A CAPS marker for the length gene of thin-skinned melon and its application

Abstract

The invention discloses a CAPS marker for a length gene of a thin-skinned melon and an application thereof. The CAPS marker uses primer pairs CmFul‑AluI‑F and CmFul‑AluI‑R to amplify the CAPS marker, and the amplified fragment is digested with AluI. Short-fruited thin-skinned melons produce a band with a length of 351 bp; long-fruited thin-skinned melons produce two bands with lengths of 193 bp and 158 bp.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a CAPS marker for a length gene of a thin-skinned melon and an application thereof. Background Art

[0002] Fruit quality and diversity are important current and future breeding priorities. Fruit size and shape are not only important appearance traits but also key indicators of diversity. Fruit length is a key indicator of fruit size and shape (Wang et al., 2019). However, research on the genetic basis and molecular mechanisms of fruit length formation remains relatively scarce. Therefore, understanding the molecular and regulatory mechanisms of fruit length formation can further deepen our knowledge and understanding of the formation of fruit size and diversity. Compared to other fruits, melon has a greater diversity of fruit, making it an ideal crop for studying fruit size and diversity (Eiroshi et al., 2008; Latrasse et al., 2017).

[0003] Numerous studies have investigated the genetics of melon fruit size (length, width, and shape), suggesting that it is a complex quantitative trait controlled by multiple genes. Although numerous QTLs for fruit length, width, and shape have been reported, precise gene mapping and molecular marker development are rare. Furthermore, the independent domestication of thick-skinned and thin-skinned subspecies of melon, with distinct domestication mechanisms, suggests that their trait formation may be controlled by distinct genes. Previous QTL mapping has mostly been based on populations constructed from thick-skinned or combined thick-skinned and thin-skinned melons. However, research on thin-skinned melon, a melon species unique to my country and even Southeast Asia, is scarce. Therefore, identifying genes regulating fruit length in thin-skinned melon and developing molecular markers for these traits is crucial for furthering our understanding of fruit diversity and rapidly creating diverse germplasm resources. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a CAPS marker for the length gene of thin-skinned melon and its application.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A CAPS marker for a length gene in thin-skinned melons, wherein the CAPS marker is amplified using primer pairs CmFul-AluI-F and CmFul-AluI-R, and the amplified fragment is digested with AluI. Short-fruited thin-skinned melons produce a band of 351 bp in length; long-fruited thin-skinned melons produce two bands of 193 bp and 158 bp in length.

[0007] CmFul-AluI-F: CATATTTAACTTTCATCGATTGCTAGG

[0008] CmFul-AluI-R:GTAGCTCCTTGACTACTAAGTAACT.

[0009] Preferably, in the above-mentioned CAPS marker, the reaction procedure for amplifying the CAPS marker is: 94°C, 5 min; 95°C, 10 s, 60°C, 10 s, 72°C, 10 s, 45 cycles; 95°C, 5 s, 65°C, 1 min, 40°C, 30 s.

[0010] Preferably, in the above-mentioned CAPS marker, the reaction system for amplifying the CAPS marker is composed of the following components in 25ul: 0.5ml of 10Mmol / L forward primer, 0.5ml of 10Mmol / L reverse primer, 100ng of template DNA, and 12.5ul of KodOne high-fidelity enzyme.

[0011] Preferably, in the above-mentioned CAPS labeling, the enzyme digestion reaction system, calculated as 15ul, comprises: 4ul of PCR product, 1.5uL of 10x buffer, 0.5uL of restriction endonuclease, and the digestion is carried out at 37°C for 1h.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] Fruit shape is not only an important appearance trait but also directly correlates with yield. Currently, traditional breeding is the predominant method in melon breeding, requiring selection of material after fruit set, which is time-consuming and inefficient. This study identified a gene associated with melon fruit length and found that allelic variation in this gene is significantly correlated with melon fruit length. The development of molecular markers based on this finding is of great significance for marker-assisted selection of melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the GWAS analysis diagram of fruit length, fruit shape, and ovary shape;

[0015] Figure 2 This is an analysis diagram of the evolutionary relationship of CmFUL homologous genes;

[0016] Figure 3 This is a graph analyzing the gene expression of CmFUL in different tissues of melon;

[0017] Figure 4 The expression level of CmFUL gene in melon fruits of different lengths (a) and the difference in fruit length (b);

[0018] Figure 5The correlation diagram between CmFUL allelic variation and fruit length; Note: M5, M95, and M110 are short-fruited germplasms, and M46, M953, and M982 are long-fruited germplasms;

[0019] Figure 6 This is the CAPS primer design diagram, where the green bold letters A and G represent SNP sites;

[0020] Figure 7 This is the electrophoresis diagram of typical melon germplasm for CAPS molecular markers. DETAILED DESCRIPTION

[0021] Example 1:

[0022] 1. Materials: 1,175 melon germplasm accessions from around the world, housed at the Zhengzhou Fruit Research Institute of the Chinese Academy of Agricultural Sciences, were planted in Zhengzhou, Henan Province, in the spring of 2015. Five plants were planted from each accession. Young leaves were collected at the five-leaf, one-heart stage, quickly frozen in liquid nitrogen, and stored in an ultra-low-temperature freezer for future use in whole-genome resequencing. Five representative melon accessions of varying fruit length, MS-146, MS-78, MS-101, MS-965, and MS-979, were selected. Fruit samples were taken 15 days after pollination and quickly frozen in liquid nitrogen and stored in an ultra-low-temperature freezer for gene expression analysis. Melon accession 962 was planted in the field, and roots, stems, leaves, flowers, and fruits at different developmental stages were collected for candidate gene expression analysis. All accessions were planted on a single vine, with a single fruit, under normal management.

[0023] In accordance with the "Melon Germplasm Resource Description Specifications and Data Standards", the ovary shape was investigated during the flowering period, and the fruit length and shape were phenotypically investigated during the fruit ripening period, and the data were recorded.

[0024] 2. Genome-wide Association Analysis

[0025] Whole-genome sequencing was performed on young leaves collected at the five-leaf, one-heart stage, with an average sequencing depth of 5×. Sequencing data for each sample were first filtered for genotypes (missing data <= 40%, MAF >= 0.05), and then all phenotypic files were digitized. Genome-wide association analysis between genotypes and phenotypes was performed using EMMAX software under a mixed linear model, with population structure as the covariate. After the association analysis, a permutation test was used to determine the threshold. Signal peaks above the threshold were identified as candidate regions. Finally, candidate genes were further screened using LD decay and gene functional annotation information.

[0026] 3. Gene Expression Analysis

[0027] To clarify the expression pattern of the candidate gene, the candidate gene (MEO3C002050) was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / sra / ?term=) transcriptome database in melon roots, stems, leaves, flowers, and fruit samples at 0, 15, 20, and 30 days after pollination for analysis of the candidate gene expression pattern.

[0028] For qRT-PCR analysis, 2 –ΔCT The relative expression of the target gene was calculated using the PCR amplification method, repeated three times. For PCR amplification, the reaction system in a 20 μl reaction mixture included 2 μl of cDNA, 10 μl of Mix, 6 μl of ddH2O, and 1 μl of each forward and reverse primer. The PCR amplification program was as follows: 94°C for 5 min; 45 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 10 s; 95°C for 5 s, 65°C for 1 min, and 40°C for 30 s.

[0029] Target gene primer sequence:

[0030] F-AGCAGCAGCAGCAGGATAGT;

[0031] R-AGGGTATCGGATCTGTCGTG.

[0032] Actin primer sequence:

[0033] F:CCTGGTATCGCTGACCGTAT;

[0034] R: TACTGAGCGATGCAAGGATG.

[0035] 4. Sequence amplification and enzyme digestion reaction

[0036] The PCR amplification reaction system was 25ul, consisting of the following components: forward primer (10Mmol / L) 0.5mL, reverse primer (10Mmol / L) 0.5mL, template DNA 100ng, Kod One high-fidelity enzyme 12.5ul.

[0037] The PCR amplification product was digested with the restriction endonuclease AluI to obtain the digestion product. The digestion system consisted of 15 μL of the following: 4 μL of PCR product, 1.5 μL of 10x buffer, and 0.5 μL of the restriction endonuclease. The digestion was carried out at 37°C for 1 hour. The digestion products were separated by electrophoresis on a 2.5% agarose gel using 1xTBE buffer. After electrophoresis at a constant voltage of 5 V / cm for 40 minutes, the gel was stained with GoldView nucleic acid stain and photographed on a UV gel imaging system. All restriction endonucleases, DNA polymerase, and other reagents used in the experiment were purchased from New England Biolabs.

[0038] Example 2. Results and Analysis of Example 1

[0039] 1. Genome-wide association analysis

[0040] The MADS-box gene family is an important class of transcriptional regulators that play a crucial role in plant growth, development, and signal transduction (Smaczniak et al., 2012). In recent years, the functions of an increasing number of MADS-box genes have been revealed, particularly in model plants such as Arabidopsis and tomato. They have been found not only to be crucial regulators of floral organ formation but also to be involved in the morphogenesis of other organs, such as fruit. In the Cucurbitaceae plant cucumber, the MADS-box gene CsFUL1 has also been shown to regulate fruit length and act as a key transcription factor that inhibits fruit elongation (Zhao et al., 2019). A total of 62 MADS-box genes have been identified in the melon genome, including two FRUITFULL-like genes (MELO3C011409 and MELO3C002050). Both are specifically expressed in flowers and fruits, with MELO3C002050 showing significantly higher expression levels than MELO3C011409 during fruit growth (Hao et al., 2016).

[0041] The three traits of fruit length, fruit shape and ovary shape are significantly associated. We conducted phenotypic evaluation of fruit length, fruit shape and ovary shape of 1175 melon germplasm materials and resequenced them. When performing genome-wide association (GWAS) analysis on fruit length, fruit shape and ovary shape traits, a significant association signal was identified at the same position on chromosome 12 of the genome, and it overlapped with the single fruit weight and fruit shape QTLs sites reported by previously. Within the chromosomal interval (25.38-25.84Mb) where the three association signals overlapped, there was a FRUITFULL-like MADS-box family gene MELO3C002050 (tentatively named CmFUL). This gene contains 9 exons, among which the AG single nucleotide variation was found in exon 7, resulting in a change of valine-alanine (Val-Ala) ( Figure 1 ).

[0042] 2. Homologous comparison analysis

[0043] The homologous genes of MELO3C002050 gene in cucumber, Arabidopsis, tobacco, tomato and other crops were downloaded from NCBI database, and the phylogenetic tree was constructed using MEGA6.0 ( Figure 2) and found that MELO3C002050 shared 92.47% sequence similarity with Csa1P039910 in cucumber. Csa1P039910 (CsFUL1) has been shown to regulate cucumber fruit length (Zhao et al., 2019). Therefore, we speculated that MELO3C002050 may be a candidate gene for melon fruit length.

[0044] 3. Analysis of candidate gene expression

[0045] To explore the gene expression pattern of CmFUL (MELO3C002050), we analyzed transcriptome data from previous studies and our team and found that the gene is expressed at very low levels in melon roots, stems, and leaves, and is mainly expressed in female flowers and fruits. The expression level is significantly higher in the late stages of fruit development (0-15 days after pollination). Figure 3 ), which is consistent with the fruit cell differentiation stage. These results indicate that the expression level of CmFUL in melon fruit is significantly higher than that in other tissues, and is mainly expressed in the early stages of fruit development.

[0046] To further understand the relationship between the two alleles of CmFUL and fruit length, we combined the previous resequencing data and phenotypic data for analysis and found that CmFUL1 G It is mainly found in the Conomon germplasm of the thin-skinned melon subspecies with longer fruits. At the same time, we analyzed the relative expression levels of the CmFUL gene in the fruits of five typical germplasms of different lengths, MS-146 (10 cm), MS-78 (12 cm), MS-101 (13 cm), MS-965 (23 cm), and MS-979 (46 cm) 15 days after pollination and found that the expression level of the CmFUL gene was correlated with the fruit length, showing a negative correlation ( Figure 4 ).

[0047] 4. CAPS Marker Development and Validation

[0048] To verify the association between the allelic variation of the candidate gene CmFUL and fruit length, the short-fruited accessions M5, M95, M110 and the long-fruited accessions M46, M953, and M982 of thin-skinned melon were selected to clone the full-length sequence of the CmFUL gene. Sequence comparison revealed that the nucleotide sequences of the gene at exon 7, position 25,235,043, differed between the short-fruited accessions and the long-fruited accessions. The sites were A and G in the three short-fruited accessions and the three long-fruited accessions, respectively, preliminarily confirming the association between the allelic variation and the fruit length of thin-skinned melon.

[0049] Design a primer pair containing the SNP site:

[0050] CmFul-AluI-F: CATATTTAACTTTCATCGATTGCTAGG

[0051] CmFul-AluI-R:GTAGCTCCTTGACTACTAAGTAACT

[0052] The length of the amplified fragment is 351 bp. Figure 6 As shown, Figure 6 This is the CAPS primer design diagram. The green bold letters A and G represent SNP sites.

[0053] SnapGene analysis software revealed that the amplified sequence of the long-fruited melon material had a restriction endonuclease AluI recognition and action site A G / CT, while the amplified sequence of the short-fruited melon material lacked this restriction endonuclease cleavage site. Therefore, digestion with the restriction endonuclease AluI identified a codominant CAPS marker that successfully distinguished the genotypes of long- and short-fruited material. After digestion with AluI, the amplified product showed polymorphism in the long and short-fruited material. The short-fruited material lacked the restriction endonuclease cleavage site and remained a single 351-bp band; the long-fruited material produced two bands, 193 and 158 bp in length.

[0054] Thirteen short-fruited (5, 23, 29, 33, 52, 71, 77, 85, 90, 94, 110, 113, 117) and 11 long-fruited (46, 953, 961, 963, 970, 973, 975, 977, 982, 987, 988) typical melon germplasms were selected for validation of CAPS molecular markers. Figure 7 As shown in Table 1, all the short-fruited materials had only one 351bp band, while 8 of the 11 long-fruited materials had two bands and 3 had only one band. Overall, 21 of the 24 verified materials had phenotypes that were consistent with their genotypes, and 1 did not (973). The marker accuracy was 95.8%, as shown in Table 1.

[0055] Table 1

[0056]

[0057]

Claims

1. A CAPS marker for the length gene of thin-skinned melon, characterized in that: The CAPS marker was amplified using primers CmFul-AluI-F and CmFul-AluI-R, and the amplified fragment was digested with AluI. Short-fruited thin-skinned melons produced a band of 351 bp in length; long-fruited thin-skinned melons produced two bands of 193 bp and 158 bp in length. CmFul-AluI-F: CATATTTAACTTTCATCGATTGCTAGG CmFul-AluI-R:GTAGCTCCTTGACTACTAAGTAACT.

2. Use of a reagent for detecting the CAPS marker of the muskmelon length gene according to claim 1 in molecular breeding for muskmelon length traits.

Images