Adeno-associated virus mutant and its application

Abstract

The present invention belongs to the field of biotechnology, and discloses an adeno-associated virus mutant and its application. The present invention provides an adeno-associated virus capsid protein mutant, whose amino acid sequence is shown in SEQ ID No.10. The present invention uses a strategy for designing a polypeptide combinatorial library based on the RGD motif, combined with a directed screening method, to discover effective AAV variants through a single screening process with high screening accuracy. A muscle-specific AAV mutant was obtained, which has a good effect in muscle tissue, low liver tropism, and good specificity. The present invention provides more useful and optional vector tools for gene therapy of muscle diseases, and has great clinical value and commercial application scenarios.

Description

[0001] This invention patent application is a divisional application based on Chinese patent application No. 202310898798.5, filed on July 21, 2023, with the invention name “Adeno-associated virus mutants and their applications”. Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to an adeno-associated virus mutant with muscle targeting and application thereof. Background Art

[0003] Adeno-associated virus (AAV) is a small non-enveloped virus that encapsulates a linear single-stranded DNA genome. It belongs to the genus Dependovirus of the family Parvoviridae and requires a helper virus (usually adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment contained in a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and inverted terminal repeats (ITR). Recombinant adeno-associated virus vectors (rAAV) are derived from non-pathogenic wild-type adeno-associated viruses. Due to its advantages such as wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance and stable physical properties, it has been widely used as a gene transfer vector in gene therapy and vaccine research. In medical research, rAAV has been used in the study of gene therapy for a variety of diseases (including in vivo and in vitro experiments), such as gene function research, construction of disease models, and preparation of gene knockout mice.

[0004] In recent years, gene therapy has emerged as a new approach to treating muscle diseases. Take Duchenne muscular dystrophy (DMD) as an example. It is a rare and fatal neuromuscular genetic disease. DMD is caused by changes or mutations in the gene encoding dystrophin. Symptoms of DMD usually appear in infants and young children, and patients experience developmental delays, such as difficulty walking, climbing stairs, or standing up from a sitting position. SRP-9001 (AAVrh74.MHCK7.micro-Dystrophin) is a gene therapy candidate from Sarepta / Roche that utilizes the MHCK7 promoter combined with the AAVrh74 vector to deliver a micro-dystrophin transgene that produces a smaller but functional dystrophin (called micro-dystrophin), which is a functional protein that is lacking in DMD patients. On June 22, 2023, Sarepta Therapeutics announced that its AAV gene therapy Delandistrogene moxeparvovec (SRP-9001) was approved by the FDA for the treatment of Duchenne muscular dystrophy (DMD) under the trade name Elevidys. The drug has good efficacy and significantly improved the patient's muscle function. However, AAV treatment also has disadvantages. For example, poor targeting and specificity can cause excessive doses to cause the immune system to react, leading to side effects. In addition, high doses also mean greater production difficulty and higher costs. Therefore, the main purpose of AAV serotype modification is to develop drugs with higher targeting to reduce drug doses, or to make drugs have better specificity to avoid adverse reactions.

[0005] In summary, although AAV is one of the most widely used and safest gene therapy vectors, aspects such as lower dose muscle targeting in vivo still need further improvement. Therefore, it is necessary to develop serotypes with better therapeutic effects, lower therapeutic doses, reduced side effects and usage costs to meet the needs of patients and promote AAV-based gene therapy methods towards large-scale and socialized applications. This is of great significance for improving the benefits of gene therapy and serving the majority of patients. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant and its application, wherein the adeno-associated virus mutant has muscle targeting, high specificity and good safety.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides an adeno-associated virus capsid protein mutant, wherein a heterologous peptide is inserted into the adeno-associated virus capsid protein mutant; the amino acid sequence of the heterologous peptide is a sequence as shown in any one of SEQ ID No. 1 to 4.

[0009] The adeno-associated virus capsid protein mutant of the present invention has good targeting to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting is improved by up to about 10 times, and the liver tropism is also 2 to 3 times lower than that of the control group, with good specificity.

[0010] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, the insertion site of the heterologous peptide is located between amino acids 583 and 591 of the adeno-associated virus capsid protein.

[0011] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, its amino acid sequence is any one of the sequences shown in SEQ ID No. 9 to 12.

[0012] In a second aspect, the present invention provides a nucleic acid encoding an adeno-associated virus capsid protein mutant, the nucleotide sequence of which comprises a heterologous peptide nucleotide sequence as shown in SEQ ID No. 5-8.

[0013] As a preferred embodiment of the nucleic acid encoding the adeno-associated virus capsid protein mutant of the present invention, its nucleotide sequence is a sequence as shown in any one of SEQ ID No.13 to SEQ ID No.16.

[0014] In a third aspect, the present invention provides a recombinant adeno-associated virus, including the adeno-associated virus capsid protein mutant.

[0015] The recombinant adeno-associated virus vector constructed by the adeno-associated virus capsid protein mutant of the present invention has higher specificity, better safety and a wide range of applications.

[0016] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it also includes a heterologous target gene.

[0017] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

[0018] In a fourth aspect, the present invention uses the adeno-associated virus capsid protein mutant and the recombinant adeno-associated virus in the preparation of a drug or preparation for delivering a gene product to cells or tissues of a subject.

[0019] As a preferred embodiment of the application of the present invention, the cells are muscle cells; the tissues are muscle tissues.

[0020] In a fifth aspect, the present invention uses the adeno-associated virus capsid protein mutant and the recombinant adeno-associated virus in the preparation of a drug delivery tool for preventing and / or treating muscle diseases.

[0021] In a sixth aspect, the present invention uses the adeno-associated virus capsid protein mutant and the recombinant adeno-associated virus in the preparation of drugs for treating muscle diseases.

[0022] As a preferred embodiment of the application described in the present invention, the muscle diseases include but are not limited to any one of Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), X-linked myotubular myopathy (XLMTM), limb-girdle muscular dystrophy (LGMD), myotonic dystrophy, and facioscapulohumeral muscular dystrophy.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention uses a method based on a specific motif to construct a small AAV virus library. Effective AAV variants can be discovered through a single screening process, with high screening accuracy, and no need for multiple rounds of repeated screening and verification. The present invention obtained 4 muscle-specific AAV9 mutants, which were verified to have good effects in muscle tissues such as quadriceps, biceps, and abdominal muscles from the mRNA and protein expression levels (compared with the control group AAV9, the muscle targeting was increased by up to about 10 times), and the liver tropism was low (2 to 3 times lower than the control group) and the specificity was good. Providing more useful and optional vector tools for gene therapy of muscle diseases will benefit a large number of patients and have great clinical value and commercial application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a targeting analysis of different serotypes on C57 mouse muscle (quadriceps femoris) (3 weeks); in the figure, A is the relative expression level of mRNA in quadriceps femoris, and B is the protein expression level in quadriceps femoris;

[0026] Figure 2 This is a targeting analysis of different serotypes on C57 mouse muscle (biceps brachii) (3 weeks); in the figure, A is the relative expression level of mRNA in biceps brachii, and B is the protein expression level in biceps brachii;

[0027] Figure 3 This is a targeting analysis of different serotypes on C57 mouse muscle (abdominal muscle) (3 weeks); in the figure, A is the relative expression level of mRNA in abdominal muscle, and B is the protein expression level in abdominal muscle;

[0028] Figure 4 The figure shows the tropism of different serotypes to the liver of C57 mice (3 weeks); in the figure, A is the relative expression level of mRNA in the liver, and B is the protein expression level in the liver. DETAILED DESCRIPTION

[0029] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0030] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0031] Example 1: Screening of novel mutants

[0032] (1) Construction of the backbone plasmid of the AAV9 capsid protein mutant library

[0033] The AAV9 library backbone vector contains the MHCK promoter, Intron, the mutated AAV9 CAP sequence [the sequence after T582 of the AAV9CAP sequence is removed, and the T582 nucleic acid sequence ACA is mutated to ACT, thereby forming a restriction site BsrGI (TGTACA) with the polyA front sequence for subsequent backbone restriction linearization] and poly A. The above sequence is synthesized by gene synthesis and inserted between the ITRs of the AAV vector plasmid to form the AAV9 library backbone vector.

[0034] (2) Construction of mutant Rep-CAP vector

[0035] By introducing a stop codon at the N-terminus of the VP1, VP2, and VP3 proteins of the CAP sequence in AAV9, the Rep-CAP vector can normally express the Rep protein and AAP protein, but cannot express the VP1, VP2, and VP3 proteins of CAP, thereby avoiding contamination of the CAP sequence in the parent AAV9. The above sequence is synthesized by gene synthesis and inserted to replace the CAP sequence of the AAV9 Rep-CAP vector.

[0036] (3) Construction of a random peptide vector library containing the RGD motif

[0037] Primer design: The N583 and A591 sequences of AAV9 CAP were used as insertion and modification sequences. The original sequence was N583-HQSAQAQ-A591, and random tetrapeptide sequences containing RGD were inserted and replaced at different sites to form the following 18 combinations: N583-HQSAQ (RGD + random tetrapeptide) AQ-A591, N583-HQSAQ (RGD + random tetrapeptide) Q-A591, N583-HQSAQ (RGD + random tetrapeptide) -A591, N583-HQSA (RGD + random tetrapeptide) AQ-A591, N583-HQSA (RGD + random tetrapeptide) Q-A591, N583-HQSA (RGD + random tetrapeptide) -A591, N583-HQS (RGD + random tetrapeptide) AQ -A591, N583-HQS (RGD + random tetrapeptide) Q-A591, N583-HQS (RGD + random tetrapeptide)-A591, N583-HQ (RGD + random tetrapeptide) AQ-A591, N583-HQ (RGD + random tetrapeptide) Q-A591, N583-HQ (RGD + random tetrapeptide) -A591, N583-H (RGD + random tetrapeptide) AQ-A591, N583-H (RGD + random tetrapeptide) Q-A591, N583-H (RGD + random tetrapeptide) -A591, N583-(RGD + random tetrapeptide) AQ-A591, N583-(RGD + random tetrapeptide) Q-A591, N583-(RGD + random tetrapeptide) -A591. Among them, (RGD+random tetrapeptide) itself also has 5 RGD position combinations: RGDXXXX, XRGDXXX, XXRGDXX, XXXRGDX, XXXXRGD. Therefore, a total of 90 sequence primers are formed, which are used as upstream primers and downstream primers to form primer pairs. When the AAV9 CAP vector is used as a template, the target fragment library is amplified. The fragment library has homology arms at both ends, which can be homologously recombined with the AAV9 library backbone plasmid after enzyme digestion to form a vector library.

[0038] The specific operation steps are as follows: using the vector containing AAV9 CAP as a template, PCR amplification using the above primers to obtain a fragment containing a random sequence. The fragment is subjected to gel electrophoresis and gel recovery to obtain a purified nucleic acid fragment; the nucleic acid fragment is connected to the AAV9 library backbone vector (after BsrG I restriction enzyme digestion and gel recovery purification) by Gibson homologous recombination connection, and the connected vector is purified by a PCR product purification kit and digested with Plasmid-Safe DNase enzyme to remove the unconnected fragments; finally, after purification by a PCR product purification kit, the constructed AAV9 random polypeptide vector library containing the RGD motif is obtained.

[0039] (4) Construction of AAV9 mutant virus library

[0040] The mutant Rep-Cap plasmid, AAV9 mutant plasmid library, and pHelper plasmid were co-transfected into HEK-293T cells, and the adeno-associated virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured at 10 12 GC / mL~10 13 GC / mL is the appropriate titer, and the AAV9 mutant virus library is obtained and placed at -80°C for future use.

[0041] (5) Screening of AAV9 mutants

[0042] (5.1) Animal injection and dissection

[0043] The animal experiment used 6-8 week old C57 male mice, which were divided into groups according to different doses. Each mouse in each group was injected with 2E10GC and 3E9GC virus libraries, respectively. The relevant viruses were prepared according to the experimental groups. Animal dissection and organ sampling (muscles, heart, liver, etc.) were performed 21 days after the injection. The samples were quickly frozen in liquid nitrogen and used for subsequent RNA extraction experiments.

[0044] (5.2) Total RNA extraction and RT-PCR

[0045] Sample grinding: Precool the grinder 10 minutes in advance and set the grinding parameters. Take out the animal tissue sample stored in the -80℃ refrigerator, take about 50-100 mg of tissue, cut it into soybean size in a sterile culture dish, and transfer it to a 1.5mL RNase-free EP tube. Add an appropriate amount of TransZolUp according to the ratio of 1mL TransZol Up per 50-100 mg tissue, then add two clean and sterile 3mm grinding steel beads and wrap it with sealing film. Place the sample in the 24-hole grinding adapter and balance it, tighten the screw, and press the cover button. Start the grinding program, take out the sample after the instrument runs, observe the sample grinding particle size, and if there is no large piece of tissue left, you can proceed with the subsequent extraction operation. The ground sample is centrifuged at 4℃, 12,000×g for 2 minutes, and the supernatant is transferred to a new 1.5mL RNase-free EP tube with the corresponding label.

[0046] Extraction of total RNA from samples: Refer to the instructions of TransZol Up Plus RNA Kit (Beijing Quanshijin, catalog number: ER501) for details. For every 1 mL of TranZol up, add 0.2 mL of RNA Extraction Agent, shake vigorously for 5 minutes, and centrifuge at 12,000×g, 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5mL RNase-free EP tube, add an equal volume of anhydrous ethanol (precipitate may appear at this time), and gently invert to mix; add the obtained solution and precipitate to the centrifuge column, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; add 500μL CB9, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; repeat the above steps once; add 500μL WB9, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; repeat the above steps once; centrifuge at 12,000×g at room temperature for 2min to completely remove residual ethanol; place the centrifuge column in a 1.5mL RNase-free EP tube, add 30~50μL (depending on the size of the tissue) RNase-free Water in the center of the centrifuge column, and let it stand at room temperature for 1min; centrifuge at 12,000×g at room temperature for 1min to elute RNA;

[0047] Determination of sample nucleic acid concentration: Use a micro-nucleic acid quantifier detector to detect RNA concentration, record the concentration, OD260 / 280, OD260 / 230, and store the RNA at -80°C.

[0048] RT-PCR: Extract RNA samples and use PrimeScriptTM IV 1st strand cDNA Synthesis Mix (Takara, 6215A) to synthesize the first strand cDNA. Then use NEB Q5 for 2 rounds of PCR amplification (the first round uses outer primers for amplification; the second round uses the first round product recovered from the gel as a template and amplifies with NGS primers). The PCR products of the corresponding band size recovered from the gel are sent to the company for NGS sequencing.

[0049] NGS sequencing, data analysis, and selection of candidate vectors: After sequencing, sequencing data analysis is performed, and sequences with high frequency rankings and multiple occurrences in multiple samples are selected as candidates for subsequent AAV mutant construction and verification.

[0050] Example 2: Construction of AAV capsid protein mutants and virus production

[0051] (1) Construction of mutant serotype vector and plasmid extraction

[0052] The AAV9 Rep-CAP plasmid was double-digested with Smi I and BshT I, and the fragment band of about 5000 bp was cut out for gel electrophoresis and gel recovery to obtain the digested backbone fragment.

[0053] According to the Cap sequence of mutant 1, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ221-R primers to amplify and gel-recover to obtain the target product YJ221-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ221-F+cap-r primers to amplify and gel-recover to obtain the target product YJ221-2, and by mixing the backbone fragment, YJ221-1, and YJ221-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 1 can be recombined and constructed;

[0054] According to the Cap sequence of mutant 2, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ222-R primers to amplify and gel-recover to obtain the target product YJ222-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ222-F+cap-r primers to amplify and gel-recover to obtain the target product YJ222-2, and by mixing the backbone fragment, YJ222-1, and YJ222-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 2 can be recombined and constructed;

[0055] According to the Cap sequence of mutant 3, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ223-R primers to amplify and gel-recover to obtain the target product YJ223-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ223-F+cap-r primers to amplify and gel-recover to obtain the target product YJ223-2, and by mixing the backbone fragment, YJ223-1, and YJ223-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 3 can be recombined and constructed;

[0056] According to the Cap sequence of mutant 4, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ224-R primers to amplify and gel-recover to obtain the target product YJ224-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ224-F+cap-r primers to amplify and gel-recover to obtain the target product YJ224-2, and by mixing the backbone fragment, YJ224-1, and YJ224-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 4 can be recombined and constructed;

[0057] According to the Cap sequence of mutant 5, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ225-R primers to amplify and gel-recover to obtain the target product YJ225-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ225-F+cap-r primers to amplify and gel-recover to obtain the target product YJ225-2, and by mixing the backbone fragment, YJ225-1, and YJ225-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 5 can be recombined and constructed;

[0058] According to the Cap sequence of mutant 6, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ226-R primers to amplify and gel-recover to obtain the target product YJ226-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ226-F+cap-r primers to amplify and gel-recover to obtain the target product YJ226-2, and by mixing the backbone fragment, YJ226-1, and YJ226-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 6 can be recombined and constructed;

[0059] According to the Cap sequence of mutant 7, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ227-R primers to amplify and gel-recover to obtain the target product YJ227-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ227-F+cap-r primers to amplify and gel-recover to obtain the target product YJ227-2, and by mixing the backbone fragment, YJ227-1, and YJ227-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 7 can be recombined and constructed;

[0060] According to the Cap sequence of mutant 8, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+YJ228-R primers to amplify and gel-recover to obtain the target product YJ228-1, using the Rep-CAP plasmid of AAV9 as a template, using the YJ228-F+cap-r primers to amplify and gel-recover to obtain the target product YJ228-2, and by mixing the backbone fragment, YJ228-1, and YJ228-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 8 can be recombined and constructed;

[0061] The primers involved in the construction of the Rep-CAP vector of the above-mentioned AAV capsid protein mutant are shown in Table 1:

[0062] Table 1 Primer sequences

[0063]

[0064]

[0065] Take a clean 200μL PCR tube, mark it and place it on an ice box. Prepare the reaction solution with the above enzyme-cut backbone and each target fragment at a backbone: fragment molar ratio of 1:3, and react in a PCR instrument at 50℃ for 30min for recombination connection. Take 50μL of competent cells and thaw them on ice. Mix 10μL of the connection product with DH5α competent cells and place them on ice for 20-30 minutes; heat shock at 42℃ for 45 seconds; quickly place them on ice for 2 minutes, add 400μL of recovery SOC medium (without antibiotics), and culture at 37℃ and 200rpm for 1h; evenly apply it to Amp resistance plate (50μg / mL) and culture at 37℃ for 14 hours. Select monoclonal bacteria, expand the culture in 4mL liquid LB medium (Amp+ resistance), and culture at 37℃ for 14 hours.

[0066] The bacterial solution was centrifuged at 12000rpm for 1 minute, and the supernatant medium was discarded; 250μL of buffer P1 / RNaseA mixture was added, and the bacteria were resuspended by high-speed vortexing; 250μL of buffer P2 was added, and the solution was inverted 8-10 times; 350μL of buffer P3 was added, and the solution was immediately inverted and mixed 8-10 times to completely neutralize the solution; centrifuged at 13000rpm for 10 minutes, and the supernatant was passed through the column; centrifuged at 12000 for 1 minute, and the waste liquid was discarded, and 500μL of PW1 was added, and the waste liquid was discarded; 600μL of PW2 was added, and the supernatant was discarded; 600μL of PW2 was added, and the solution was centrifuged at 12000 for 1 minute, and the supernatant was discarded; the solution was idling at 12000rpm for 2 minutes; 30-50μL of 55℃ preheated eluent was added, and the solution was allowed to stand for 2 minutes, and the solution was centrifuged at 12000rpm for 1 minute. Use a micro-volume nucleic acid quantifier to detect the concentration.

[0067] The obtained plasmid was tested for concentration, and 10 μL of the positive plasmid identified by enzyme digestion was sent for sequencing, and the positive plasmid was stored at -20°C. The sequencing results showed that the obtained plasmid could encode the variant capsid protein VP1. Finally, according to the amount of virus required for the later test, the relevant Helper plasmid, the Rep-Cap plasmid (AAV9 wild type and AAV9 mutants 1 to 8) plasmids of each group, and the GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) were extracted.

[0068] (2) Packaging and purification of mutant serotype viruses

[0069] The Rep-Cap plasmids of each group (AAV9 wild type and AAV9 mutants 1 to 8), the GOI plasmid expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts, and the AAV virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured to be 1E+12GC / mL to 1E+13GC / mL, which was an appropriate titer, and the cells were placed at -80°C for use.

[0070] Example 3: Comparative test of various indicators of mutant serotypes

[0071] (1) Animal injection and dissection

[0072] The animal experiment used C57 male mice aged 6 to 8 weeks. The relevant viruses were prepared according to the designed experimental and control groups. Each mouse in each group was injected with 2E11GC virus. The animals were dissected and organs were collected 3 weeks after the injection. The samples were quickly frozen in liquid nitrogen and used for subsequent experiments such as RNA extraction and WB detection.

[0073] (2) Detection of target gene mRNA expression level

[0074] (2.1) Total RNA extraction and reverse transcription:

[0075] Sample grinding: Precool the grinder 10 minutes in advance and set the grinding parameters. Take out the animal tissue sample stored in the -80℃ refrigerator, take about 50-100 mg of tissue, cut it into soybean size in a sterile culture dish, and transfer it to a 1.5mL RNase-free EP tube. Add an appropriate amount of TransZolUp according to the ratio of 1mL TransZol Up per 50-100 mg tissue, then add two clean and sterile 3mm grinding steel beads and wrap it with sealing film. Place the sample in the 24-hole grinding adapter and balance it, tighten the screw, and press the cover button. Start the grinding program, take out the sample after the instrument runs, observe the sample grinding particle size, and if there is no large piece of tissue left, you can proceed with the subsequent extraction operation. The ground sample is centrifuged at 4℃, 12,000×g for 2 minutes, and the supernatant is transferred to a new 1.5mL RNase-free EP tube with the corresponding label.

[0076] Extraction of total RNA from samples: Refer to the instructions of TransZol Up Plus RNA Kit (Beijing Quanshijin, catalog number: ER501) for details. For every 1 mL of TransZol up, add 0.2 mL of RNA Extraction Agent, shake vigorously for 5 minutes, and centrifuge at 12,000×g, 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5mL RNase-free EP tube, add an equal volume of anhydrous ethanol (precipitate may appear at this time), and gently invert to mix; add the obtained solution and precipitate to the centrifuge column, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; add 500μL CB9, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; repeat the above steps once; add 500μL WB9, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; repeat the above steps once; centrifuge at 12,000×g at room temperature for 2min to completely remove residual ethanol; place the centrifuge column in a 1.5mL RNase-free EP tube, add 30~50μL (depending on the size of the tissue) RNase-free Water in the center of the centrifuge column, and let it stand at room temperature for 1min; centrifuge at 12,000×g at room temperature for 1min to elute RNA;

[0077] Determination of sample nucleic acid concentration: Use a micro-nucleic acid quantifier detector to detect RNA concentration, record the concentration, OD260 / 280, OD260 / 230, and store the RNA at -80°C.

[0078] Reverse transcription: Each RNA sample was used All-in-One First-Strand cDNASynthesis SuperMix for qPCR (One-Step gDNA Removal) (Beijing Quanshijin, Catalog No.: AE341-03). For specific steps, please refer to the instruction manual.

[0079] (2.2) Quantitative PCR (qPCR) experiment:

[0080] Each group of cDNA was used as a template, and the qPCR system was configured according to the instructions of 2×SYBR Green qPCR Master Mix (Bimake, catalog number: B21203), see Tables 2 to 4:

[0081] Table 2 qPCR system

[0082] Reagents Usage 2×SYBR Green qPCR Master Mix 10μL cDNA template 1.5μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL ROX Reference Dye 0.4μL Deionized water Up to 20μL

[0083] Table 3 Primer sequences

[0084] Primer name Primer sequence (5'->3') Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC

[0085] Table 4 qPCR program settings

[0086]

[0087] (2.3) Data analysis

[0088] According to the Ct value of each group, according to formula 2 -ΔΔct Calculate the relative expression.

[0089] (3) Western Blot detection of target protein expression level

[0090] Sample pretreatment:

[0091] Cut the tissue into small pieces, weigh and record the weight, place in 1.5mL or 2mL centrifuge tubes, label the tubes, freeze at -80℃ for later use, and pre-cool the cryo-grinder; dissolve in RIPA (Biyuntian, P0013B) lysis buffer (add PMSF within a few minutes before use to make the final concentration of PMSF 1mM);

[0092] Add the above complete lysis solution at a ratio of 150-250 μL lysis solution per 20 mg tissue, then add two sterilized zirconium oxide grinding beads, and grind the sample directly in the lysis solution (brain, spinal cord and other tissue samples: temperature -20°C, frequency 70 Hz, 50 s pause 10 s every oscillation, 3-4 cycles; muscle, liver and other samples: temperature -20°C, frequency 70 Hz, 50 s pause 10 s every oscillation, 5-7 cycles). After the sample is ground, centrifuge the sample in a refrigerated centrifuge at 4°C, 12,000×g for 5-10 minutes, then take the supernatant and transfer it to a new sterilized EP tube and store at -20°C or -80°C;

[0093] Protein concentration determination:

[0094] After determining the protein concentration according to the method in the modified BCA protein concentration determination kit (Shenggong, Cat. No. C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix it with the corresponding amount of 5×SDS-PAGE protein loading buffer, boil it in a boiling water bath for 10 minutes, centrifuge it at low speed for a while after cooling, and wait for loading.

[0095] WB (Western Blot) detection:

[0096] a.SDS-PAGE electrophoresis: Determine the appropriate loading volume according to the protein concentration and expression level, which should be less than 20μL / well. The loading volume of tissue homogenate protein is about 20-50μg. The specific operation process of electrophoresis is as follows: Pull out the comb on the precast gel, install the gel into the electrophoresis tank, add electrophoresis buffer to both the inner and outer tanks, add the newly prepared buffer to the inner tank, and check for leaks. If there is no leak, add electrophoresis buffer to the outer tank; Load an appropriate amount of processed protein sample, use the pre-stained standard protein as a reference, and perform 100V constant voltage electrophoresis on the Tianneng electrophoresis device for 100 minutes until bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, remove the gel, and place it in the transfer buffer and wait for subsequent operations;

[0097] b. Transfer: Cut 6 filter papers and 1 PVDF membrane according to the gel area. Soak the PVDF membrane in methanol for 5-10 seconds, then transfer to the transfer buffer and soak for 5 minutes. The filter paper is also pre-wetted in the transfer buffer; install the transfer device: negative electrode (blackboard) - sponge - 3 layers of wet filter paper - gel - PVDF membrane - 3 layers of wet filter paper - sponge - positive electrode (transparent plate). Drive away bubbles in each layer to avoid affecting the transfer effect, clamp the bracket, and put it into the electrotransfer tank; use 100V constant voltage ice bath to transfer the membrane for 100 minutes; judge whether the transfer is successful or not based on whether the pre-stained protein molecular weight standard band is completely transferred to the PVDF membrane; soak the transferred PVDF membrane in PBST solution and wash at room temperature for 5 minutes, cut the PVDF membrane as needed, and be careful not to let the PVDF membrane dry during the cutting process;

[0098] c. Blocking and antibody incubation: Incubate the PVDF membrane with blocking solution (5% skim milk powder) at room temperature for 2 hours or at 4°C overnight; transfer the blocked PVDF membrane into primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000) and add them to 4 ml QuickBlock TMThe washed PVDF membrane was transferred to the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, SA00001-2) at a ratio of 1:5000 and added to 4 mL QuickBlock TM Western secondary antibody diluent (Biyuntian, P0258), i.e., secondary antibody hybridization solution), incubate at room temperature for 1 h, and wash the membrane with PBST for 3 × 5 min;

[0099] d. Color development: Mix equal volumes of Solution A and Solution B of the ECL chemiluminescence kit, shake and mix thoroughly, then drop the luminescent solution on the PVDF membrane so that the entire PVDF membrane is covered with the luminescent solution. Adjust different exposure times to make the protein bands clear and take pictures with the instrument.

[0100] The different screened mutants were compared with the parental AAV9 control. Figure 1 , 2 As shown in Figures 1 and 3, mutants 1, 2, 4, and 7 all have different degrees of improvement in their ability to target muscles. Among them, the mRNA levels of mutants 1 and 2 in the quadriceps femoris were 8.34 times and 10.35 times higher than AAV9, while mutants 4 and 7 were slightly lower, 6.52 times and 5.55 times, respectively. The protein expression levels of the quadriceps femoris were significantly improved by mutants 1, 2, and 7. The protein expression results of the biceps brachii were basically similar to those of the quadriceps femoris, and mutants 1, 2, and 7 were the most significant. Moreover, the highest mRNA levels were found in mutants 2 and 7, which were 2.73 times and 2.26 times that of the AAV9 control. The mRNA expression levels of the abdominal muscles were also significantly increased by mutants 1, 2, 4, and 7, reaching 2.64 times, 3.19 times, 2.29 times, and 3.94 times that of the AAV9 control, respectively, and the protein levels were basically the same. Based on the performance in the above three muscle tissues, it can be determined that mutants 1, 2, 4 and 7 have good targeting to muscles. We also found that although the candidate mutants all contain the RGD motif, the types of amino acids around the RGD motif and the effects on the AAV capsid protein structure make the targeting different. Therefore, for the targeting sequence with a determined motif, the optimization of the adjacent amino acids is also a necessary process.

[0101] To better evaluate the specificity of the mutants in vivo, the mutants' tropism for the liver was analyzed. Figure 4As shown, most mutants are lower than the AAV9 control group in terms of both mRNA level and protein level. For example, the mRNA levels of mutants 1, 2, 4 and 7 are 0.32 times, 0.55 times, 0.4 times and 0.51 times of the control group, respectively. This indicates that the mutants of the present invention not only have improved muscle targeting, but also reduced liver tropism. The significant improvement in specificity plays a very important role in subsequent efficacy, dose reduction, toxic side effects, etc.

[0102] The AAV capsid protein mutants 1, 2, 4, and 7 screened by the present invention have VP1 amino acid sequences as shown in SEQ ID No. 9 to SEQ ID No. 12, and nucleotide sequences as shown in SEQ ID No. 13 to SEQ ID No. 16; the amino acid sequences of the targeting peptides in VP1 are as shown in SEQ ID No. 1 to SEQ ID No. 4, and the nucleotide sequences are as shown in SEQ ID No. 5 to SEQ ID No. 8. Specifically as follows:

[0103] SEQ ID No. 1 (targeting peptide 1 amino acid sequence): QMHRGDA;

[0104] SEQ ID No. 2 (targeting peptide 2 amino acid sequence): RRGDLVG;

[0105] SEQ ID No.3 (targeting peptide 4 amino acid sequence): SVRGDAS;

[0106] SEQ ID No.4 (targeting peptide 7 amino acid sequence): DLRSRGD;

[0107] SEQ ID No.5 (targeting peptide 1 nucleic acid sequence (5'->3')): CAGATGCATAGAGGAGACGCT;

[0108] SEQ ID No.6 (targeting peptide 2 nucleic acid sequence (5'->3')): CGTAGAGGAGACTTGGTTGGG;

[0109] SEQ ID No.7 (targeting peptide 4 nucleic acid sequence (5'->3')): TCGGTGAGAGGAGACGCGTCG;

[0110] SEQ ID No.8 (targeting peptide 7 nucleic acid sequence (5'->3')): GATCTTCGTAGTAGAGGAGAC;

[0111] SEQ ID No.9 (amino acid sequence of mutant 1VP1):

[0112] MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQMHRGDAAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIKNTPVPADPPTAFNKDKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSNNVEFAVNTEGVYSEPRPIGTRYLTRNL*

[0113] SEQ ID No.10 (Amino acid sequence of mutant 2VP1):

[0114] MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQSARRGDLVGAQAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIKNTPVPADPPTAFNKDKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSNNVEFAVNTEGVYSEPRPIGTRYLTRNL*

[0115] SEQ ID No.11 (Amino acid sequence of mutant 4VP1):

[0116] MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQSSVRGDASAQAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIKNTPVPADPPTAFNKDKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSNNVEFAVNTEGVYSEPRPIGTRYLTRNL*

[0117] SEQ ID No. 12 (Amino acid sequence of mutant 7VP1):

[0118] MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQDLRSRGDAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIKNTPVPADPPTAFNKDKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSNNVEFAVNTEGVYSEPRPIGTRYLTRNL*

[0119] SEQ ID No. 13 (Mutant 1 VP1 Nucleic Acid Sequence (5’->3’)):

[0120]

[0121] SEQ ID No.14 (mutant 2VP1 nucleic acid sequence (5'->3')):

[0122]

[0123] SEQ ID No.15 (mutant 4VP1 nucleic acid sequence (5'->3')):

[0124]

[0125] SEQ ID No.16 (Mutant 7VP1 nucleic acid sequence (5’->3’)):

[0126] ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTTAGTGAAGGAATTCG

[0127] CGAGTGGTGGGCTTTGAAACCTGGAGCCCCTCAACCCAAGGCAAATCAACAACATCAAGAC

[0128] AACGCTCGAGGTCTTGTGCTTCCGGGTTACAAATACCTTGGACCCGGCAACGGACTCGACA

[0129] AGGGGGAGCCGGTCAACGCAGCAGACGCGGCGGCCCTCGAGCACGACAAGGCCTACGACC

[0130] AGCAGCTCAAGGCCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCCGAGTTCCA

[0131] GGAGCGGCTCAAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCC

[0132] AAAAAGAGGCTTCTTGAACCTCTTGGTCTGGTTGAGGAAGCGGCTAAGACGGCTCCTGGAA

[0133] AGAAGAGGCCTGTAGAGCAGTCTCCTCAGGAACCGGACTCCTCCGCGGGTATTGGCAAATC

[0134] GGGTGCACAGCCCGCTAAAAAGAGACTCAATTTCGGTCAGACTGGCGACACAGAGTCAGTC

[0135] CCAGACCCTCAACCAATCGGAGAACCTCCCGCAGCCCCCTCAGGTGTGGGATCTCTTACAA

[0136] TGGCTTCAGGTGGTGGCGCACCAGTGGCAGACAATAACGAAGGTGCCGATGGAGTGGGTA

[0137] GTTCCTCGGGAAATTGGCATTGCGATTCCCAATGGCTGGGGGACAGAGTCATCACCACCAG

[0138] CACCCGAACCTGGGCCCTGCCCACCTACAACAATCACCTCTACAAGCAAATCTCCAACAGC

[0139] ACATCTGGAGGATCTTCAAATGACAACGCCTACTTCGGCTACAGCACCCCCTGGGGGTATTT

[0140] TGACTTCAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACA

[0141] ACTGGGGATTCCGGCCTAAGCGACTCAACTTCAAGCTCTTCAACATTCAGGTCAAAGAGGT

[0142] TACGGACAACAATGGAGTCAAGACCATCGCCAATAACCTTACCAGCACGGTCCAGGTCTTC

[0143] ACGGACTCAGACTATCAGCTCCCGTACGTGCTCGGGTCGGCTCACGAGGGCTGCCTCCCGC

[0144] CGTTCCCAGCGGACGTTTTCATGATTCCTCAGTACGGGTATCTGACGCTTAATGATGGAAGC

[0145] CAGGCCGTGGGTCGTTCGTCCTTTTACTGCCTGGAATATTTCCCGTCGCAAATGCTAAGAAC

[0146] GGGTAACAACTTCCAGTTCAGCTACGAGTTTGAGAACGTACCTTTCCATAGCAGCTACGCTC

[0147] ACAGCCAAAGCCTGGACCGACTAATGAATCCACTCATCGACCAATACTTGTACTATCTCTCA

[0148] AAGACTATTAACGGTTCTGGACAGAATCAACAAACGCTAAAATTCAGTGTGGCCGGACCCA

[0149] GCAACATGGCTGTCCAGGGAAGAAACTACATACCTGGACCCAGCTACCGACAACAACGTGT

[0150] CTCAACCACTGTGACTCAAAACAACAACAGCGAATTTGCTTGGCCTGGAGCTTCTTCTTGGG

[0151] CTCTCAATGGACGTAATAGCTTGATGAATCCTGGACCTGCTATGGCCAGCCACAAAGAAGG

[0152] AGAGGACCGTTTCTTTCCTTTGTCTGGATCTTTAATTTTTGGCAAACAAGGAACTGGAAGAG

[0153] ACAACGTGGATGCGGACAAAGTCATGATAACCAACGAAGAAGAAATTAAAACTACTAACC

[0154] CGGTAGCAACGGAGTCCTATGGACAAGTGGCCACTAACCACCAGGATCTTCGTAGTAGAGG

[0155] AGACGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGAC

[0156] AGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACGGCAACTTTC

[0157] ACCCTTCTCCGCTGATGGGAGGGTTTGGAATGAAGCACCCGCCTCCTCAGATCCTCATCAAA

[0158] AACACACCTGTACCTGCGGATCCTCCAACGGGCCTTCAACAAGGACAAGCTGAACTCTTTCAT

[0159] CACCCAGTATTCTACTGGCCAAGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAAAC

[0160] AGCAAGCGCTGGAACCCGGAGATCCAGTACACTTCCAACTATTACAAGTCTAATAATGTTG

[0161] AATTTGCTGTTAATACTGAAGGTGTATATAGTGAACCCCGCCCCATTGGCACCAGATACCTGACTCGTAATCTGTAA.

[0162] Based on the above results, the present invention uses a method based on a specific motif to construct a small AAV virus library. Through a single screening process, effective AAV variants can be discovered, with high screening accuracy, and no need for multiple rounds of repeated screening and verification. Based on the strategy of designing a polypeptide combinatorial library based on the RGD motif, combined with a directional screening method, four muscle-specific AAV9 mutants were obtained. The mRNA and protein expression levels verified that it has good effects in muscle tissues such as the quadriceps, biceps, and abdominal muscles (compared with the control group AAV9, the muscle targeting is increased by up to about 10 times), and the liver tropism is low (2 to 3 times lower than the control group), and the specificity is good. Providing more useful and optional vector tools for the gene therapy of muscle diseases will benefit a large number of patients and have great clinical value and commercial application scenarios.

[0163] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. An adeno-associated virus capsid protein mutant, characterized in that: Its amino acid sequence is shown as SEQ ID No.

10.

2. A nucleic acid encoding an adeno-associated virus capsid protein mutant, characterized in that: Its nucleotide sequence is shown as SEQ ID No.

14.

3. A recombinant adeno-associated virus, characterized in that: It includes the adeno-associated virus capsid protein mutant described in claim 1.

4. The recombinant adeno-associated virus according to claim 3, characterized in that Heterologous genes of interest are also included.

5. The recombinant adeno-associated virus according to claim 4, characterized in that The heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

6. Use of the adeno-associated virus capsid protein mutant according to claim 1 or the recombinant adeno-associated virus according to any one of claims 3 to 5 in the preparation of a drug or preparation for delivering a gene product to cells or tissues of a subject, characterized in that: The cells are muscle cells; the tissues are muscle tissues.

7. Use of the adeno-associated virus capsid protein mutant according to claim 1 or the recombinant adeno-associated virus according to any one of claims 3 to 5 in the preparation of a drug delivery tool for delivering a gene product to cells or tissues of a subject, characterized in that: The cells are muscle cells; the tissues are muscle tissues.

Images