Artificial antigen presenting cell and its preparation method and application

Abstract

The present invention relates to the field of biomedicine technology, and discloses a method for preparing artificial antigen presenting cells, characterized in that the method comprises: (1) constructing K562 cells expressing HLA; (2) loading RNA onto the K562 cells expressing HLA; (3) fixing the RNA-loaded K562 cells using a fixative. The method for preparing artificial antigen presenting cells provided by the present invention can effectively amplify antigen-specific T cells in peripheral blood mononuclear cells, and the ability to amplify specific T cells is superior to that of K562 cells loaded with polypeptides and natural DC cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to artificial antigen presenting cells and a preparation method and application thereof. Background Art

[0002] Autologous antigen presenting cells (APCs) such as dendritic cells (DCs), monocytes and activated B cells were initially used to expand tumor-specific T cells in vitro. In the process of presenting tumor antigens to T cells for recognition, the signal stimulation obtained by T cells will affect their programming and therapeutic effects, thereby regulating the differentiation of T cells into the most suitable phenotype. It is very difficult to isolate homologous APCs from the blood of tumor patients. The number of DCs is scarce, accounting for less than 1% of peripheral blood mononuclear cells (PBMCs). The number of mature DCs obtained by in vitro culture is also small and difficult to expand. The number of induced specific T cells is difficult to meet the requirements of clinical treatment and detection. In order to overcome the above disadvantages, artificial antigen presenting cell (artificial APC, aAPC) systems based on human cell lines have been developed and widely used for the expansion of tumor-specific T cells in immunotherapy.

[0003] Artificial antigen presenting cells (aAPCs) can effectively activate and amplify antigen-specific T cells with high efficiency and good feasibility. Different types of aAPCs can express different molecules, produce corresponding signal stimulation, promote the required T cells to migrate and exert effector functions, and help programmed cells to establish lasting T cell memory. One aAPC can also express multiple antibodies and antigens at the same time, which is easy to manipulate and meet experimental needs. In short, the application of aAPCs effectively improves the clinical efficacy of tumor-specific T cell therapy.

[0004] K562 cells are human leukemia cell lines derived from patients with chronic myeloid leukemia in the blast crisis. Although there have been reports of using K562 cells to construct aAPCs, K562 cells have a certain inhibitory effect on the proliferation of T cells and the efficiency of antigen presentation still needs to be further improved. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems existing in the prior art and provide a method for preparing artificial antigen presenting cells.

[0006] In order to achieve the above object, the present invention provides a method for preparing an artificial antigen presenting cell in a first aspect, the method comprising:

[0007] (1) Construction of K562 cells expressing HLA;

[0008] (2) loading HLA-expressing K562 cells with RNA;

[0009] (3) Use a fixative to fix RNA-loaded K562 cells.

[0010] The second aspect of the present invention provides an artificial antigen presenting cell prepared by the method described in the first aspect of the present invention.

[0011] The third aspect of the present invention provides a method for preparing T cells, the method comprising: co-culturing peripheral blood mononuclear cells with artificial antigen presenting cells;

[0012] Wherein, the peripheral blood mononuclear cells are from a donor subject, and the artificial antigen-presenting cells are artificial antigen-presenting cells prepared by the method described in the first aspect of the present invention.

[0013] The fourth aspect of the present invention provides a pharmaceutical composition, which comprises artificial antigen-presenting cells prepared by the method described in the first aspect of the present invention.

[0014] The fifth aspect of the present invention provides an application of the method for preparing artificial antigen presenting cells according to the first aspect of the present invention in preparing a drug for T cell immunotherapy.

[0015] A sixth aspect of the present invention provides use of the method for preparing artificial antigen presenting cells according to the present invention in preparing a preparation and / or device for detecting T cells.

[0016] Through the above technical solution, the present invention has at least the following beneficial effects:

[0017] (1) The preparation method of artificial antigen-presenting cells provided by the present invention can effectively amplify antigen-specific T cells in peripheral blood mononuclear cells. The ability to amplify specific T cells is better than that of K562 cells loaded with polypeptides and natural DC cells, which is conducive to further promoting the promotion of tumor-specific T cell therapy.

[0018] (2) The method provided by the present invention is simple and easy to implement, eliminating the high requirements for equipment and sites for irradiation. While inactivating the cells, it retains the function of artificial antigen-presenting cells to the greatest extent, and eliminates the complex process of isolating and inducing DC cells. Compared with culturing antigen-presenting cells through natural DCs, it can reduce the amount of blood drawn from patients. When used for T cell detection, it can improve the detection sensitivity of antigen-specific T cells and is more practical. In some preferred embodiments, the method of the present invention does not introduce co-stimulatory molecules, which simplifies the preparation method and saves time and cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is the process of constructing a single HLA K562 cell line. Figure 1 A is the map of HLA-A0201 lentiviral expression plasmid; Figure 1 B is the detection of HLA expression levels in overexpression cell lines, including three HLA subtypes: HLA-A0201, HLA-A1101 and HLA-A2402.

[0020] Figure 2 K562-A02 cells electroporated with CMV mRNA and fixed with paraformaldehyde can stimulate the proliferation of specific T cells. Figure 2 A and Figure 2 B is the result of specific T cell expansion ratio detection. Figure 2 C shows the proliferation curve of total T cells during culture.

[0021] Figure 3 It is the expansion of antigen-specific T cells after the addition of co-stimulatory molecules. Figure 3 A and 3B are the results of specific T cell expansion ratio detection. Figure 3 C shows the proliferation curve of total T cells during culture.

[0022] Figure 4 It is the effect of aAPC and autologous DC on the expansion of specific T cells.

[0023] Figure 5 It is the antigen presentation effect of aAPC of different HLA subtypes. DETAILED DESCRIPTION

[0024] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0025] In the present invention, HLA-A1101 is equivalent to HLA-A*11:01, HLA-A0201 is equivalent to HLA-A*02:01, and HLA-A2402 is equivalent to HLA-A*24:02.

[0026] The first aspect of the present invention provides a method for preparing an artificial antigen presenting cell, the method comprising:

[0027] (1) Construction of K562 cells expressing HLA;

[0028] (2) loading HLA-expressing K562 cells with RNA;

[0029] (3) Use a fixative to fix RNA-loaded K562 cells.

[0030] K562 cells (human chronic myeloid leukemia cells) are isolated from the bone marrow of a patient with chronic myeloid leukemia. The original cells of K562 are malignant tumor cells of the hematopoietic system with multidirectional differentiation potential, which can spontaneously differentiate into identifiable progenitor cells of the erythroid, granulocyte and monocytic lines, etc. The cells are common mature cell lines in the field and can be obtained commercially, for example, from the American Type Culture Collection (ATCC), the Chinese Academy of Sciences Cell Bank and the National Laboratory Cell Resource Sharing Platform.

[0031] In the present invention, preferably, the method of constructing the K562 cell expressing HLA in step (1) is: integrating the HLA expression gene into the genome of the K562 cell. The integration method is not particularly limited, and can be a gene integration method commonly used in the art, which can enable the HLA gene to be stably inherited and expressed in the K562 cell, for example, by using a transposon, a viral vector, a recombinase or a gene editing technology to integrate the target sequence into the host genome; it can also be optimized by conventional technical means in the art according to actual needs.

[0032] In the present invention, the type of HLA expression gene can be any type, for example, all types recorded in the HLA database https: / / hla.alleles.org / nomenclature / index.html, such as: HLA-I class genes, including HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, wherein HLA-A includes A*01:01, A*01:02, A*01:03, A*01:06, A*01:07, A*01:08, A*01:09, A*01:100, A*01:111, A*01:12, A*01:13, A*01:14, A*01:15, A*01:16, A*01:17, A*01:18, A*01:19, A*01:20, A*01:21, A*01:22, A*01:23, A*01:24, A*01:25 09, A*01:10, A*01:12, A*01:13, etc. HLA-B includes B*07:02, B*07:03, B*07:04, B*07:05, B*07:06, B*07:07, B*07:08, B*07:09, B*07:10, B*07:11, etc. HLA-II genes include HLA-DRA, HLA-DRB1, HLA-DRB2-9, HLA-DQA1, HLA-DQB1, HLA-DPA1, HLA-DPB1, and each category also includes multiple types. In the examples, HLA-A*02:01, HLA-A*11:01 and HLA-A*24:02 are used as examples to illustrate the advantages of the present invention, but the scope of the present invention is not limited thereby. The method described in the present invention can integrate different HLA expression genes into K562 cells as needed.

[0033] Preferably, in order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, the HLA expression gene is an HLA-I class gene, more preferably HLA-A, and further preferably at least one of HLA-A*02:01, HLA-A*11:01, HLA-A*24:02, HLA-A*01:01, HLA-A*01:02, HLA-A*01:03, HLA-A*01:06, HLA-A*01:07, HLA-A*01:08, HLA-A*01:09, HLA-A*01:10, HLA-A*01:12 and HLA-A*01:1.

[0034] In the present invention, the method and conditions for constructing K562 cells expressing HLA can be selected conventionally in the art, and those skilled in the art can adjust the method and conditions for constructing K562 cells expressing HLA according to actual conditions. For example, a vector containing an HLA expression gene can be transfected into K562 cells to obtain transfected target cells, and the transfected target cells can be subjected to monoclonal screening to obtain monoclones, and the monoclones can be subjected to PCR identification to obtain positive clones, and finally the positive clones can be expanded and cultured to obtain K562 cells expressing HLA, wherein the construction, transfection, monoclonal screening and expansion culture of the vector are conventional technical means in the art, and those skilled in the art can adjust them according to actual conditions.

[0035] In the present invention, preferably, the method of loading RNA in step (2) is transfection, and the method and conditions of transfection can be conventionally selected in the art. Those skilled in the art can adjust the method and conditions of cell transfection according to actual conditions. In order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, the transfection method is electroporation.

[0036] In the present invention, preferably, in order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, every 2×10 6 The amount of RNA used is 5-20 μg per cell, for example, it can be 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 11 μg, 12 μg, 13 μg, 14 μg, 16 μg, 16 μg, 17 μg, 18 μg, 19 μg, 20 μg, and any value in the range composed of any two of the above values, and more preferably 12-20 μg.

[0037] In the present invention, preferably, in order to further improve the ability of artificial antigen-presenting cells to expand antigen-specific T cells, the RNA is antigen mRNA, which can be any mRNA of an antigen (polypeptide) that can promote the desired T cell migration and exert effector function, as well as optimized mRNA (such as mRNA optimized to enhance protein expression levels), such as mRNA of a tumor antigen, more preferably human cytomegalovirus mRNA, and further preferably an RNA with a base sequence as shown in SEQ ID NO:4.

[0038] K562 cells that have not been inactivated will have a certain inhibitory effect on the proliferation of T cells. In order to inactivate K562 cells by irradiation, irradiation is commonly used, but this method has high requirements on equipment and environment. The inventors of the present invention unexpectedly discovered in their research that after fixing the K562 cells loaded with RNA, not only can the cells be inactivated so that they will not inhibit the proliferation of T cells, but they can also promote the proliferation of T cells.

[0039] In order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, in the present invention, preferably, a fixative is used to fix the RNA-loaded K562 cells, and the fixative is a paraformaldehyde solution and / or a formaldehyde solution.

[0040] In order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, in the present invention, preferably, the concentration of paraformaldehyde in the paraformaldehyde solution is 0.5 wt %-3 wt %, more preferably 0.5 wt %-1.5 wt %.

[0041] In order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, in the present invention, preferably, the concentration of formaldehyde in the formaldehyde solution is 0.1 wt %-2 wt %, more preferably 0.8-1.2 wt %.

[0042] In the present invention, the paraformaldehyde solution and the formaldehyde solution can be purchased from suppliers known in the art and formulated as needed, including but not limited to Solarbio (e.g., 4 wt % paraformaldehyde solution, product number P1110), Sigma-Aldrich (e.g., formaldehyde solution, product number F8775-25ML).

[0043] In the present invention, the amount of the fixing agent can be adjusted according to actual needs. In order to further improve the ability of artificial antigen presenting cells to amplify antigen-specific T cells, preferably, per 1×10 6For K562 cells loaded with RNA, the amount of the fixative is 0.5-1.5 mL, for example, 0.5 mL, 0.6 mL, 0.7 mL, 0.8 mL, 0.9 mL, 1 mL, 1.1 mL, 1.2 mL, 1.3 mL, 1.4 mL, 1.5 mL, and any value in the range composed of any two of the above values, more preferably 0.8-1.2 mL.

[0044] In the present invention, in order to further improve the ability of artificial antigen presenting cells to expand antigen-specific T cells, preferably, the fixed conditions include: temperature of 15-30°C, more preferably 22-28°C; time of 5-15 min, more preferably 8-12 min.

[0045] In the present invention, the costimulatory signal mediated by the co-stimulatory factor can lead to the activation, proliferation, differentiation and up-regulation of cytokine production of T cells. K562 cells themselves do not express the costimulatory molecules 4-1BBL and OX40L. In order to promote the expansion of specific T cells, costimulatory molecules are usually introduced into K562 cells. In the present invention, the artificial antigen-presenting cells can be introduced into costimulatory molecules. However, the inventors of the present invention have found in their research that, unlike conventional means in the art, the artificial antigen-presenting cells prepared by the above method do not introduce costimulatory molecules, which does not affect the ability to amplify antigen-specific T cells. In the present invention, preferably, the artificial antigen-presenting cells do not introduce costimulatory molecules, and more preferably, the artificial antigen-presenting cells do not introduce 4-1BBL and / or OX40L.

[0046] The second aspect of the present invention provides an artificial antigen presenting cell prepared by the method described in the first aspect of the present invention.

[0047] A third aspect of the present invention provides a method for preparing T cells, the method comprising: co-culturing peripheral blood mononuclear cells with artificial antigen presenting cells;

[0048] Wherein, the peripheral blood mononuclear cells are from a donor subject, and the artificial antigen-presenting cells are artificial antigen-presenting cells prepared by the method described in the first aspect of the present invention.

[0049] In the present invention, the donor subject can be a cancer patient (ie, an autologous donor) who is to be treated with the cell population generated by the method described in the present invention, or an individual who donates a peripheral blood mononuclear cell sample.

[0050] In the present invention, the peripheral blood mononuclear cells can be obtained by any suitable in vitro method, venipuncture or other blood collection method for obtaining a blood sample.

[0051] In the present invention, the peripheral blood mononuclear cells may be enriched peripheral blood mononuclear cells, and the enrichment method is a method conventionally used in the art without special limitation, for example, it may be a gradient density centrifugation method.

[0052] In the present invention, the number ratio of the artificial antigen presenting cells to the peripheral blood mononuclear cells can be adjusted as needed. In order to further improve the effect of preparing T cells, preferably, the number ratio of the artificial antigen presenting cells to the peripheral blood mononuclear cells is 1:(0.5-2), for example, it can be 1:0.5, 1:0.6, 1:0.7, 1:0.8, 1:0.9, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, and any range composed of any of the above numerical values ​​and any value in the range, more preferably 1:(0.8-1.2).

[0053] In the present invention, preferably, the co-culture time is not particularly limited and can be determined according to the required number of T cells. In order to further improve the effect of preparing T cells, the co-culture time is preferably 7-14 days.

[0054] In the present invention, the co-culture temperature is not particularly limited and can be selected conventionally in the art. In order to further improve the effect of preparing T cells, the co-culture temperature is preferably 20-35°C.

[0055] The fourth aspect of the present invention provides a pharmaceutical composition, which comprises artificial antigen-presenting cells prepared by the method described in the first aspect of the present invention.

[0056] In the present invention, as mentioned above, the artificial antigen-presenting cells of the present invention can effectively expand antigen-specific T cells without introducing co-stimulatory molecules. Therefore, preferably, the pharmaceutical composition does not contain co-stimulatory molecules, and more preferably, the pharmaceutical composition does not contain 4-1BBL and / or OX40L.

[0057] In the present invention, the pharmaceutical composition may also contain therapeutic agents required clinically, including but not limited to T cells induced by artificial antigen presenting cells prepared by the method, chemotherapeutic agents, radiotherapeutic agents or immunotherapeutic agents.

[0058] In the present invention, the pharmaceutical composition may also contain a pharmaceutically acceptable carrier, such as a diluent, an excipient, a wetting agent, a buffer, a suspending agent, a lubricant, an adjuvant, an emulsifier, a disintegrant, an absorbent, a storage agent, a surfactant, a colorant, a flavoring agent or a sweetener, etc.

[0059] In the present invention, the dosage form of the pharmaceutical composition is not particularly limited and can be adjusted according to clinical needs. For example, it can be an injection, a freeze-dried product, a tablet, a hard capsule, a soft capsule, a granule, a powder, a pill, a syrup, a suppository, a cataplasm, an ointment, a cream or an eye drop, etc.

[0060] The fifth aspect of the present invention provides an application of the method for preparing artificial antigen presenting cells according to the first aspect of the present invention in preparing a drug for T cell immunotherapy.

[0061] In the present invention, the T cell immunotherapy drug can be a T cell immunotherapy drug conventionally used in the art, for example, it can be a CAR-T (chimeric antigen receptor T cell) drug, TCR-T (T cell receptor engineered T cell) drug.

[0062] The method for preparing artificial antigen presenting cells provided by the present invention can also be used to prepare drugs for treating human cytomegalovirus infectious diseases.

[0063] The method for preparing artificial antigen-presenting cells provided by the present invention can effectively amplify antigen-specific T cells (CTLs) in peripheral blood mononuclear cells, and the amplified antigen-specific T cells can be separated from the artificial antigen-presenting cells using conventional technical means in the art, and the obtained CTLs can be used to prepare cell therapy products and T cell immunotherapy drugs.

[0064] The medicine of the present invention may further include pharmaceutically acceptable excipients, including diluents, adhesives, lubricants, disintegrants, colorants, emulsifiers, pH buffers, preservatives, etc. The excipients used in the present invention may be various conventional excipients used in pharmaceutical preparations.

[0065] The method for preparing artificial antigen-presenting cells described in the present invention can also be used for quality control of cell therapy products, for example, pathogen screening and detection of autologous cell donors or allogeneic cell donors (such as CMV antigen detection), production process quality control of CAR-T cell products, and cell viability in cell products.

[0066] A sixth aspect of the present invention provides use of the method for preparing artificial antigen presenting cells according to the present invention in preparing a preparation and / or device for detecting T cells.

[0067] DCs are scarce, and mature DCs obtained through in vitro culture are also rare and difficult to expand. Moreover, the amount of blood drawn from clinical patients during testing is small, usually 10 ml. Therefore, it is difficult to use natural DC cells to co-culture with PBMC to induce specific T cells during clinical testing. The inventors of the present invention have found in their studies that the method for preparing artificial antigen-presenting cells described in the present invention can improve the ability of artificial antigen-presenting cells to present antigens. When the obtained artificial antigen-presenting cells are co-cultured with PBMC, the number of amplified specific T cells is higher than that of natural DC cells that are also co-cultured. Therefore, compared with conventional technical means, the method provided by the present invention can enhance the sensitivity of detecting antigen-specific T cells, and K562 cells can be loaded with one or more different antigen RNAs as needed to detect different antigen-specific T cells.

[0068] In the present invention, the preparation and / or device can be used in clinical, scientific research, drug development and other fields, such as disease screening, clinical testing, clinical diagnosis, efficacy evaluation, disease progression monitoring, immune monitoring, prognosis monitoring, etc.; specifically, the method described in the present invention can be used to prepare artificial antigen presenting cells, and after co-culturing with PBMC of patients or healthy individuals, substances related to disease diagnosis and treatment in antigen-specific T cells and / or secretions can be detected to achieve early tumor screening, evaluate the effect of breast cancer surgery, etc.

[0069] In the present invention, the preparation includes but is not limited to drugs, reagents and the like.

[0070] In the present invention, the equipment includes but is not limited to a reagent kit, a detection system, an instrument, and the like.

[0071] The present invention also relates to a method for detecting T cells, which comprises preparing artificial antigen presenting cells, co-culturing the artificial antigen presenting cells with peripheral blood mononuclear cells, and then performing T cell detection;

[0072] Wherein, the peripheral blood mononuclear cells are from a donor subject, and the method for preparing artificial antigen presenting cells is the method described in the first aspect of the present invention.

[0073] The method for detecting T cells can increase the number of T cells and enhance the sensitivity of detecting antigen-specific T cells.

[0074] In the present invention, the method for performing T cell detection may be a conventional method in the art, such as flow cytometry, enzyme-linked immunosorbent assay (ELISPOT), and the like.

[0075] In the present invention, the T cell detection may be detection of the number, activity, quality, etc. of T cells.

[0076] In the present invention, the T cell detection method can be used in clinical, scientific research, drug development and other fields, such as disease screening, clinical testing, clinical diagnosis, efficacy evaluation, disease progression monitoring, immune monitoring, prognosis monitoring, etc. Specifically, for example, it can be used to judge whether the immunotherapy drug is effective and the patient's prognosis before or during the patient's medication.

[0077] The present invention will be described in detail below by way of examples. In the present invention, unless otherwise specified, all reagents, raw materials and equipment used in the present invention can be purchased through commercial channels.

[0078] The complete culture medium of PBMC is: X-VIVO 15 (Lonza, brand: 04-418Q) + 10% hAB + 5ng / ml IL-7 (PeproTech, brand: 200-07-1-UG) + 5ng / ml IL-15 (PeproTech, brand: 200-15-10UG) + 100U / ml IL-2 (PeproTech, brand: 200-02-1MG)) + 20μg / ml polyinosinic acid (Sigma, brand: P0913-10MG), which is used for co-culture.

[0079] Complete culture medium for K562 overexpression cell line: RPMI 1640 culture medium (purchased from Gibco) + 10% FBS + 1% P / S.

[0080] mDC complete culture medium: RPMI-1640 (Gibco, brand: 11875-093) + 10% FBS (Cytiva, brand: SV30208.02) + 20 ng / mL IL-4 (RD, brand: 204-GMP-010) + 100 ng / mL GM-CSF (RD, brand: 7954-GM-010 / CF).

[0081] 4 wt% paraformaldehyde fixative was purchased from Solarbio, product number P1110, and was diluted with PBS to a concentration of 1 wt% when used.

[0082] The paraformaldehyde used in the following examples, unless otherwise specified, is 1% by weight paraformaldehyde.

[0083] Embodiment 1: Construction of single HLA K562 cell line

[0084] This example is used to illustrate the construction of a single HLA K562 cell line.

[0085] First, the HLA expression gene was packaged into lentivirus using 293FT tool cells, and then the HLA gene was stably integrated into the genome of K562 cells using lentiviral infection, allowing it to be stably inherited and expressed.

[0086] Experimental process:

[0087] (1) Cell culture: Wild-type 293FT (purchased from Beina Biotechnology) and K562 cells (purchased from Zhejiang Meisen) were revived and cultured according to the cell culture operation manual.

[0088] Recovery: Take one vial of 293FT and k562 wild-type frozen cells, thaw them gently and quickly in a 37°C water bath, then transfer them into a 15 mL centrifuge tube, centrifuge once at room temperature with a centrifugal force of 350 g for 5 min, discard the supernatant, resuspend the cells with an appropriate amount of complete medium, and then transfer them to a T75 culture flask and culture them in a 37°C, 5% CO2 incubator;

[0089] Culture: 293FT is an adherent cell. When the cell fusion degree at the bottom of the culture bottle reaches 80-90%, the cells are subcultured at a ratio of 1:3. K562 is a suspension cell. The culture medium state is observed every 2-3 days. When the solution turns yellow, subculture or rehydration can be performed. The initial cell density is adjusted to 5×10 5 cells / mL.

[0090] (2) Lentivirus packaging and concentration: After the cells are stable, the HLA lentivirus expression plasmid (synthesized by GenScript) and two auxiliary plasmids (psPAX2 vector and pMD2G vector) are co-transfected into 293FT cells using the Lipo3000 transfection kit. The cell supernatant is collected after 48 hours, and the supernatant is collected after the medium is changed. The two supernatants are mixed and concentrated using PEG8000 concentration reagent (add 1 / 5 of the total virus volume). After concentration at 4°C overnight, the precipitate is collected by centrifugation at 4500 rpm, 4°C, and 50 min to obtain the purified lentivirus.

[0091] (3) Lentivirus infection and stable clone screening: The cultured K562 wild-type cells were centrifuged and the density was adjusted to 3×10 5 cells / mL, inoculated into a 12-well plate, 1mL / well, and added 5μL of Polybrene infection-promoting reagent and 50μL of purified lentivirus to each well. After culturing for 2 generations, HLA expression was detected by flow cytometry (BV510 Mouse Anti-Human HLA-ABC, BD), and the cell wells with HLA positive expression were flow sorted, and the top 5% monoclonal clones were sorted into 1 well and continued to be cultured; the flow detection and flow sorting steps were repeated, and the clones with significantly higher expression than the K562 wild type were selected for amplification and cryopreservation.

[0092] The results are as follows Figure 1 shown.

[0093] Results Analysis :The HLA expression intensity and positive rate were detected by flow cytometry, and the cells with the best expression effect were selected. The results are as follows Figure 1 B. K562-HLA-A1101 OE (hereinafter referred to as HLA-A11) cell HLA positive rate was 98.68%; K562-HLA-A0201 OE (hereinafter referred to as HLA-A02) cell HLA positive rate was 98.61%; K562-HLA-A2402 OE The HLA positivity rate of (hereinafter referred to as HLA-A24) cells was 98.15%.

[0094] HLA-A1101 gene sequence:

[0095] SEQ ID NO:1

[0096]

[0097] HLA-A0201 gene sequence:

[0098] SEQ ID NO:2

[0099]

[0100] HLA-A2402 gene sequence:

[0101] SEQ ID NO:3

[0102]

[0103] Embodiment 2: K562-A02 cells fixed with paraformaldehyde and electroporated with CMV mRNA (cytomegalovirus mRNA) can stimulate the proliferation of specific T cells

[0104] The sequence of CMV mRNA is:

[0105] SEQ ID NO:4AUGAACCUCGUCCCCAUGGUGGCCACCGUGUAA

[0106] Experimental procedures :

[0107] (I) aAPC preparation

[0108] (1) Preparation of K562-A02 cells:

[0109] Recovery: Take 1 vial of k562-A02 frozen cells, thaw them gently and quickly in a 37°C water bath, then transfer them into a 15mL centrifuge tube, centrifuge once at room temperature with a centrifugal force of 350g for 5min, discard the supernatant, resuspend the cells with an appropriate amount of complete culture medium, and then transfer them to a T75 culture flask and culture them in a 37°C, 5% CO2 incubator;

[0110] Culture: K562-A02 is a suspension cell. The culture medium status is observed every 2-3 days. When the solution turns yellow, it can be subcultured or rehydrated. The initial cell density is adjusted to 5×10 5 cells / mL, and electroporation can be performed after the cells are stable after 2-3 generations.

[0111] (2) Electroporation of K562-A02 cells:

[0112] Centrifuge the prepared cells at 350g for 5 minutes at room temperature, discard the supernatant, resuspend the cells in 0.5-1ml D-PBS and count them, calculate the required volume of cell suspension based on the counting results, pipette the required number of cells into a 1.5ml sterile EP tube, centrifuge at 350g for 5 minutes at room temperature, and discard the supernatant;

[0113] Use the corresponding Neon TM Resuspend the cells in the resuspension buffer provided in the kit at 15 μg / 2×10 6 cells and add CMV mRNA (Note: resuspension volume = resuspension buffer volume + mRNA volume);

[0114] Using Neon TM Pipette the prepared cells and place the Neon TM The pipette is inserted vertically into the Neon TMInsert the pipette tip into the tube of the pipette rack until you hear a click, making sure that the protrusion of the pipette is inserted into the groove in the pipette rack. Set the electroporation parameters, pulse voltage 1300V, pulse width 30ms, pulse number 1, click Start, and after the instrument makes a "beep" sound, take out the Neon TM Use a pipette to gently transfer the cells into the pre-warmed maturation medium and return them to the incubator to complete the electroporation.

[0115] The electroporated cells were divided into 1×10 6 / ml density to inoculate complete medium until re-diffusion is sufficient, and then put the well plate into a CO2 incubator for re-cultivation. The culture temperature is 37°C and the CO2 concentration is 5%.

[0116] (3) Fixation of K562-A02 cells after electroporation:

[0117] 24 hours after electroporation, the electroporated K562-A02 cells were harvested; after centrifugation, the supernatant was discarded (all liquid was removed as much as possible), and the cells were resuspended with 900 μl sterile PBS, and then 300 uL of 1 wt % paraformaldehyde was added, mixed evenly, and fixed at room temperature (25°C) for 10 min;

[0118] After 10 minutes, centrifuge at 450g for 10 minutes and discard the supernatant. Repeat the wash twice with 1 mL of PBMC complete medium. Finally, resuspend with PBMC complete medium and count with a cell counting plate without DAPI staining. (K2 bright field counting).

[0119] (II) PBMC preparation

[0120] PBMC Isolation:

[0121] Peripheral blood (HLA-A02:01, blood from a 27-year-old healthy female donor, 15 ml) was transferred from the blood collection tube to a centrifuge tube, and centrifuged at 1000 g for 10 min at 9°C.

[0122] Preparation of autologous plasma (BLP): Pipette the upper plasma into a new 15 ml centrifuge tube, seal it with a sealing film, and inactivate it in a water bath for later use (56°C, centrifuge at 1000g for 10 minutes after 30 minutes, and store the supernatant at -20°C for later use);

[0123] The remaining peripheral blood solution after removing the plasma was used for subsequent density gradient centrifugation. D-PBS buffer was added to the remaining peripheral blood solution after removing the plasma to make the total volume 18 ml, the tube cap was tightened, and mixed for about 5 times;

[0124] Take a 50ml centrifuge tube, add 13.5ml Ficoll solution, absorb the peripheral blood D-PBS mixture, and slowly load it onto the Ficoll liquid surface without shaking it significantly. Tighten the bottle cap, select centrifugal force 600g, speed increase 9, speed decrease 0, centrifugation time 20min (start timing when centrifugation starts), centrifugation temperature 19℃, and start centrifugation;

[0125] Absorb the white film layer: After centrifugation, confirm that the centrifuge tube after density gradient centrifugation has four distinct layers and is clearly layered. Absorb the white film into a new 50ml centrifuge tube, fill it up to 50ml with D-PBS buffer, tighten the bottle cap and mix it upside down for about 5 times;

[0126] Initial wash centrifugation: centrifugal force 700g, speed up 9, speed down 9, centrifugation time 10min, centrifugation temperature 19℃;

[0127] After centrifugation, remove the supernatant, blow the cells, and add D-PBS to 50 ml;

[0128] Final centrifugation: centrifugal force 300g, speed up 9, speed down 9, centrifugation time 10min, centrifugation temperature 19℃;

[0129] Unscrew the tube cap, pour all the liquid in the tube into the waste bottle, tighten the tube cap, blow on the cells to shake off the cell pellet, and count the cells.

[0130] (III) Co-culture of aAPCs and PBMCs

[0131] The prepared aAPCs of different species were collected and added to the prepared PBMCs (cell number ratio was 1:1). Based on the total number of cells and the viable cell density of PBMCs, the ratio was 1×10 6 cells / ml, observe the PBMC cells every day, count and replenish the cells every day or every other day according to the growth rate of the PBMC cells (using PBMC complete culture medium). The density of PBMC viable cells after each replenishment should be 1×10 6 / ml. Starting from Day 9, there is no need to add autologous plasma to the PBMC cell culture medium, that is, the composition of the PBMC culture medium is X-VIVO15+100U IL-2.

[0132] Testing and result determination:

[0133] Cells in each group were collected at two time points, Day 0 and Day 14, and the expansion ratio of specific T cells was detected by CMV Tetramer. The detection panel was CD3 (Biolegend, Cat: 45-0037-42) / CD8 (BD, Cat: 563256) / CD4 (BD, Cat: 344616) / CMV Tetramer (MBL, Cat: TS-0010-1C).

[0134] The experimental results are as follows Figure 2 As shown in A, B, and C.

[0135] The experimental groups are as follows:

[0136] (1) K562-A02: K562-A02 cells were not fixed with 1 wt % paraformaldehyde and were directly used as aAPCs;

[0137] (2) K562-A02-1%F: aAPCs after K562-A02 cells were fixed with 1 wt % paraformaldehyde;

[0138] (3) K562-A02-CMV: K562-A02 cells electroporated with CMV mRNA were not fixed with 1 wt % paraformaldehyde and were directly used as aAPCs;

[0139] (4) K562-A02-CMV-1%F: K562-A02 cells electroporated with CMV mRNA were fixed with 1 wt % paraformaldehyde and used as aAPCs;

[0140] Results Analysis :

[0141] Depend on Figure 2 A and B show that the baseline specific T cell ratio on Day 0 was 1.29%. On Day 14 of co-culture, the ratios of CMV tetramer-positive CD8+T cells in the unfixed K562-A02 and K562-A02-CMV groups were 0.55% and 7.54%, respectively, and the ratios of K562-A0201-1%F and K562-A0201-CMV-1%F in the fixed groups fixed with paraformaldehyde were 0.66% and 10.05%, respectively. It can be seen that after K562-A02 cells were transfected with CMV mRNA, CMV antigens could be effectively presented, and the proliferation of CMV-specific T cells could be significantly induced regardless of whether the cells were fixed with paraformaldehyde or not, and the induction ability of specific T cells was stronger after paraformaldehyde fixation, indicating that paraformaldehyde fixation did not affect the antigen presentation ability of cells.

[0142] On the other hand, Figure 2C, from the total T cell proliferation curve during the whole culture process, the unfixed K562 cells (K562-A02) significantly inhibited T cell proliferation; while the K562-A2 CMV cells (K562-A0201-CMV-1%F) fixed with paraformaldehyde had no significant effect on total T cells and specific T cells ( Figure 2 AB) have the strongest expansion ability; this indicates that the present invention uses 1 wt% paraformaldehyde to prepare aAPC, which retains the antigen presentation efficiency after fixation at room temperature, and does not affect the proliferation of T cells, and can be better used for specific T cell expansion.

[0143] This example demonstrates that non-inactivated K562 cells will affect the proliferation of T cells. Using the method of the present invention, using paraformaldehyde to fix K562-A02 cells transfected with CMV mRNA can inactivate the cells and simultaneously proliferate CMV-specific T cells.

[0144] Embodiment 3: Exploring the effect of co-stimulatory molecules on the effect of aAPC

[0145] 4-1BBL belongs to the tumor necrosis factor (TNF) ligand superfamily, and OX40L is a member of the tumor necrosis factor receptor (NGFR / TNFR) family that has the function of activating T cells. Both 4-1BBL and OX40L are co-stimulatory molecules, and the co-stimulatory signals mediated by their activation can lead to the activation, proliferation, differentiation of T cells and up-regulation of cytokine production.

[0146] This example is used to illustrate whether the introduction of co-stimulatory molecules into fixed aAPC cells can enhance the expansion capacity of specific T cells.

[0147] Sequence of OX40L mRNA:

[0148] SEQ ID NO:5

[0149] AUGGAAAGGGUCCAACCCCUGGAAGAGAAUGUGGGAAAUGCAGCCAGGCCAAGAUUCGAGAGGAACAAGCUAUUGCUGGUGGCCUCUGUAAUUCAGGGACUGGGGCUGCUCCUGUGCUUCACCUACAUCUGCCUGCACUUCUCUGCUCUUCAGGUAUCACAUCGGUAUCCUCGAAUUCAAAGUAUCAAAGUACAAUUUACCGAAUAUAAGAAGGAGAAAGGUUUCAUCCUCACUUCCCAAAAGGAGGAUGAAAUCAUGAAGGUGCAGAACAACUCAGUCAUCAUCAACUGUGAUGGGUUUUAUCUCAUCUCCCUGAAGGGCUACUUCUCCCAGGAAGUCAACAUUAGCCUUCAUUACCAGAAGGAUGAGGAGCCCCUCUUCCAACUGAAGAAGGUCAGGUCUGUCAACUCCUUGAUGGUGGCCUCUCUGACUUACAAAGACAAAGUCUACUUGAAUGUGACCACUGACAAUACCUCCCUGGAUGACUUCCAUGUGAAUGGCGGAGAACUGAUUCUUAUCCAUCAAAAUCCUGGUGAAUUCUGUGUCCUUUGA

[0150] Sequence of 4-1BBL mRNA:

[0151] SEQ ID NO:6

[0152] AUGGAAUACGCCUCUGACGCUUCACUGGACCCCGAAGCCCCGUGGCCUCCCGCGCCCCGCGCUCGCGCCUGCCGCGUACUGCCUUGGGCCCUGGUCGCGGGGCUGCUGCUGCUGCUGCUGCUCGCUGCCGCCUGCGCCGUCUUCCUCGCCUGCCCCUGGGCCGUGUCCGGGGCUCGCGCCUCGCCCGGCUCCGCGGCCAGCCCGAGACUCCGCGAGGGUCCCGAGCUUUCGCCCGACGAUCCCGCCGGCCUCUUGGACCUGCGGCAGGGCAUGUUUGCGCAGCUGGUGGCCCAAAAUGUUCUGCUGAUCGAUGGGCCCCUGAGCUGGUACAGUGACCCAGGCCUGGCAGGCGUGUCCCUGACGGGGGGCCUGAGCUACAAAGAGGACACGAAGGAGCUGGUGGUGGCCAAGGCUGGAGUCUACUAUGUCUUCUUUCAACUAGAGCUGCGGCGCGUGGUGGCCGGCGAGGGCUCAGGCUCCGUUUCACUUGCGCUGCACCUGCAGCCACUGCGCUCUGCUGCUGGGGCCGCCGCCCUGGCUUUGACCGUGGACCUGCCACCCGCCUCCUCCGAGGCUCGGAACUCGGCCUUCGGUUUCCAGGGCCGCUUGCUGCACCUGAGUGCCGGCCAGCGCCUGGGCGUCCAUCUUCACACUGAGGCCAGGGCACGCCAUGCCUGGCAGCUUACCCAGGGCGCCACAGUCUUGGGACUCUUCCGGGUGACCCCCGAAAUCCCAGCCGGACUCCCUUCACCGAGGUCGGAAUAA

[0153] Experimental process:

[0154] The K562-A02 cells co-transfected with three kinds of mRNAs of CMV, OX40L and 4-1BBL were processed according to the electroporation and fixation methods in Example 2 to prepare aAPC. K562-A02 cells were electroporated with CMV mRNA alone, or with CMV mRNA + OX40L mRNA + 4-1BBL mRNA, and the electroporation coefficient was: 2×10 6cells / 100μl / 15μg mRNA. After 24h of electroporation, the cells were collected and centrifuged once at room temperature (350g, 5min). The supernatant was discarded and resuspended in PBS. The cells were counted and centrifuged again. The cells were resuspended in 1 wt% paraformaldehyde (Solarbio, Cat: P1110) and the cell density was adjusted to 1×10 6 cells / ml, fixed at room temperature for 10 min, centrifuged once at room temperature (350 g, 5 min), discarded the supernatant, washed once with PBS, and resuspended in complete medium.

[0155] Testing and result determination:

[0156] After aAPCs and PBMCs were mixed in a ratio of 1:1, they were cultured in vitro until D14, and cells were taken at D0 and D14 for flow cytometry detection of specific T cell expansion ratio. The detection panel was CD3 (Biolegend, Cat: 45-0037-42) / CD8 (BD, Cat: 563256) / CD4 (BD, Cat: 344616) / CMV Tetramer (MBL, Cat: TS-0010-1C).

[0157] The experimental groups are as follows:

[0158] (1) K562-A02-CMV: The electroporated cells were directly used as aAPCs;

[0159] (2) K562-A02-CMV-1%F: K562-A02 cells fixed with paraformaldehyde and electroporated with CMV were used as aAPCs;

[0160] (3) K562-A02-CMV-OX40L-41BBL: cells co-transfected with three mRNAs of CMV-OX40L-41BBL were directly used as aAPCs;

[0161] (4) K562-A02-CMV-OX40L-41BBL-1%F: cells fixed with paraformaldehyde and co-transfected with three mRNAs of CMV-OX40L-41BBL were used as aAPCs.

[0162] The experimental results are as follows Figure 3 .

[0163] Result analysis:

[0164] Depend on Figure 3 As shown in A and 3B, different aAPC experimental groups were set up, and K562-A2CMV cells transfected or not transfected with co-stimulatory molecules were fixed or not with paraformaldehyde and co-cultured with PBMCs in a ratio of 1:1, respectively. The baseline CMV tetramer positive ratio was 0.79%;

[0165] After adding aAPC for co-culture, on Day 14, K562-A2 CMV cells transfected or not transfected with co-stimulatory molecules could significantly induce the expansion of CMV-specific T cells. Figure 3 AB showed that when the electroporated cells were directly used as aAPC (K562-A02-CMV), the proportion of induced specific T cells was 2.53%. On this basis, transfection with OX40L-41BBL could significantly enhance the presentation ability of K562-A2 for CMV antigens, and the proportion of specific T cells increased to 6.63% (K562-A02-CMV-OX40L-41BBL), and the total number of T cells also increased ( Figure 3 C), suggesting that 4-1BBL and OX40L can enhance the proliferation of T cells and antigen-presenting cells. However, compared with aAPC K562-A2 CMV cells that were not transfected with OX40L-41BBL and only fixed with paraformaldehyde, aAPC transfected with OX40L-41BBL did not have an advantage. The proportion of specific T cells induced by the former could reach 10.38%; while the proportion of specific T cells induced by aAPC transfected with OX40L-41BBL and then fixed with paraformaldehyde (9.47%) did not increase significantly. The above experimental results show that the addition of costimulatory molecules does not affect the antigen presentation effect of aAPC prepared by paraformaldehyde fixation based on K562-HLA cells.

[0166] The results of this example show that fixed aAPCs can effectively expand specific T cells without the addition of costimulatory molecules, and there is no significant difference after the addition of costimulatory molecules.

[0167] Embodiment 4: Comparison of the effects of aAPC and autologous DC on the expansion of specific T cells

[0168] This example is used to demonstrate that the effect of aAPC prepared by the method of the present invention on the expansion of specific T cells is comparable to that of autologous DC, and that the method of electroporating mRNA antigens is superior to the method of loading antigen peptides.

[0169] DCs were prepared using autologous adherent isolation method:

[0170] (1) PBMC static state:

[0171] According to the total amount of PBMC viable cells (cell number) obtained from peripheral blood separation, according to the plating density, use static culture medium, gently blow and evenly spread the cells in a 6-well culture plate for culture. After inoculating PBMC into the well plate, cover the lid, gently cross-shake the 6-well plate 3-5 times to make the cells evenly spread in the 6-well plate, and mark the sample number on the lid. Place the above 6-well plate in a carbon dioxide incubator with a culture temperature of 37.0°C and a CO2 concentration of 5.0%. Let it stand for 2-3 hours to allow the monocytes to adhere to the wall. Be careful to avoid violent shaking of the well plate during the movement of the well plate.

[0172] (2) DC separation:

[0173] Place the 6-well plate flat on the operating table in the biosafety cabinet, use a 1 ml pipette to aspirate the supernatant, then add 2 ml of mDC complete medium twice, and slowly pipette the medium along the wall of the well plate;

[0174] Use a pipette to add GM-CSF working solution and IL-4 working solution to the mDC culture medium in each well, and gently shake the culture container crosswise parallel to the bottom for 4 times to allow the factors to fully dissolve in the culture medium (prepare the mixed solution in advance and add it directly), and place the above 6-well plate in a CO2 incubator for culture at a temperature of 37.0°C and a CO2 concentration of 5.0%.

[0175] The cultured DC cells were used in subsequent experiments.

[0176] Experimental process:

[0177] (1) K562-A02 cells electroporated with CMV and fixed with paraformaldehyde as aAPC (K562-A02-CMV-1%F):

[0178] The K562-A02 cells electroporated with CMV mRNA were treated with reference to the electroporation and fixation method in Example 1 to prepare aAPCs. K562-A02 cells were electroporated with CMV mRNA, and the electroporation coefficient was 1×10 6 cells / 100μl / 15μg mRNA. After 24h of electroporation, cells were collected and centrifuged once at room temperature (350g, 5min). The supernatant was discarded and resuspended in PBS. The cells were counted and centrifuged again. The cells were resuspended in 1 wt% paraformaldehyde (Solarbio, Cat: P1110) and the cell density was adjusted to 1×10 6 cells / ml, fixed at room temperature for 10 min, centrifuged once at room temperature (350 g, 5 min), discarded the supernatant, washed once with PBS, and resuspended in complete medium.

[0179] (2) K562-A02 cells loaded with HLA-A*02:01 positive antigen peptide as aAPC (K562-A02-CMVPeptied):

[0180] HLA-A*02:01 positive antigenic peptide: HLA-A*02:01 restricted antigenic peptide derived from human cytomegalovirus (HCMV) matrix phosphoprotein pp65, pp65 495-504: NLVPMVATV (SEQ ID NO: 7).

[0181] Loading method: Incubate cells with peptide overnight.

[0182] After loading, fixation was performed using 1 wt % paraformaldehyde according to the method of Example (1).

[0183] (3) DC to CMV (DC-CMV):

[0184] The preparation was carried out according to the electroporation method in Example 2.

[0185] (4) DC loaded with HLA-A*02:01 positive antigen peptide (K562-A02-CMV Peptied):

[0186] The preparation was carried out according to the method in Example (2), but the loading was not fixed.

[0187] Testing and result determination:

[0188] At the same time, DCs electroporated with CMV and DCs loaded with HLA-A*02:01 positive antigen peptides were used as APCs as the control group. The cells in each group were mixed with PBMCs at a ratio of 1:1 and cultured in vitro until D14. Cells were collected at D0 and D14 for flow cytometry detection of specific T cell expansion ratio. The detection panel was CD3 (Biolegend, Cat: 45-0037-42) / CD8 (BD, Cat: 563256) / CD4 (BD, Cat: 344616) / CMV Tetramer (MBL, Cat: TS-0010-1C).

[0189] The experimental groups are as follows:

[0190] (1) K562-A02-CMV-1%F: K562-A02 cells fixed with paraformaldehyde and electroporated with CMV were used as aAPCs;

[0191] (2) K562-A02-CMV Peptied: K562-A02 cells loaded with HLA-A*02:01 positive antigen peptides were used as aAPCs;

[0192] (3) DC-CMV: DC electroporated into CMV as APC;

[0193] (4) DC-CMV Peptied: DC cells loaded with HLA-A*02:01 positive antigen peptides were used as APCs.

[0194] The experimental results are as follows Figure 4 .

[0195] Result analysis:

[0196] Depend on Figure 4 As shown in A and 4B, different aAPC experimental groups were set up, and the baseline specific T cell ratio on Day 0 was 0.45%; after adding aAPC for co-culture, CMV-specific T cell proliferation was significantly induced on Day 14. When K562-A2 electroporated with CMV mRNA was used as aAPC (i.e., K562-A02-CMV-1%F) and cells fixed with paraformaldehyde were used as aAPC, the induced specific cell ratio was 11.15%, and the induced specific cell ratio was 9.99% when autologous DC electroporated with CMV mRNA was used as APC (DC-CMV), indicating that the effect of aAPC prepared by the present invention on CMV-specific T cell proliferation reached or even exceeded the level of using autologous DC cells;

[0197] At the same time, HLA-A*02:01 positive antigen peptides were loaded on K562-A02 (co-cultured with T cells after fixation) and DC cells for comparison (K562-A02-CMV Peptied and DC-CMV Peptied). The results showed that the proportions of specific T cells induced in the two groups were 4.58% and 4.18%, respectively. There was no significant difference between the two groups. Although the proportions of specific T cells were significantly increased compared with the baseline, the proportions were lower than those in the mRNA transfection groups.

[0198] This example illustrates that the aAPC prepared by the method of the present invention has a better effect on the expansion of specific T cells than autologous DC, and the method of electroporating mRNA antigens is better than the method of loading antigen peptides.

[0199] Embodiment 5: aAPCs prepared from different HLA subtypes can effectively expand specific T cells

[0200] This example is used to demonstrate that aAPCs of different HLA subtypes prepared using the above method can effectively expand specific T cells.

[0201] Experimental process:

[0202] K562 cells overexpressing HLA-A11 and HLA-A02 were selected for aAPC preparation. The preparation method was referred to Example 2. Then, K562-A02 and K562-A11 were used to electroporate CMV mRNA, respectively. The electroporate coefficient was 1×10 6 cells / 100μl / 15μg mRNA. After 24h of electroporation, the cells were collected and centrifuged once at room temperature (350g, 5min). The supernatant was discarded and resuspended in PBS. The cells were counted and centrifuged again. The cells were resuspended in 1 wt% paraformaldehyde (Solarbio, Cat: P1110) and the cell density was adjusted to 1×10 6 cells / ml, fixed at room temperature for 10 min, centrifuged once at room temperature (350 g, 5 min), discarded the supernatant and washed once with PBS.

[0203] Resuspend in complete medium, and select healthy donors with different HLA subtypes for PBMCs isolation. The two HLA subtypes are HLA-A*02:01 (HLA-A02) and HLA-A*11:01 (HLA-A11). After aAPCs and PBMCs are mixed in a 1:1 ratio, they are cultured in vitro until D14.

[0204] Testing and result determination:

[0205] Cells were collected at D0 and D14 for flow cytometry detection of specific T cell expansion ratio. The detection panel was CD3 (Biolegend, Cat: 45-0037-42) / CD8 (BD, Cat: 563256) / CD4 (BD, Cat: 344616) / CMV Tetramer (MBL, Cat: TS-0010-1C).

[0206] The experimental results are as follows Figure 5 shown.

[0207] Result analysis:

[0208] like Figure 5As shown, volunteers of HLA-A02 and HLA-A11 subtypes were selected, and K562 cells corresponding to the overexpressed HLA subtypes were used respectively, CMV mRNA was electroporated, and the cells were fixed with 1 wt % paraformaldehyde and mixed with PBMC in a 1:1 ratio as aAPCs. The cells were cultured in vitro until D14, and the CMV Tetramer positive ratio was detected by flow cytometry on Day 0 and Day 14 respectively. For A02 subtype donors, the proportion of specific T cells detected on Day 14 was 9.61%, which was significantly higher than the baseline of 0.38%; for A11 subtype donors, the proportion of specific T cells detected on Day 14 was 7.70%, which was significantly higher than the baseline of 0%. The above results demonstrate that when K562 cells of different HLA subtypes are prepared into aAPCs using the above method, specific T cells can be effectively amplified.

[0209] This example illustrates that the artificial antigen-presenting cells of different HLA subtypes constructed by the present invention can cover most of the population and can be used for the expansion of specific T cells of multiple HLA subtypes.

[0210] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A method for preparing an artificial antigen presenting cell, characterized in that: The method includes: (1) Construction of K562 cells expressing HLA; (2) Loading RNA onto K562 cells expressing HLA, wherein the RNA is antigen mRNA, and the RNA loading method is transfection, wherein each 2×10 6 cells, the amount of the RNA used is 12-20 μg, and the RNA has a base sequence as shown in SEQ ID NO: 4; (3) fixing the RNA-loaded K562 cells with a fixative, wherein the fixative is a paraformaldehyde solution and / or a formaldehyde solution, wherein the concentration of paraformaldehyde in the paraformaldehyde solution is 0.5-1.5 wt %, and the concentration of formaldehyde in the formaldehyde solution is 0.8-1.2 wt %, and the concentration of each 1×10 6 K562 cells loaded with RNA, the amount of the fixative is 0.5-1.5 mL, and the fixation conditions include: temperature of 15-30° C., time of 5-15 min; The artificial antigen presenting cells do not introduce co-stimulatory molecules.

2. The method according to claim 1, wherein: The method for constructing the HLA-expressing K562 cells in step (1) is to integrate the HLA expression gene into the genome of the K562 cells.

3. The method according to claim 2, wherein: The HLA expression gene is an HLA-I class gene.

4. The method according to claim 3, wherein: The HLA expression gene is HLA-A.

5. The method according to claim 4, wherein: The HLA expression gene is at least one of HLA-A*02:01, HLA-A*11:01, HLA-A*24:02, HLA-A*01:01, HLA-A*01:02, HLA-A*01:03, HLA-A*01:06, HLA-A*01:07, HLA-A*01:08, HLA-A*01:09, HLA-A*01:10, HLA-A*01:12 and HLA-A*01:

13.

6. The method according to claim 1, wherein: The co-stimulatory molecule is 4-1BBL and / or OX40L.

7. An artificial antigen-presenting cell prepared by the method according to any one of claims 1 to 6.

8. A method for preparing T cells, characterized in that: The method comprises: co-culturing peripheral blood mononuclear cells with artificial antigen presenting cells; Wherein, the peripheral blood mononuclear cells are from a donor subject, and the artificial antigen-presenting cells are artificial antigen-presenting cells prepared by the method according to any one of claims 1 to 6.

9. The method according to claim 8, wherein: The number ratio of the artificial antigen presenting cells to the peripheral blood mononuclear cells is 1:(0.5-2).

10. The method according to claim 9, wherein: The ratio of the number of artificial antigen presenting cells to that of peripheral blood mononuclear cells is 1:(0.8-1.2).

11. A pharmaceutical composition comprising artificial antigen presenting cells prepared by the method according to any one of claims 1 to 6; in, The pharmaceutical composition does not comprise a co-stimulatory molecule.

12. The pharmaceutical composition according to claim 11, wherein The co-stimulatory molecule is 4-1BBL and / or OX40L.

13. Use of the method according to any one of claims 1 to 6 in the preparation of a drug for T cell immunotherapy.

14. Use of the method according to any one of claims 1 to 6 in the preparation of a preparation and / or device for detecting T cells.

Images