SNP marker combination related to sweet corn kernel pericarp hardness and its application

Abstract

The present invention relates to the technical field of molecular markers, and in particular to a SNP marker combination related to the hardness of sweet corn kernels and peels and an application thereof. The present invention uses sweet corn inbred lines SHL01 and SHL03 as parents to construct a RIL population (permanent population), uses a texture analyzer to collect data on traits related to the hardness of sweet corn kernels and peels, and performs QTL positioning through the trait of kernel and peel hardness, and finds that there is a major effect QTL related to the hardness of sweet corn kernels on chromosome 6 of corn, the major effect QTL is located between SNP sites S_Chr6:161990361 and S_Chr6:162070558, and the contribution rate to the phenotype of kernel and peel hardness is 13.49%. The obtained SNP marker linked to the major effect QTL (i.e., the SNP marker combination) lays a foundation for molecular marker-assisted breeding, and is of great significance for improving the taste quality of sweet corn.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to a SNP marker combination related to sweet corn kernel pericarp hardness and an application thereof. Background Art

[0002] Sweet corn is an important type of fresh corn. Sweet corn is native to the American continent. Its nutritional value is no less than that of fruits and vegetables. It is also called "fruit corn" or "vegetable corn". It can be steamed and processed after maturity or eaten fresh. The added value of sweet corn processing is high and the economic benefits are significant. It is rich in fructose, sucrose, glucose, and a variety of amino acids, proteins, cellulose, minerals and other nutrients, and is very popular among consumers. Sweet corn kernels are fresh, sweet, crisp and tender during the milky stage and can be eaten directly as fruits and vegetables. Compared with ordinary corn, sweet corn has a short growth cycle, high economic value and rich nutrition. With the improvement of people's living and consumption levels, the demand for sweet corn is also increasing, which has driven the development of sweet corn planting and related industries, and has broad market prospects. Improving the tenderness of sweet corn and improving the taste quality are one of the important directions of sweet corn quality breeding at present.

[0003] Kernel pericarp hardness is a key factor affecting the tenderness of sweet corn, and pericarp hardness is an important component of tenderness. Kernel pericarp hardness is a complex quantitative trait controlled by multiple genes. If molecular markers are developed for molecular marker-assisted breeding, they can be applied together through molecular markers related to kernel pericarp hardness traits.

[0004] Although previous studies have also located QTLs for the trait of sweet corn kernel pericarp hardness and detected some quantitative trait loci that control corn kernel pericarp hardness, due to the influence of marker density, population type, accuracy of genetic linkage maps, and different methods of detecting kernel trait phenotypes, the QTL results related to kernel pericarp hardness obtained in the studies were not the same, and most of them were non-major effect QTLs. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a SNP marker combination related to sweet corn kernel peel hardness and its application. The SNP marker combination provided by the present invention is a major effect QTL related to sweet corn kernel peel hardness, and the identification result is more accurate.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a SNP marker combination associated with sweet corn kernel pericarp hardness, wherein the SNP marker combination comprises a first SNP molecular marker and a second SNP molecular marker;

[0008] The first SNP molecular marker is that the nucleotide at position 161990361 of chromosome 6 of the corn B73 RevGen_V3 genome is A or G;

[0009] The second SNP molecular marker is that the nucleotide at position 162070558 of chromosome 6 of the corn B73 RevGen_V3 genome is T or G.

[0010] The present invention provides a primer set for identifying the genotype of the SNP marker combination described in the above technical solution.

[0011] Preferably, the primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer of the first primer pair is shown as SEQ ID NO.2; the nucleotide sequence of the upstream primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the second primer pair is shown as SEQ ID NO.4.

[0012] The present invention provides the use of the SNP marker combination described in the above technical solution or the primer set described in the above technical solution in assisted breeding of sweet corn.

[0013] Preferably, the sweet corn assisted breeding includes screening sweet corn with relatively low kernel pericarp hardness.

[0014] Preferably, the screening comprises: screening sweet corns whose first SNP molecular marker is AA genotype and whose second SNP molecular marker is TT genotype.

[0015] The present invention provides a method for screening sweet corn with relatively low kernel and pericarp hardness, comprising the following steps:

[0016] Determine the genotype of the SNP molecular marker combination of the above technical solution of sweet corn;

[0017] According to the determination results, the sweet corns with the first SNP molecular marker being the AA genotype and the second SNP molecular marker being the TT genotype are the sweet corns with relatively low kernel and pericarp hardness.

[0018] Preferably, the determination method comprises performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product.

[0019] Preferably, the primer set for PCR amplification includes the primer set described in the above technical solution.

[0020] Beneficial effects:

[0021] The present invention provides a SNP marker combination associated with sweet corn kernel peel hardness, the SNP marker combination comprising a first SNP molecular marker and a second SNP molecular marker; the first SNP molecular marker is that the nucleotide at position 161990361 of chromosome 6 of the corn B73 RevGen_V3 genome is A or G; the second SNP molecular marker is that the nucleotide at position 162070558 of chromosome 6 of the corn B73 RevGen_V3 genome is T or G. The invention uses sweet corn inbred lines SHL01 and SHL03 as parents to construct a RIL population (permanent population), uses a texture analyzer to collect data on traits related to sweet corn kernel peel hardness, performs QTL positioning through the kernel peel hardness trait, finds that a major QTL related to the sweet corn kernel peel hardness exists on corn chromosome 6, the major QTL is located between SNP sites S_Chr6:161990361 and S_Chr6:162070558, and the contribution rate to the kernel peel hardness phenotype is 13.49%. The obtained SNP markers linked to the major QTL (i.e., SNP marker combinations) lay a foundation for molecular marker-assisted breeding, and are of great significance for improving the taste quality of sweet corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0023] Figure 1 This is the location map of the SNP closely linked to the major QTL related to sweet corn kernel pericarp hardness on the corn chromosome. DETAILED DESCRIPTION

[0024] The present invention provides a SNP marker combination associated with sweet corn kernel pericarp hardness, wherein the SNP marker combination comprises a first SNP molecular marker and a second SNP molecular marker;

[0025] The first SNP molecular marker is that the nucleotide at position 161990361 of chromosome 6 of the corn B73 RevGen_V3 genome is A or G;

[0026] The second SNP molecular marker is that the nucleotide at position 162070558 of chromosome 6 of the corn B73 RevGen_V3 genome is T or G.

[0027] The present invention detects sweet corn kernel peel hardness trait data by using a texture analyzer, performs QTL positioning by using the kernel peel hardness trait, and through analysis results, finds that there is a major QTL related to the sweet corn kernel peel hardness on corn chromosome 6, the major QTL is located between SNP sites S_Chr6:161990361 and S_Chr6:162070558, and the contribution rate to the kernel peel hardness phenotype is 13.49%. The major QTL is suitable for predicting the sweet corn kernel peel hardness trait, and lays a foundation for molecular marker-assisted breeding.

[0028] The present invention provides a primer set for identifying the genotype of the SNP marker combination described in the above technical solution. In the present invention, the primer set preferably includes a first primer pair and a second primer pair;

[0029] The nucleotide sequence of the upstream primer of the first primer pair is preferably as shown in SEQ ID NO.1, specifically as follows: 5'-CATGCTCTTTGTTATGCCTT-3';

[0030] The nucleotide sequence of the downstream primer of the first primer pair is preferably as shown in SEQ ID NO. 2, specifically as follows: 5'-TTCTTCATGAAGTCCTTTGA-3';

[0031] The nucleotide sequence of the upstream primer of the second primer pair is preferably as shown in SEQ ID NO.3, specifically as follows: 5'-ATTGTTCATCTGCAGTTTGT-3';

[0032] The nucleotide sequence of the downstream primer of the second primer pair is preferably as shown in SEQ ID NO.4, specifically as follows: 5'-CATCTGCAGGATCTGTCCTG-3'.

[0033] The first primer pair of the present invention can specifically amplify a sequence containing the first SNP molecular marker (S_Chr6: 161990361). When the nucleotide of S_Chr6: 161990361 is G, the sequence amplified by the first primer pair is preferably as shown in SEQ ID NO. 5, specifically as follows: 5'-CACTCGCACCTGCATTGATGATTTCGTCGACAGCAGGAGCTTTGCCATTGTCATTATTTCTTCCATCTTTGGCGATATTAACGGCCACCACTTGATGATGGCGTGTTGATTCAGTGGCATTGCTCGTCTCGAACTTGGCAGCGAAACACCCTTTGACTTTCTTGTGGCTAGCCCGGTGGCCTCCAAGAGCCTGGTGTGAAG-3', wherein the bold 101st base G is the S_Chr6: 161990361 site;

[0034] The second primer pair can specifically amplify a sequence containing the second SNP molecular marker (S_Chr6:162070558). When the nucleotide of S_Chr6:162070558 is A, the sequence amplified by the second primer pair is preferably as shown in SEQ As shown in IDNO.6, the details are as follows: 5'-ATTGTTCATCTGCAGTTTGTATGCCCAGGAACGTGGCTATGTGACTTGACTCTTGAAAGATATGAAGTCCGGGAGAAGAAGGTTTCCAAGAAGGTAGGTGTATTGTGGCGTGTTGATATCTATCAATTTCATACTCTTGCAGGAATTCATTCAGTAAGCT TACATTTGAACTGATTTTGCAGCGCCCCAGGGGATTGAAAGCTATGCACGACATGGACAGTGACTCGGAATAAATAAAAGAAGATCACTGAACATGAGAAGCTGAATATTAGAAAGAAGGCCAGGACAGATCCTGCAGATG-3', where the bolded base T at position 201 is S_Chr6:162070558.

[0035] The present invention provides an application of the SNP marker combination described in the above technical solution or the primer set described in the above technical solution in sweet corn assisted breeding. In the present invention, the sweet corn assisted breeding preferably includes screening sweet corn with relatively low kernel and pericarp hardness; the screening preferably includes: screening sweet corn with a first SNP molecular marker of AA genotype and a second SNP molecular marker of TT genotype.

[0036] The present invention provides a method for screening sweet corn with relatively low kernel and pericarp hardness, comprising the following steps:

[0037] Determine the genotype of the SNP molecular marker combination of the above technical solution for sweet corn; based on the determination result, screen the sweet corn with the first SNP molecular marker as AA genotype and the second SNP molecular marker as TT genotype as the sweet corn with relatively low kernel and pericarp hardness.

[0038] In the present invention, the determination method preferably includes PCR amplification of the sweet corn to be tested and sequencing the obtained PCR amplification product; the primer set of the PCR amplification product preferably includes the primer set described in the above technical solution; the reaction procedure of the PCR amplification is preferably: denaturation at 95°C for 3min; denaturation at 95°C for 30s, annealing at 52°C for 30s, extension at 72°C for 30s, for a total of 35 cycles; and finally extension at 72°C for 5min.

[0039] The SNP marker combination provided by the present invention only needs to detect the SNP bases at specific sites when breeding sweet corn to predict the sweet corn kernel peel hardness trait. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. The SNP marker can also achieve high throughput. It can be used for molecular marker-assisted breeding of sweet corn kernel peel hardness traits at the sweet corn seedling stage. Sweet corn plant candidates with the first SNP molecular marker being the AA genotype and the second SNP molecular marker being the TT genotype are retained as materials with lower kernel peel hardness. If the two site conditions cannot be met, the plant will be discarded; it can also be used for molecular polymer breeding of traits.

[0040] To further illustrate the present invention, the SNP marker combination related to sweet corn kernel peel hardness and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1

[0042] 1. Construction of genetic map of sweet corn recombinant inbred line (RIL) population.

[0043] Sweet corn inbred lines SHL01 and SHL03 were used as parents to construct RIL populations, which were planted at the Zhuanghang Experimental Station of Shanghai Academy of Agricultural Sciences. After emergence, leaf tissues of the RIL population were collected to extract DNA. Genotyping by target sequencing (GBTS) technology was used to genotype 236 individuals in the F7 generation, and a total of 10,000 SNP loci were obtained. PLINK software was used for quality control filtering, and the missing rate was less than 20%, the minimum allele frequency was greater than 0.05, and the heterozygosity rate was less than 20%. The constructed genetic map had a total of 4253 high-quality SNP markers, which were divided into 10 linkage groups. The total distance of the genetic map was 3052.3cM, and the average genetic distance between SNP markers was 0.7cM.

[0044] 2. Measurement of sweet corn kernel peel hardness

[0045] Sweet corn inbred lines SHL01 and SHL03 were used as parents to construct an RIL population, and the RIL population was designed with a randomized block experiment and planted at the Zhuanghang Experimental Station of Shanghai Academy of Agricultural Sciences in 2021. Each RIL strain was planted in 2 rows, repeated three times, and managed normally in the field. On the 20th day after the sweet corn cobs were pollinated, the TA.XTPlusC texture analyzer (using a P2 / E probe with a diameter of 2 mm) from Stable MicroSystems was used to detect the hardness of the kernel peel. Three cobs were taken for each repetition, and 5 complete kernels without disease and insect pest infection in the middle of each cob were selected for puncture detection of the top of the kernel. Finally, the average value of the three repetitions was taken as the phenotypic data, and the results are shown in Table 1.

[0046] Table 1 Comparison of phenotypic variation and heritability among RIL populations

[0047] Characteristics average value Amplitude Skewness Kurtosis Coefficient of variation (%) Peel hardness 0.69±0.12 0.45-0.99 0.12 0.46 16.67

[0048] 3. Obtain the main QTL for sweet corn kernel pericarp hardness

[0049] The QTL IciMapping 4.2 software and the composite interval mapping method (CIM) were used to perform QTL analysis on the average value of seed skin hardness in the RIL population. A randomness test was performed 1000 times at a significance level of P < 0.05 to determine the logarithm of the odds (LOD) of the likelihood function ratio. The 2-LOD interval method was used to determine the confidence interval (QTL interval) of the QTL. The format for naming QTL is: the prefix is ​​"q" + the English abbreviation of the trait + the chromosome number where the QTL is located + the serial number of the QTL on the same chromosome, and the number is connected to the chromosome number with "-". QTL analysis of seed skin hardness (FSH) was performed, such as Figure 1 As shown in the figure, a total of 4 QTLs were detected, distributed on chromosomes 1, 3, 4, and 6, with LOD values ​​of 2.70 and 5.70, respectively. The contribution of a single QTL to phenotypic variation ranged from 6.15% to 13.49%. A single QTL with a contribution of ≥10% to phenotypic variation was considered a major effect QTL. Among them, qFSH6, located on chromosome 6, had a contribution of 13.49% and was a major effect QTL.

[0050] Table 2 QTL results for seed and fruit skin hardness traits

[0051]

[0052] 4. Development and application of SNP markers tightly linked to sweet corn kernel pericarp hardness traits

[0053] qGLU2 is a major QTL regulating kernel pericarp hardness located on chromosome 6 of maize, between SNP sites S_Chr6:161990361 and S_Chr6:162070558. The physical position of SNP site S_Chr6:_161990361 in the B73RevGen_V3 genome sequence is G, and the variation is A / G. The physical position of SNP site S_chr:2_162070558 in the B73RevGen_V3 genome sequence is T, and the variation is T / G. These two SNP sites can be used to predict the kernel pericarp hardness of sweet corn. A primer set for screening sweet corn with relatively low kernel pericarp hardness is designed based on two SNP sites, the primer set consisting of a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer of the first primer pair is shown as SEQ ID NO.2; the nucleotide sequence of the upstream primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the second primer pair is shown as SEQ ID NO.4; the screening method is as follows:

[0054] DNA was extracted from corn plant leaves by conventional methods, and PCR amplification was performed using the following primers. The amplification system for PCR amplification was: 2×PCRmix 25μL, ddH2O 22μL, 1μL of upstream and downstream primers, and 1μL of DNA template. The PCR reaction conditions were: 95℃ denaturation for 3min; 95℃ denaturation for 30s, 52℃ annealing for 30s, 72℃ extension for 30s, and a total of 35 cycles; finally 72℃ extension for 5min; the PCR product amplification product was obtained for sequencing. When the SNP site S_Chr6:161990361 base was A and the S_Chr6:162070558 base was T, the plant candidate was retained as a material with lower hardness of the kernel pericarp. If the conditions of these two sites were not met, the plant would be discarded.

[0055] PCR amplification and sequencing were performed on the tested corn materials in the sweet corn population of 104 Shanghai Academy of Agricultural Sciences Corn Center. The results are shown in Table 3.

[0056] When the bases of SNP sites S_Chr6:161990361 and S_Chr6:162070558 were both T, the hardness values ​​of the sweet corn kernels were 4.57-9.43, with an average of 5.98, indicating that the hardness of the kernels was low. When the bases of SNP sites S_chr:2_161990361 were G and S_chr:2_162070558 were A, the hardness values ​​of the sweet corn kernels were 1.65-4.50, with an average of 3.29, indicating that the hardness of the kernels was low. The average values ​​of the two groups of phenotypes showed significant differences.

[0057] Table 3 Corresponding results of SNP genotypes and kernel and pericarp hardness phenotypes of sweet corn materials tested

[0058]

[0059]

[0060] The above-mentioned major effect QTL closely linked SNP markers related to the pericarp hardness of sweet corn can be used to assist in the selection of sweet corn with low pericarp hardness, wherein the SNP sites S_Chr6:161990361 and S_Chr6:162070558 can select the pericarp hardness trait of sweet corn kernels. Molecular marker-assisted selection is performed by using the SNP markers disclosed by the present invention, and only the SNP bases at specific sites of the PCR amplification product need to be detected to predict the pericarp hardness trait of sweet corn kernels.

[0061] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of a SNP marker combination associated with sweet corn kernel pericarp hardness or a primer set for identifying a SNP marker combination associated with sweet corn kernel pericarp hardness in sweet corn assisted breeding; The SNP marker combination includes a first SNP molecular marker and a second SNP molecular marker; The first SNP molecular marker is that the nucleotide at position 161990361 of chromosome 6 of the corn B73 RevGen_V3 genome is A or G; The second SNP molecular marker is that the nucleotide at position 162070558 of chromosome 6 of the corn B73 RevGen_V3 genome is T or G; The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer of the first primer pair is shown as SEQ ID NO.2; the nucleotide sequence of the upstream primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the second primer pair is shown as SEQ ID NO.

4.

2. The use according to claim 1, characterized in that: The sweet corn assisted breeding includes selecting sweet corns with relatively low kernel and pericarp hardness.

3. The use according to claim 2, characterized in that: The screening comprises: screening sweet corns whose first SNP molecular marker is AA genotype and whose second SNP molecular marker is TT genotype.

4. A method for screening sweet corn with relatively low kernel and pericarp hardness, characterized in that: The following steps are involved: The genotypes of the SNP marker combination associated with kernel pericarp hardness in sweet corn were determined; The SNP marker combination includes a first SNP molecular marker and a second SNP molecular marker; The first SNP molecular marker is that the nucleotide at position 161990361 of chromosome 6 of the corn B73 RevGen_V3 genome is A or G; The second SNP molecular marker is that the nucleotide at position 162070558 of chromosome 6 of the corn B73 RevGen_V3 genome is T or G; According to the results of the determination, the sweet corns with the first SNP molecular marker being the AA genotype and the second SNP molecular marker being the TT genotype are screened as sweet corns with relatively low kernel and pericarp hardness.

5. The method according to claim 4, characterized in that The determination method comprises performing PCR amplification on the sweet corn to be detected, and sequencing the obtained PCR amplification products.

6. The method according to claim 5, characterized in that The primer set for PCR amplification includes a primer set for identifying a SNP marker combination associated with sweet corn kernel pericarp hardness; The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer of the first primer pair is shown as SEQ ID NO.2; the nucleotide sequence of the upstream primer of the second primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the second primer pair is shown as SEQ ID NO.4.

Images