0017] The following examples are further explanations of the present invention, rather than limitations of the present invention.

[0018] Example 1: Cloning and sequence analysis of the promoter of the Neolamarckia cadamba sucrose transporter gene NcSUT1

[0019] I. Method

[0020] 1. Extraction of Neolamarckia cadamba DNA

[0021] The materials were from the clonal tissue - cultured seedlings in the laboratory. The culture conditions were at room temperature of 28 ± 2 °C, with 16 h of light / 8 h of darkness. After one month of rooting culture, the young and tender leaves were cut and used for DNA extraction.

[0022] The DNA was extracted using the TIANGEN DNA extraction kit. The specific steps were as follows:

[0023] (1) Take 100 mg of fresh young leaf tissue of Neolamarckia cadamba, add liquid nitrogen and grind it thoroughly into powder, then put it into a 2 - mL centrifuge tube, add 600 μL of buffer LP1, vortex for 1 min, and leave it at room temperature for 10 min;

[0024] (2) Add 130 μL of buffer LP2, mix well thoroughly, and vortex for 1 min;

[0025] (3) Centrifuge at 12000 rpm for 5 min, and transfer the supernatant to a new 1.5 - mL centrifuge tube;

[0026] (4) Add 1.5 times the volume of buffer LP3 of the supernatant, and immediately shake well for 15 s;

[0027] (5) Transfer the liquid to the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;

[0028] (6) Add 600 μL of wash buffer PW, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and repeat once;

[0029] (7) Without adding any reagents, centrifuge at 12,000 rpm for 2 min;

[0030] (8) Transfer the adsorption column into a new centrifuge tube, add 30 μL of ddH 2 O dropwise while suspending, let it stand for 2 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube;

[0031] (9) To increase the yield of genomic DNA, add the supernatant again to the adsorption column, let it stand for 2 min, then centrifuge at 12,000 rpm for 2 min, collect the solution, and the DNA of Neolamarckia cadamba can be obtained;

[0032] (10) Store the extracted Neolamarckia cadamba DNA in a -80 °C ultra-low temperature refrigerator for standby.

[0033] 2. Cloning of the promoter of the sucrose transporter gene NcSUT1 from Neolamarckia cadamba

[0034] (1) According to the genomic sequencing data, design appropriate primers pNcSUT1-F: TGTGGGTAAAGTGGACCAGTGC and pNcSUT1-R: TATTATGACTATGTTGTTCTAG, using Neolamarckia cadamba DNA as a template, amplify a 2015 bp fragment pNcSUT1 upstream of the ATG (start codon) of the NcSUT1 gene. The PCR reaction system and conditions are shown in Table 1 and Table 2 respectively.

[0035] Table 1 PCR reaction system

[0036]

[0037]

[0038] Table 2 PCR reaction conditions

[0039]

[0040] (2) Add Loading Buffer to the PCR reaction solution, pipette and mix well, perform electrophoresis on a 1.5% gel, set the voltage to a constant voltage of 120 V, and the electrophoresis time to 30 min to detect the size of the amplified fragment.

[0041] 3. Gel extraction of the target band

[0042] (1) Perform agarose gel electrophoresis on the PCR product. When the required DNA fragment is completely separated, cut the target DNA fragment in the gel under ultraviolet light, place it in a centrifuge tube and weigh it (0.1 g ≈ 0.1 mL);

[0043] (2) Add an equal volume of Binding Buffer (XP2) and melt the gel block in a 55°C constant temperature water bath for 10 min to release the target fragment. Take it out and shake it intermittently every 2 - 3 min.

[0044] (3) Place a HiBind DNA Mini binding column into a collection tube.

[0045] (4) After the gel block is completely melted, let it stand and cool. After the temperature drops to room temperature, add it to the binding column, let it stand for 1 min, centrifuge at 10000 rpm for 1 min, and discard the waste liquid.

[0046] (5) Add 300 μL of Binding Buffer (XP2) to the column and centrifuge at the maximum speed at room temperature for 1 min. Discard the waste liquid.

[0047] (6) Add 700 μL of SPW Wash Buffer (diluted with absolute ethanol), centrifuge at 10000 rpm at room temperature for 1 min, and repeat once.

[0048] (7) Without adding any reagents, centrifuge at 13000 rpm for 2 min. Discard the waste liquid.

[0049] (8) Place the binding column into a new centrifuge tube, and suspend and add 20 μL of ddH 2 O (previously water - bathed at 60°C) to the middle part of the adsorption membrane. Let it stand at room temperature for 2 min, centrifuge at 13000 rpm for 1 min to elute the DNA, and collect the solution into the centrifuge tube (the elution can be repeated once). Measure the nucleic acid concentration, and store the obtained DNA solution (i.e., the recovered product) at - 20°C or use it for subsequent experiments.

[0050] 4. Ligation of the recovered product with the vector pTopo - Blunt

[0051] Use the Zero Background pTopo - Blunt Cloning kit from Beijing Aidlab Biotechnologies Co., Ltd. The ligation reaction system is as follows: 80 ng of the recovered product, 1 μL of pTopo - Blunt Vector, 1 μL of 10×Enhancer, add ddH 2 O to a total volume of 10 μL.

[0052] After adding the reagents, gently pipette and mix well, centrifuge at low speed to collect all the liquid at the bottom of the centrifuge tube, and ligate at room temperature (20°C - 30°C) for 5 minutes to obtain the ligation product (containing the recombinant plasmid pTopo - pNcSUT1).

[0053] 5. Transformation of the ligation product into competent cells E.coli DH5α

[0054] (1) Thaw 100 μL of E. coli DH5α competent cells on ice, add 10 μL of the ligation product to it, flick gently to mix evenly, and place on ice for 30 min;

[0055] (2) Heat shock in a 42 °C water bath for 45 s, and immediately place on ice for 2 min;

[0056] (3) Add 900 μL of liquid LB medium (without antibiotics) to the transformed E. coli, place it on a shaker at 37 °C and culture under the condition of 200 rpm for 1 h;

[0057] (4) Centrifuge the bacterial solution at 4500 rpm for 30 s, discard the supernatant, leave 50 - 100 μL of liquid to resuspend the bacteria, spread the remaining bacterial solution on solid LB medium (containing the corresponding antibiotic), seal it with a sealing film, and incubate it upside down in an incubator at 37 °C overnight to form single colonies.

[0058] (5) Transfer the monoclonal colonies into 1 mL of LB liquid medium (containing the corresponding antibiotic) in a laminar flow hood, and place it in a shaker at 37 °C and 200 rpm for overnight culture.

[0059] (6) Identify positive clones by colony PCR and perform sequencing. The sequencing results are compared with the reference sequence using DNAMAN software.

[0060] 6. Analysis of promoter sequence characteristics

[0061] Use the online databases PlantCARE (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) and New PLACE (https: / / www.dna.affrc.go.jp / PLACE / ?action=newplace) to analyze the obtained NcSUT1 promoter sequence and predict the possible cis - acting elements. Use SnapGene (https: / / www.snapgene.com / ) to mark the positions of the relevant cis - acting elements.

[0062] II. Results

[0063] 1. According to the genomic sequencing data of Neolamarckia cadamba, design appropriate primers, use the DNA of Neolamarckia cadamba leaves as a template, and amplify a 2015 - bp fragment upstream of the ATG (start codon) of the NcSUT1 gene by PCR. After detecting the PCR product by agarose gel electrophoresis, a target band that meets the expectation is obtained ( Figure 1) It was named pNcSUT1 (its nucleotide sequence is shown in SEQ ID NO.1). After the PCR product was recovered, purified and ligated with the cloning vector pTopo-Blunt, it was transformed into Escherichia coli. The positive clones were sequenced. Sequence analysis showed that the target sequencing sequence was exactly the same as the reference sequence, indicating that the full-length promoter of the NcSUT1 gene had been successfully cloned.

[0064] 2. The cis-acting element analysis of the promoter sequence was carried out using the online analysis databases PlantCARE and New PLACE, as Figure 2 shown in and Table 3. As can be seen from Figure 2 the table, the NcSUT1 promoter contains multiple core promoter elements such as TATA-box and CAAT-box, indicating that it is a typical eukaryotic promoter. Some elements related to stress response and hormone response were also predicted in the NcSUT1 promoter; in addition, a large number of light response elements were found, among which Box 4 appeared the most times (8).

[0065] Table 3 Prediction results of cis-acting elements of the NcSUT1 promoter

[0066]

[0067] Example 2: Verification of promoter activity by tobacco transient expression system

[0068] I. Method

[0069] 1. Construction of dual-luciferase reporter gene vector

[0070] (1) Cloning of different length promoter fragments of the NcSUT1 gene

[0071] Using pTopo-pNcSUT1 as a template, according to the prediction results of cis-acting elements, 7 pairs of PCR primers for constructing sequence deletion vectors were designed by CE design software. The specific primers are shown in Table 4 (primers Luc-pNcSUT1A-F to Luc-pNcSUT1G-F, Luc-pNcSUT1-R). 7 promoter fragments with 5'-end sequence deletions of different lengths were amplified by PCR. The PCR reaction system and conditions are shown in Table 1 and Table 2. After electrophoresis, the gel was recovered for subsequent recombination experiments.

[0072] Table 4 Primer sequences

[0073] Primer Name Primer Sequence Sequence Number Luc-pNcSUT1A-F ctatagggcgaattgggtaccTGTGGGTAAAGTGGACCAGTGC SEQ ID NO.2 Luc-pNcSUT1B-F ctatagggcgaattgggtaccTTTCGGAGTATAAATCGAAGCA SEQ ID NO.3 Luc-pNcSUT1C-F ctatagggcgaattgggtaccCACGACTTTTGGGTAAAGGG SEQ ID NO.4 Luc-pNcSUT1D-F ctatagggcgaattgggtaccTATGAAATCTAAATGCCATTCTAC SEQ ID NO.5 Luc-pNcSUT1E-F ctatagggcgaattgggtaccCAAATAGATTACACATACATGC SEQ ID NO.6 Luc-pNcSUT1F-F ctatagggcgaattgggtaccCAAAAGGAAAATGCCTAACAA SEQ ID NO.7 Luc-pNcSUT1G-F ctatagggcgaattgggtaccCAATTAATTTTTGCAGATTTTC SEQ ID NO.8 Luc-pNcSUT1-R cgctctagaactagtggatccTATTATGACTATGTTGTTCTAGAGAGAATAGACA SEQ ID NO.9

[0074] (2) One-step cloning to ligate the fragment with the vector pGreenⅡ0800-LUC

[0075] ①Double digest the expression vector pGreenⅡ0800-LUC with the restriction enzymes KpnI and BamHI. The reaction system is shown in Table 5. Incubate at 37 °C for 2 h. Add Loading Buffer to the double-digested reaction solution, pipette and mix well. Perform 1.5% gel electrophoresis with a constant voltage of 120 V for 30 min. Detect the size of the digested vector fragment and perform gel extraction.

[0076] Table 5 Double-digestion reaction system

[0077] Reagent Dosage 10×K buffer 5μL KpnI 4μL BamHI 4μL pGreenⅡ0800-LUC (plasmid) 3μL (~2μg) <![CDATA[ddH 2 O]]> Make up to 100μL

[0078] ②Use the ClonExpress II One Step Cloning Kit produced by Novizan to ligate promoter fragments of different lengths with the linearized vector pGreenⅡ0800-LUC. The ligation system is shown in Table 6. Incubate in a metal bath at 37 °C for 30 min, let it stand on ice for 5 min, and immediately transform the competent cells E.coli DH5α.

[0079] Table 6 Ligation system

[0080] Reagent Dosage Linearized Vector 0.02×Vector Length (ng) Target Fragment 0.02×Fragment Length (ng) 5×CE II buffer 4μL Exnase II 2μL <![CDATA[ddH 2 O]]> Make up to 20μL

[0081] ③Spread the transformation products on an LB plate containing the corresponding antibiotic for culture. Transfer monoclonal colonies into 1 mL of LB liquid medium (containing the corresponding antibiotic) in a laminar flow hood, and incubate overnight at 37 °C and 200 rpm in a shaker. Identify positive clones by colony PCR and perform sequencing. Compare the results with the reference sequence using DNAMAN software.

[0082] (3) Plasmid extraction and transformation of Agrobacterium

[0083] Inoculate 50 μL of the positive bacterial solution with correct sequencing into 10 mL of LB liquid medium containing Kan antibiotic, and culture with shaking at 37 °C and 200 rmp for 12 h. Use the plasmid extraction kit from TIANGEN Company, and refer to the instruction manual for the extraction steps. Transfer the constructed pGreenⅡ0800-pNcSUT1::LUC fusion expression vector into Agrobacterium GV3101 (Psoup-p19) competent cells by the freeze-thaw method, and refer to the instruction manual for the specific steps.

[0084] 2. Transient expression of dual luciferase in tobacco

[0085] ①Streak and activate the Agrobacterium containing the pGreenⅡ0800-pNcSUT1::LUC recombinant plasmid on an LB plate containing antibiotics for 1 - 2 d;

[0086] ②Pick a monoclonal colony and inoculate it into 1 mL of LB liquid medium containing the corresponding antibiotic. Culture at 28 °C and 200 rpm for 12 h;

[0087] ③Transfer 100 μL of the fresh bacterial solution obtained in step ② to 5 mL of LB liquid medium containing the corresponding antibiotic. Culture at 28 °C and 200 rpm for 8 h;

[0088] ④Centrifuge at 5000 rpm for 8 min at room temperature to collect the bacterial cells. Suspend the bacterial cells with the infection solution (formula shown in Table 7), adjust the OD value to about 0.4, add acetosyringone to a final concentration of 100 μM, and incubate in the dark for 2 h;

[0089] ⑤Select the third and fourth leaves (counting from the bottom upwards) of Nicotiana benthamiana seedlings at the age of 4 - 5 weeks for infection. Water thoroughly before infection;

[0090] ⑥Use a 1 mL syringe without a needle to aspirate the infection solution and inject it into the leaf from the back of the tobacco. Circle the injection area with a marker pen;

[0091] ⑦After 2 days of dark culture, culture normally for 2 days. Cut the leaves and spray 1 mmol·L -1 of D - Luciferin on the back of the leaves. Place in the dark for 5 min and then perform fluorescence detection in a dark box. The instrument used is a plant in - vivo imaging system (BERTHOLDNightSHADE LB 985).

[0092] Table 7 Formula of tobacco infection solution

[0093] Reagent Volume <![CDATA[1M MgCl 2 > 10mL 0.2M MES 10mL <![CDATA[ddH 2 O]]> Make up to 100mL

[0094] I. Results

[0095] Design primers and amplify 7 truncated fragments of different lengths of pNcSUT1 (whose nucleotide sequence is shown in SEQ ID NO.1) by PCR, as Figure 3 shown. The lengths of each fragment are 2015 bp, 1695 bp, 1377 bp, 1093 bp, 669 bp, 318 bp, and 165 bp, denoted as pNcSUT1A, pNcSUT1B, pNcSUT1C, pNcSUT1D, pNcSUT1E, pNcSUT1F, and pNcSUT1G respectively. Link this series of promoter sequence deletion fragments into the dual - luciferase reporter gene vector to obtain the pNcSUT1A::LUC - pNcSUT1G::LUC expression vectors. Inject the Agrobacterium containing the pNcSUT1A::LUC - pNcSUT1G::LUC expression vectors into the tobacco leaves respectively, and use the empty vector (EV) without a promoter as a negative control. Observe the fluorescence imaging after 2 days of co - culture. The results are as Figure 4As shown, the promoter fragments of pNcSUT1C, pNcSUT1D, pNcSUT1E, and pNcSUT1F can all drive the expression of the LUC gene. The full-length promoter vector pNcSUT1A and the deleted promoter vector pNcSUT1B cannot drive the expression of the LUC gene, while pNcSUT1C has activity. It is speculated that there may be promoter activity inhibitory elements in the region of -1377bp to -1695bp. Since the deletion from pNcSUT1E to pNcSUT1F causes a decrease in promoter activity, resulting in the deleted promoter vector pNcSUT1G being unable to drive the expression of the LUC gene, it is speculated that there are elements very important for promoter activity between pNcSUT1E and pNcSUT1F (-669bp to -318bp). The -318bp promoter (pNcSUT1F) can drive the expression of the LUC gene normally, indicating that it has a complete promoter function.

[0096] Example 3: Analysis of the Activity of the NcSUT1 Promoter in Stably Transformed Arabidopsis thaliana Plants

[0097] I. Method

[0098] 1. Construction of the Promoter-Driven GUS Expression Vector

[0099] (1) Construction of the Entry Vector by BP Cloning Reaction and Transformation and Identification

[0100] Using pTopo-pNcSUT as a template, primers Gus-pNcSUT1C-F: ggggacaagtttgtacaaaaaagcaggctCACGACTTTTGGGTAAAGGG and Gus-pNcSUT1C-R: ggggaccactttgtacaagaaagctgggtTATTATGACTATGTTGTTCTAGAG were designed to PCR amplify the 1377bp fragment pNcSUT1C of the NcSUT1 promoter. The PCR reaction system and conditions are shown in Tables 1 and 2. After electrophoresis and gel running, gel extraction was performed for subsequent experiments.

[0101] The target gene fragment with attB sites at both ends was used to conjugate with the donor vector (pDONR207) to form the entry vector. Thaw 2×Gateway BP Cloning Enzyme on ice and prepare the following reaction system in a PCR tube (Table 8). Gently pipette and mix well, briefly centrifuge at low speed, and incubate overnight at 25°C in a metal bath. Add 1 μL of 10× Proteinase K to the reaction solution to terminate the reaction, mix well, and incubate at 37°C for 10 min.

[0102] Table 8 BP Cloning System

[0103] Reagent Dosage 2×Gateway BP Cloning Enzyme 5μL attB-Target Fragment 150ng pDONR207 1μg <![CDATA[ddH 2 O]]> Make up to 10μL

[0104] The ligation product was used to transform competent cells of E. coli DH5α. The transformed product was spread on an LB plate containing the corresponding antibiotic for culture. In a laminar flow hood, monoclonal colonies were transferred into 1 mL of LB liquid medium (containing the corresponding antibiotic), and cultured overnight in a shaker at 37 °C and 200 rpm. Positive clones were identified by colony PCR and sequenced. The sequencing results were aligned with the reference sequence using DNAMAN software. Monoclonal plasmids with correct sequencing were extracted.

[0105] (2) Construction of the expression vector by LR cloning reaction and transformation and identification

[0106] Thaw the 2×Gateway LR Clonase on ice, and prepare the following reaction system in a PCR tube (Table 9). Gently pipette to mix well, centrifuge briefly at low speed, and incubate overnight at 25 °C in a metal bath. Add 1 μL of 10× Proteinase K to the reaction solution to terminate the reaction, mix well and incubate at 37 °C for 10 min.

[0107] Table 9 LR cloning system

[0108] Reagent Dosage 2×Gateway LR Cloning Enzyme 5μL pDONR207-Target Fragment 300ng pHGWFS.7 1μg <![CDATA[ddH 2 O]]> Make up to 10μL

[0109] The ligation product was used to transform competent cells of E. coli DH5α. The transformed product was spread on an LB plate containing the corresponding antibiotic for culture. In a laminar flow hood, monoclonal colonies were transferred into 1 mL of LB liquid medium (containing the corresponding antibiotic), and cultured overnight in a shaker at 37 °C and 200 rpm. Positive clones were identified by colony PCR and sequenced (completed by Tsingke Biotechnology Co., Ltd.). The sequencing results were aligned with the reference sequence using DNAMAN software. Monoclonal clones with correct PCR band sizes were selected for sequencing and preservation of the bacterial liquid.

[0110] 2. Genetic transformation of Arabidopsis thaliana and screening and identification of positive plants

[0111] Take 1 mL of Agrobacterium liquid containing the recombinant plasmid and add it to 100 mL of LB (containing the corresponding antibiotics). Incubate with shaking at 28 °C and 200 rpm for 14 - 18 h until the OD value is about 0.8. Centrifuge at 4 °C and 5500 rpm for 10 min, and discard the supernatant. Suspend the precipitate in 40 mL of infection solution (an aqueous solution containing 5% sucrose and 0.02% (v / v) Silwet L - 77). Centrifuge at 4 °C and 5000 rpm for 10 min, and discard the supernatant. Suspend the cells in 50 mL of infection solution. Select healthy Arabidopsis thaliana at the early fruiting stage, water it thoroughly before infection, remove the fruit pods, soak the entire inflorescence in the infection solution for about 50 s, try to avoid contact of the leaves with the infection solution, place it horizontally in a dark box, and pay attention to moisturizing cultivation. After 24 h, cultivate it normally. Infiltrate again after one week. After the siliques mature, harvest the seeds and store them in a dry and low - temperature environment. The T0 - generation seeds need to be sown aseptically, screened on a resistant plate, and the DNA is extracted for identification until the T3 - generation homozygote is obtained for subsequent phenotypic observation.

[0112] 3. GUS activity detection of transgenic Arabidopsis thaliana

[0113] Select the seedlings cultured on MS plates containing 30 mg·L -1 Hyg (hygromycin) resistance for 3 d and 7 d respectively, the inflorescences of plants grown in soil for 35 d, the siliques 6 days after flowering, and the seeds 15 days after flowering. Immerse them in the GUS staining solution (add X - Gluc to the GUS staining buffer at a ratio of 1:50, prepare it freshly before use). After the seedlings, inflorescences, siliques, and seeds are immersed in the GUS staining solution, the vacuum infiltration method is needed to help the substrate penetrate into the cells. Wrap it with tin foil to avoid light, and place it on a shaker at 37 °C for staining for 2 - 3 h until the plants turn blue. Wash it several times with 75% alcohol until the negative control (wild type) becomes colorless. Take pictures and record under a stereomicroscope.

[0114] II. Results

[0115] The transient expression experiment of LUC in tobacco showed that the promoter fragments pNcSUT1A and pNcSUT1B, which are 2015 bp and 1695 bp upstream of the ATG (start codon), could not drive the expression of LUC. It is speculated that there may be inhibitory elements in the region from - 1377 bp to - 1695 bp. Therefore, in this example, a transgenic pHGWFS.7 - pNcSUT1C - GUS expression vector was constructed to stably transform Arabidopsis thaliana plants to detect the tissue - specific expression characteristics of the pNcSUT1C promoter. GUS staining was observed for the seedlings, flowers, siliques, and seeds of the transgenic Arabidopsis thaliana plants respectively. The results showed that for the transgenic Arabidopsis thaliana containing the pNcSUT1C promoter vector, GUS was expressed in the parts with rich vasculature in tissues such as the leaf veins and roots of seedlings, petals, anthers, filaments, flower stalks, siliques, funicles, and pod stalks, but not in seeds ( Figure 5 ).

Claims

1. The promoter of the Neolamarckia cadamba sucrose transporter gene NcSUT1, characterized in that, its nucleotide sequence is shown as the 639-2015th bases, 923-2015th bases, 1347-2015th bases or 1698-2015th bases of SEQ ID NO.

1.

2. An expression vector, characterized in that, it contains the promoter of the Neolamarckia cadamba sucrose transporter gene NcSUT1 described in claim 1.

3. The application of the promoter of the Neolamarckia cadamba sucrose transporter gene NcSUT1 described in claim 1 or the expression vector containing the promoter of the Neolamarckia cadamba sucrose transporter gene NcSUT1 described in claim 1 in plant genetic improvement.

4. The application according to claim 3, characterized in that, it is the application of the promoter of the Neolamarckia cadamba sucrose transporter gene NcSUT1 in constructing transgenic plants with specific expression in the vascular part of plants.

5. The application according to claim 3, characterized in that, the plant is Neolamarckia cadamba or Arabidopsis thaliana.

Images