Nuclease and preparation method and use thereof

Abstract

The present invention relates to the field of biotechnology, and in particular to a nuclease and a preparation method and use thereof. The nuclease provided by the present invention comprises a polypeptide formed by one or more amino acid mutations of a wild-type Cas9 nuclease at position 766, position 915 or position 916; the amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID No. 1. Compared with the wild-type Cas9 nuclease, the ratio of the protruding broken ends and the blunt broken ends generated when the nuclease in the present invention cuts the target genomic DNA fragment is different from that of the wild-type Cas9 nuclease, so that the present invention can achieve more efficient and accurate single nucleotide insertion. Using the nuclease in the present invention to cut the DNA double strand can produce protruding broken ends, and the bases complementary to the protruding broken ends can be added by the cell's own repair system in a way of filling and connecting, which can achieve accurate editing of adding specific bases to specific positions of genomic DNA fragments.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nuclease and a preparation method and application thereof. Background Art

[0002] Since the completion of the Human Genome Project and the Encyclopedia of DNA Elements, scientists have analyzed and identified a large number of genes and DNA regulatory elements in the genome [1,2]. DNA regulatory elements that play an important role in gene expression regulation include promoters, enhancers, silencers, and insulators. However, the functions of most regulatory elements have not been experimentally verified and elucidated [2-8]. To explore the functions of genes and DNA regulatory elements, genetic DNA fragment editing can be used for research.

[0003] Early gene editing and gene function modification were achieved through gene transposition and transgenesis [9-14]. With the development of sequencing technology, reverse genetics was applied to specific mutations in the genome [15,16]. In particular, gene-targeted mice that rely on homologous recombination were rapidly applied to scientific research [15,17,18]. In addition, the inversion and duplication of DNA fragments in mice and zebrafish were used to study specific genomic structural changes [19-24].

[0004] In recent years, the type II clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated nuclease 9 (Cas9) CRISPR / Cas9, which originated from bacteria and archaea, is an emerging genome editing technology [25-27]. Due to its simple design and convenient operation, it has been rapidly applied to eukaryotic genome editing. In CRISPR / Cas9 genome editing technology, sgRNA guides the Cas9 protein to its target site, and finally generates double-strand DNA breaks (DSB) at the target site. The breaks are repaired through endogenous repair pathways, including nonhomologous end-joining (NHEJ) and microhomology-mediated end joining (MMEJ), as well as homology-directed repair (HDR) using repair templates, which has more accurate repair results, and may ultimately produce different repair results

[28] . In addition to the traditional CRISPR / Cas9-induced double-stranded DNA cleavage knockout, new technologies are emerging. For example, base editing provides a strategy to generate site-specific and precise point mutations without DSBs. Due to its accuracy and efficiency, it has shown great potential in the treatment of genetic diseases caused by certain single-base mutations. However, the gene mutations of many human genetic diseases are not limited to single-base mutations. Frameshift mutations are also a very important type of mutation. At the same time, base editors cannot achieve the goal of efficiently restoring normal sequences. In recent years, Cas9 nuclease in vitro cleavage experiments have revealed that the RuvC nuclease domain has diversity in cleaving the non-complementary strand of the targeted DNA, which can be broken at positions such as -3 and -4 upstream of PAM. At the same time, the HNH nuclease domain cuts the complementary strand at a fixed position 3bp upstream of PAM, thereby generating a 5' overhang with 1-2 nucleotides. This cleavage pattern will produce the addition of specific bases through DNA repair in cells [29-31]. By taking advantage of this cutting feature, it is possible to more efficiently edit the genes of certain diseases caused by single-base deletions and restore them to normal genotypes. This method does not require the addition of additional templates and has great application prospects in disease treatment

[32] . How to increase the proportion of 1-2bp template insertion in editing results is one of the important issues.

[0005] The above references are as follows:

[0006] [1]LI J,SHOU J,GUO Y,et al.Efficient inversions and duplications ofmammalian regulatory DNA elements and gene clusters by CRISPR / Cas9[J].Journalof molecular cell biology,2015,7(4):284–298.DOI:10.1093 / jmcb / mjv016.

[0007] [2]MALIP,YANG L,ESVELT K M,et al.RNA-guided human genome engineeringvia Cas9[J].Science(New York,N.Y.),2013,339(6121):823–826.DOI:10.1126 / science.1232033.

[0008] [3]LE CONG,RAN F A,COX D,et al.Multiplex genome engineering usingCRISPR / Cas systems[J].Science(New York,N.Y.),2013,339(6121):819–823.DOI:10.1126 / science.1231143.

[0009] [4]JINEK M,CHYLINSKI K,FONFARAI,et al.Aprogrammabledual-RNA-guidedDNA endonuclease in adaptive bacterial immunity[J].Science(New York,N.Y.),2012,337(6096):816–821.DOI:10.1126 / science.1225829.

[0010] [5]WU S,YING G,WU Q,et al.Aprotocol for constructing gene targetingvectors:generating knockout mice for the cadherin family and beyond[J].Natureprotocols,2008,3(6):1056–1076.DOI:10.1038 / nprot.2008.70.

[0011] [6]KRAFT K,GEUER S,WILL A J,et al.Deletions,Inversions,Duplications:Engineering of Structural Variants using CRISPR / Cas in Mice[J].Cell reports,2015,10(5):833–839.DOI:10.1016 / j.celrep.2015.01.016.

[0012] [7]An XIAO,WANG Z,HU Y,et al.Chromosomal deletions and inversionsmediated by TALENs and CRISPR / Cas in zebrafish[J].Nucleic acids research,2013,41(14):e141.DOI:10.1093 / nar / gkt464.

[0013] [8]GUPTAA,HALL V L,KOK F O,et al.Targeted chromosomal deletions andinversions in zebrafish[J].Genome research,2013,23(6):1008–1017.DOI:10.1101 / gr.154070.112.

[0014] [9]WU S,YING G,WU Q,et al.Toward simpler and faster genome-widemutagenesis in mice[J].Nature genetics,2007,39(7):922–930.DOI:10.1038 / ng2060.

[0015]

[10] ZHENG B,SAGE M,SHEPPEARD E A,et al.Engineering mouse chromosomeswith Cre-loxP:range,efficiency,and somatic applications[J].Molecular andcellular biology,2000,20(2):648–655.DOI:10.1128 / MCB.20.2.648-655.2000.

[0016]

[11] THOMAS K R,CAPECCHI M R.Introduction of homologous DNA sequencesinto mammalian cells induces mutations in the cognate gene[J].Nature,1986,324(6092):34–38.DOI:10.1038 / 324034a0.

[0017]

[12] SMITHIES O,GREGG R G,BOGGS S S,et al.Insertion of DNA sequencesinto the human chromosomal beta-globin locus by homologous recombination[J].Nature,1985,317(6034):230–234.DOI:10.1038 / 317230a0.

[0018]

[13] CARROLL D.Genome engineering with targetable nucleases[J].Annualreview of biochemistry,2014,83:409–439.DOI:10.1146 / annurev-biochem-060713-035418.

[0019]

[14] CAPECCHI M R.Gene targeting in mice:functional analysis of themammalian genome for the twenty-first century[J].Nature reviews.Genetics,2005,6(6):507–512.DOI:10.1038 / nrg1619.

[0020]

[15] PALMITER R D,BRINSTER R L,HAMMER R E,et al.Dramatic growth ofmice that develop from eggs microinjected with metallothionein-growth hormonefusion genes[J].Nature,1982,300(5893):611–615.DOI:10.1038 / 300611a0.

[0021]

[16] GORDON J W,SCANGOS G A,PLOTKIN D J,et al.Genetic transformationof mouse embryos by microinjection of purified DNA[J].Proceedings of theNational Academy of Sciences of the United States of America,1980,77(12):7380–7384.DOI:10.1073 / pnas.77.12.7380.

[0022]

[17] HARBERS K, D,JAENISCH R.Microinjection of clonedretroviral genomes into mouse zygotes:integration and expression in theanimal[J].Nature,1981,293(5833):540–542.DOI:10.1038 / 293540a0.

[0023]

[18] BRINSTER R L,CHEN H Y,TRUMBAUER M,et al.Somatic expression ofherpes thymidine kinase in mice following injection of a fusion gene intoeggs[J].Cell,1981,27(1 Pt2):223–231.DOI:10.1016 / 0092-8674(81)90376-7.

[0024]

[19] MCCLINTOCK B.The significance of responses of the genome tochallenge[J].Science(New York,N.Y.),1984,226(4676):792–801.DOI:10.1126 / science.15739260.

[0025]

[20] MCCLINTOCK B.The origin and behavior of mutable loci in maize[J].Proceedings of the National Academy of Sciences of the United States ofAmerica,1950,36(6):344–355.DOI:10.1073 / pnas.36.6.344.

[0026]

[21] LAAT W de,DUBOULE D.Topology of mammalian developmental enhancersand their regulatory landscapes[J].Nature,2013,502(7472):499–506.DOI:10.1038 / nature12753.

[0027]

[22] THURMAN R E,RYNES E,HUMBERT R,et al.The accessible chromatinlandscape of the human genome[J].Nature,2012,489(7414):75–82.DOI:10.1038 / nature11232.

[0028]

[23] SHEN Y,YUE F,MCCLEARY D F,et al.Amap of the cis-regulatorysequences in the mouse genome[J].Nature,2012,488(7409):116–120.DOI:10.1038 / nature11243.

[0029]

[24] NEPH S,VIERSTRAJ,STERGACHIS AB,et al.An expansive humanregulatory lexicon encoded in transcription factor footprints[J].Nature,2012,489(7414):83–90.DOI:10.1038 / nature11212.

[0030]

[25] ZHANG T,HAWS P,WU Q.Multiple variable first exons:a mechanism forcell-and tissue-specific gene regulation[J].Genome research,2004,14(1):79–89.DOI:10.1101 / gr.1225204.

[0031]

[26] BANERJI J,OLSON L,SCHAFFNER W.Alymphocyte-specific cellularenhancer is located downstream of the joining region in immunoglobulin heavychain genes[J].Cell,1983,33(3):729–740.DOI:10.1016 / 0092-8674(83)90015-6.

[0032]

[27] An integrated encyclopedia of DNAelements in the human genome[J].Nature,2012,489(7414):57–74.DOI:10.1038 / nature11247.

[0033]

[28] XUE C,GREENE E C.DNArepair pathway choices in CRISPR-Cas9mediated genome editing[J].Trends in genetics:TIG,2021,37(7):639–656.DOI:10.1016 / j.tig.2021.02.008.

[0034]

[29] WU Q,SHOU J.Toward precise CRISPR DNAfragment editing andpredictable 3Dgenome engineering[J].Journal of molecular cell biology,2021,12(11):828–856.DOI:10.1093 / jmcb / mjaa060.

[0035]

[30] SHI X,SHOU J,MEHRYAR M M,et al.Cas9 has no exonuclease activityresulting in staggered cleavage with overhangs and predictabledi-and tri-nucleotide CRISPR insertions without template donor[J].Cell discovery,2019,5:53.DOI:10.1038 / s41421-019-0120-z.

[0036]

[31] SHOU J,LI J,LIU Y,et al.Precise and Predictable CRISPRChromosomal Rearrangements Reveal Principles of Cas9-Mediated NucleotideInsertion[J].Molecular cell,2018,71(4):498-509.e4.DOI:10.1016 / j.molcel.2018.06.021.

[0037]

[32] S, MARG A, IGNAK B, et al. Cas9-induced single cut enables highly efficient and template-free repair of a muscular dystrophy causing founder mutation [J]. Molecular therapy. Nucleic acids, 2023, 31: 494–511. DOI: 10.1016 / j.omtn.2023.02.005. Summary of the invention

[0038] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a nuclease and a preparation method and use thereof, so as to solve the problems in the prior art.

[0039] To achieve the above-mentioned object and other related objects, the present invention provides a nuclease, which comprises a polypeptide formed by one or more amino acid mutations of a wild-type Cas9 nuclease at position 766, position 915 or position 916; the amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID No.1

[0040] Preferably, the nuclease comprises a polypeptide formed by amino acid mutations at positions 766 and 915 of a wild-type Cas9 nuclease; or, the nuclease comprises a polypeptide formed by amino acid mutations at positions 766 and 916 of a wild-type Cas9 nuclease.

[0041] The present invention also provides an isolated polynucleotide encoding the aforementioned nuclease.

[0042] The present invention also provides an expression vector, which comprises the aforementioned polynucleotide and a plasmid backbone.

[0043] The present invention also provides a gene editing system, which comprises the aforementioned nuclease, and gRNA or a nucleic acid fragment encoding gRNA; or, comprises the aforementioned polynucleotide, and gRNA or a polynucleotide encoding gRNA; or, comprises the aforementioned expression vector, and gRNA or a polynucleotide encoding gRNA. The present invention also provides a cell, which comprises the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system.

[0044] The present invention also provides a method for preparing the aforementioned nuclease, which comprises: introducing the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system into an engineered cell, inducing the expression of the exogenous gene, and separating and purifying to obtain the nuclease.

[0045] The present invention also provides the use of the aforementioned nuclease, the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system in performing gene editing on a target gene in an in vitro cell or a cell-free environment or in preparing a gene editing tool.

[0046] The present invention also provides an in vitro gene editing method, which comprises: contacting a target gene with the aforementioned gene editing system to achieve editing of the target gene.

[0047] As described above, a nuclease of the present invention and its preparation method and use have the following beneficial effects: compared with the wild-type Cas9 nuclease, the ratio of the protruding break ends and the blunt break ends generated by the nuclease of the present invention when cutting the target genomic DNA fragment is different from that of the wild-type Cas9 nuclease, so that the present invention can achieve more and more accurate single nucleotide insertions. Cutting the DNA double strands with the nuclease of the present invention can produce protruding break ends, and the bases complementary to the protruding break ends can be added by the cell's own repair system in a way of filling and connecting, which can achieve accurate editing of adding specific bases to specific positions of genomic DNA fragments. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is shown that Cas9 in the present invention cuts the DNA double strands under the mediation of two sgRNAs to produce four broken ends, which produce indels under the action of the cell repair system, and "C" is added at the joint.

[0049] Figure 2 It is shown that Cas9 in the present invention cuts the DNA double strand under the mediation of one sgRNA to produce two broken ends, and these broken ends produce indels under the action of the cell repair system, and "T" is added at the joint.

[0050] Figure 3 It shows that the proportion of 1 bp insertion generated when each Cas9 nuclease cuts the genomic DNA fragment under the mediation of sgRNA is counted by detecting the connection of the DNA fragment deletion adapter in the present invention.

[0051] Figure 4 It shows the percentage of 1bpinsertion generated when WT-Cas9, E766A, G915F, and IN Cas9-1 nucleases cut genomic DNA fragments under the mediation of sgRNA by detecting the connection of DNA fragment deletion adapters in the present invention.

[0052] Figure 5 It shows the cutting of the target DNA fragment by the WT-Cas9 nuclease in the present invention.

[0053] Figure 6 It shows the cleavage of the target DNA fragment by the E766A nuclease of the present invention.

[0054] Figure 7 It shows the cleavage of the target DNA fragment by the G915F nuclease of the present invention.

[0055] Figure 8 It shows the cutting of the target DNA fragment by the IN Cas9-1 nuclease in the present invention.

[0056] Fig. 9 It shows the percentage of precise ligation generated when WT-Cas9, E766A, G915F, and IN Cas9-1 nucleases cut genomic DNA fragments under the mediation of sgRNA by detecting the connection of DNA fragment deletion adapters in the present invention.

[0057] Fig.10 It shows that the proportion of 2bp insertion generated when each Cas9 nuclease cuts the genomic DNA fragment under the mediation of sgRNA is counted by detecting the connection of the DNA fragment deletion adapter in the present invention.

[0058] Fig.11 It shows the proportion of 2bpinsertion generated by WT-Cas9, E766A, F916P, and IN Cas9-2 nucleases when cutting genomic DNA fragments under the mediation of sgRNA by detecting the connection of DNA fragment deletion adapters in the present invention.

[0059] Fig.12 It shows the cleavage of the target DNA fragment by the F916P nuclease of the present invention.

[0060] Fig.13 It shows the cutting of the target DNA fragment by the IN Cas9-2 nuclease in the present invention.

[0061] Fig.14 It shows the percentage of precise ligation generated when WT-Cas9, E766A, F916P, and IN Cas9-2 nucleases cut genomic DNA fragments under the mediation of sgRNA by detecting the connection of DNA fragment deletion adapters in the present invention. DETAILED DESCRIPTION

[0062] The present invention provides a nuclease, comprising a polypeptide formed by one or more amino acid mutations of a wild-type Cas9 nuclease at position 766, position 915 or position 916. The amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID No.1.

[0063] In some specific embodiments, the nuclease comprises a polypeptide formed by amino acid mutations at positions 766 and 915 of a wild-type Cas9 nuclease; or, the nuclease comprises a polypeptide formed by amino acid mutations at positions 766 and 916 of a wild-type Cas9 nuclease.

[0064] In some embodiments, the amino acid mutation comprises one or more of the following features:

[0065] I) glutamic acid is mutated to glycine, alanine, valine, leucine, isoleucine, methionine (methionine), proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, lysine, arginine or histidine;

[0066] II) mutation of glycine to glutamic acid, alanine, valine, leucine, isoleucine, methionine (methionine), proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, lysine, arginine or histidine;

[0067] III) Phenylalanine mutations glycine, glutamic acid, alanine, valine, leucine, isoleucine, methionine (methionine), proline, tryptophan, serine, tyrosine, cysteine, asparagine, glutamine, threonine, aspartic acid, lysine, arginine or histidine.

[0068] Furthermore, the amino acid mutation is glutamic acid mutation to alanine; and / or, glycine mutation to phenylalanine; and / or, phenylalanine mutation to proline.

[0069] Furthermore, the amino acid mutation is that the wild-type Cas9 nuclease mutates from glutamate to alanine at position 766; and / or, the wild-type Cas9 nuclease mutates from glycine to phenylalanine at position 915; and / or, the wild-type Cas9 nuclease mutates from phenylalanine to proline at position 916.

[0070] In some specific embodiments, the nuclease comprises a polypeptide having an amino acid sequence as shown in SEQ ID No.3 or SEQ ID No.5.

[0071] The present invention also provides an isolated polynucleotide encoding the aforementioned nuclease.

[0072] In some specific embodiments, the polynucleotide comprises a nucleic acid fragment having a nucleotide sequence such as SEQ ID No.4 or SEQ ID No.6.

[0073] The present invention also provides an expression vector, which comprises the aforementioned polynucleotide and a plasmid backbone.

[0074] In some embodiments, the plasmid backbone comprises an operable element. Specifically, the operable element comprises one or more of a promoter, an enhancer, a terminator, a silencer, a nuclear localization signal, a poly A structure, a reporter gene or a transposon.

[0075] In some specific embodiments, the plasmid backbone is selected from pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-Tag One or more of FP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP / VSV-G, pENTR / U6, pLenti6 / BLOCK-iT-DEST, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, pGCSIL-GFP, pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP, pAAV-Lgr5, pAAV-Sox2, pAAV-Syn or pAAV-CMV.

[0076] The present invention also provides a gene editing system, which comprises the aforementioned nuclease and guide RNA (gRNA) or a nucleic acid fragment encoding guide RNA (gRNA); or, comprises the aforementioned polynucleotide and gRNA or a polynucleotide encoding gRNA; or, comprises the aforementioned expression vector and gRNA or a polynucleotide encoding gRNA.

[0077] The system of the present invention can include one gRNA or multiple gRNAs at the same time. In some embodiments, the system includes multiple gRNAs at the same time to modify different positions on the same target DNA or different target DNAs at the same time. In some embodiments, two or more guide RNAs target the same gene or transcript or locus. In some embodiments, two or more guide RNAs target different unrelated loci. In some embodiments, two or more guide RNAs target different but related loci.

[0078] In the present invention, the polynucleotide or the expression vector can be synthesized by artificial synthesis, such as by chemical synthesis, so that it is easy to carry out a variety of modifications. The modification can be any modification known in the art. In some specific embodiments, the polynucleotide or the expression vector comprises one or more modifications, so that more functions can be easily obtained, such as enhancing transcriptional activity, changing enzyme activity, improving its translation or stability (such as increasing its resistance to proteolysis, degradation) or specificity, changing solubility, changing delivery, reducing the innate immune response in the host cell. The modification can be any modification known in the art. In some specific embodiments, the DNA or RNA encoding the nuclease introduced into the cell by modification is used to edit any one or more genomic loci. The modification can be a single modification, or a combination of modifications.

[0079] In the present invention, the nuclease or the polynucleotide encoding the nuclease is applicable to any biological or in vitro environment, including but not limited to bacteria (such as Escherichia coli, Klebsiella pneumoniae), archaea, fungi, protists, plants or animals. Accordingly, applicable target cells include but are not limited to eukaryotic cells and prokaryotic cells, such as bacterial cells, archaeal cells, fungal cells, protist cells, plant cells or animal cells; the eukaryotic cells include mammalian cells and plant cells, and the prokaryotic cells include Escherichia coli and Klebsiella pneumoniae. Applicable target cells can be any type of cells, including stem cells, somatic cells, etc. The present invention is preferably used for mammalian cells HEK293T cells. The cells can be in vivo or in vitro.

[0080] In the gene editing system of the present invention, the nuclease and gRNA can form a complex in the host cell to recognize the PAM sequence on the targeted gene (such as targeted DNA) sequence; the targeting sequence of the gene editing system is a nucleic acid fragment (such as a DNA fragment) with a length of 20bp before the PAM sequence. In some embodiments, the complex can selectively regulate the transcription of the target DNA in the host cell. The gene editing system can cut the double strand of the targeted DNA, causing DNA breaks.

[0081] In the present invention, nuclease variants can also be formed by modification, mutation, DNA shuffling, etc., so that the nuclease variants have improved desired characteristics, such as function, activity, kinetics, half-life, etc. The modification can be, for example, the deletion, insertion or substitution of amino acids, and another example can be the replacement of the "cleavage domain" of the nuclease with a homologous or heterologous cleavage domain from a different nuclease (e.g., the HNH domain of a CRISPR-associated nuclease); by any modification method of DNA binding and / or DNA modification protein known in the art, such as methylation, demethylation, acetylation, etc., for example, the DNA targeting of the aforementioned nuclease can be changed. The DNA shuffling refers to exchanging sequence fragments between DNA sequences of nucleases from different sources to produce a chimeric DNA sequence encoding a synthetic protein with RNA-guided endonuclease activity. The modification, mutation, DNA shuffling, etc. can be used alone or in combination.

[0082] The present invention also provides a composition comprising one or more of the aforementioned nuclease, the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system. In some specific embodiments, the composition further comprises a pharmaceutically acceptable carrier, medium, etc. The acceptable carrier, medium, such as sterile water or physiological saline, stabilizer, excipient, antioxidant (ascorbic acid, etc.), buffer (phosphoric acid, citric acid, other organic acids, etc.), preservative, surfactant (PEG, Tween, etc.), chelating agent (EDTA, etc.), adhesive, etc. In addition, it may also contain other low molecular weight polypeptides; proteins such as serum albumin, gelatin or immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; sugar alcohols such as mannitol or sorbitol. When preparing an aqueous solution for injection, such as physiological saline, isotonic solution containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, appropriate solubilizers such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), non-ionic surfactants (Tween 80, HCO-50), etc. can be used. In some embodiments, the composition comprises gRNA and a buffer for stabilizing nucleic acids.

[0083] The present invention also provides a cell, which contains the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system.

[0084] In some embodiments, the cell is selected from a prokaryotic cell or a eukaryotic cell. Specifically, the prokaryotic cell can be selected from Escherichia coli, Salmonella typhimurium, Klebsiella pneumoniae, Bacteroides ovale, Campylobacter jejuni, Staphylococcus saprophyticus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgaris, Bacteroides monomorpha, Lactobacillus casei, Bacteroides fragilis, Acinetobacter lwoffii, Fusobacterium nucleatum, Bacteroides johnsii, Bacteroides thaliana, Lactobacillus rhamnosus, Bacteroides massiliense, Parabacteroides feces, Fusobacterium death, Bifidobacterium breve or Listeria; or, the eukaryotic cell can be selected from yeast cells, Streptomyces, Drosophila S2 or Sf9 insect cells, CHO, COS.293 cells, or Bowes melanoma cells.

[0085] The present invention also provides a method for preparing the aforementioned nuclease, which comprises: introducing the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system into an engineered cell, inducing the expression of the exogenous gene, and separating and purifying to obtain the nuclease.

[0086] In some embodiments, the engineered cell is selected from a prokaryotic cell or a eukaryotic cell. Specifically, the prokaryotic cell can be selected from Escherichia coli, Salmonella typhimurium, Klebsiella pneumoniae, Bacteroides ovale, Campylobacter jejuni, Staphylococcus saprophyticus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgaris, Bacteroides monomorpha, Lactobacillus casei, Bacteroides fragilis, Acinetobacter lwoffii, Fusobacterium nucleatum, Bacteroides johnsii, Bacteroides thaliana, Lactobacillus rhamnosus, Bacteroides massiliense, Parabacteroides feces, Fusobacterium death, Bifidobacterium breve or Listeria; or, the eukaryotic cell can be selected from yeast cells, Streptomyces, Drosophila S2 or Sf9 insect cells, CHO, COS.293 cells, or Bowes melanoma cells.

[0087] In some specific embodiments, the introduction method can be selected from one or more of DEAE-dextran-mediated transfection, liposome-mediated transfection, virus or phage infection, lipofection, transfection, conjugation, protoplast fusion, polyethyleneimine-mediated transfection, electroporation, calcium phosphate precipitation, gene gun, calcium phosphate precipitation, microinjection, and nanoparticle-mediated nucleic acid delivery.

[0088] The present invention also provides the use of the aforementioned nuclease, the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system in performing gene editing on a target gene in an in vitro cell or a cell-free environment or in preparing a gene editing tool.

[0089] In some specific embodiments, the in vitro cell is selected from one or more of bacterial cells, archaeal cells, fungal cells, protist cells, viral cells, plant cells and animal cells.

[0090] In some embodiments, the function of gene editing is selected from one or more of gene cutting, gene deletion, gene insertion, point mutation, transcription inhibition or transcription activation. More specifically, the function of gene editing is selected from: cutting the target gene; or, manipulating the expression of the target gene; or, genetically modifying the target gene; or, genetically modifying the target gene-related polypeptide; or, for intentional and controlled damage at any desired position of the target gene; or, for one or more of intentional and controlled repair at any desired position of the target gene.

[0091] In some specific embodiments, the target gene is a target DNA. In some embodiments, the target DNA can be an in vitro naked DNA that is not bound to a DNA-related protein. In some embodiments, the target DNA is a chromosomal DNA in an in vitro cell. In some embodiments, the target gene is a target RNA. In some embodiments, the target DNA is contacted with a targeting complex comprising the aforementioned nuclease and gRNA, and the gRNA provides target specificity for the targeting complex by comprising a nucleotide sequence complementary to the target DNA; the aforementioned nuclease provides site-specific editing activity. In some embodiments, the targeting complex modifies the target DNA, resulting in, for example, DNA cutting, DNA methylation, DNA damage, DNA repair, and the like. In some embodiments, the targeting complex modifies polypeptides associated with the target DNA (e.g., histones, DNA-binding proteins, etc.), resulting in, for example, methylation of target DNA-associated polypeptides-histones, histone acetylation, histone ubiquitination, and the like.

[0092] The present invention also provides a gene editing method for in vivo or in vitro disease diagnosis or treatment purposes or non-disease diagnosis or treatment purposes, wherein the gene editing method is: contacting the target gene with the aforementioned gene editing system to achieve editing of the target gene. The gene editing method for in vitro or non-disease diagnosis or treatment purposes may be a gene editing method for industrial production purposes or a gene editing method for scientific research purposes.

[0093] In some embodiments, the gene editing method comprises the following steps:

[0094] a. introducing the aforementioned nuclease, the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system into an in vitro cell or a cell-free system;

[0095] b. introducing gRNA, also known as sgRNA, or a nucleic acid (e.g., DNA) suitable for in situ production of such gRNA;

[0096] c. contacting a cell or a target gene with the aforementioned nuclease, the aforementioned polynucleotide, the aforementioned expression vector or the aforementioned gene editing system, a gRNA (sgRNA) or a nucleic acid suitable for in situ production of such a gRNA to produce one or more cuts, incisions or edits in the target gene; wherein the nuclease is guided to the target gene by its processed or unprocessed form of the gRNA.

[0097] In some specific embodiments, the gene editing method is to use the aforementioned nuclease to cut the DNA double strands to produce protruding broken ends, and the isolated cells add bases complementary to the protruding broken ends by filling in the gaps to achieve single-site editing of the DNA fragments.

[0098] In some specific embodiments, the gene editing method is a gene editing method for improving the single nucleotide insertion efficiency based on the single nucleotide insertion efficiency of the wild-type Cas9 nuclease.

[0099] In some embodiments, when the aforementioned nuclease cuts the genomic DNA fragment (taking the β-globin site as an example) under the mediation of sgRNA, the protruding broken ends generated are first filled with the base G complementary to the protruding end C through base complementary pairing under the action of the cell repair system, and then connected to the connection adapter (such as Figure 1 shown).

[0100] In some embodiments, when the aforementioned nuclease cuts the genomic DNA fragment (taking the ATN1 site as an example) under the mediation of sgRNA, the protruding broken ends generated are first filled with bases complementary to the protruding ends through base complementary pairing under the action of the cell repair system, and then connected to the connection adapter (such as Figure 2 shown).

[0101] In the present invention, the term "filling and ligation" generally means that the protruding broken ends are first filled into blunt ends by adding bases complementary to the protruding ends through base complementary pairing and then ligated.

[0102] In the present invention, the terms "polynucleotide" and "oligonucleotide" are used interchangeably, and they refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can perform any function known or unknown. Examples of polynucleotides include, but are not limited to, the following: genes or gene fragments (including probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides also include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If there is a modification on the polynucleotide, the modification can be given before or after assembling the polynucleotide. The nucleotide sequence can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by coupling to be labeled with a labeling component. The term refers to both double-stranded and single-stranded polynucleotide molecules. Unless otherwise stated or required, any embodiment of a polynucleotide disclosed herein includes a double-stranded form thereof and any of two complementary single-stranded forms known or predicted to be capable of forming a double-stranded form.

[0103] In the present invention, the terms "peptide", "polypeptide" and "protein" are used interchangeably in the present invention and refer to a polymeric form of amino acids of any length, which may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0104] In the present invention, the term "DNA sequence encoding" a specific RNA is a DNA nucleic acid sequence transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or a DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, or gRNA; also referred to as "non-coding" RNA or "ncRNA"). A "protein coding sequence" or a sequence encoding a specific protein or polypeptide is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo or in vitro under the control of a suitable regulatory sequence.

[0105] In the present invention, the term "target DNA" is a DNA polynucleotide comprising a "target site" or "target sequence". The terms "target site", "target sequence", "target protospacer DNA" or "protospacer-like sequence" are used interchangeably in the present invention to represent a nucleic acid sequence present in the target DNA, to which the DNA-targeting segment of the gRNA will bind if there are sufficient conditions for binding. The RNA molecule contains a sequence that binds, hybridizes or is complementary to the target sequence within the target DNA, thereby targeting the bound polypeptide to a specific position (target sequence) within the target DNA. "Cut" refers to the breakage of the covalent backbone of a DNA molecule.

[0106] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0107] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0108] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0109] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques are well described in the literature, see Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; these series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATINSTRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.

[0110] The information of the nucleotide sequence or amino acid sequence used in this application is as follows:

[0111] SEQ ID No.1

[0112] MAPKKKRKVG IHGVPAAMDK KYSIGLDIGT NSVGWAVITD EYKVPSKKFK VLGNTDRHSI

[0113] KKNLIGALLF DSGETAEATR LKRTARRRYT RRKNRICYLQ EIFSNEMAKV DDSFFHRLEE

[0114] SFLVEEDKKH ERHPIFGNIV DEVAYHEKYP TIYHLRKKLV DSTDKADLRL IYLALAHMIK

[0115] FRGHFLIEGD LNPDNSDVDK LFIQLVQTYN QLFEENPINA SGVDAKAILS ARLSKSRRLE

[0116] NLIAQLPGEK KNGLFGNLIA LSLGLTPNFK SNFDLAEDAK LQLSKDTYDD DLDNLLAQIG

[0117] DQYADLFLAA KNLSDAILLSDILRVNTEIT COVERAGE RYDEHHQDLT LLKALVRQQL

[0118] PEKYKEIFFD QSKNGYAGYIDGGASQEEFY KFIKPILEKM DGTEELLVKL NREDLLRKQR

[0119] TFDNGSIPHQ IHLGELHAIL RRQEDFYPFL KDNREKIEKI LTFRIPYYVG PLARGNSRFA

[0120] WMTRKSEETI TPWNFEEVVD KGASAQSFIE RMTNFDKNLP NEKVLPKHSL LYEYFTVYNE

[0121] LTKVKYVTEG MRKPAFLSGE QKKAIVDLLF KTNRKVTVKQ LKEDYFKKIE CFDSVEISGV

[0122] EDRFNASLGT YHDLLKIIKD KDFLDNEENE DILEDIVLTL TLFEDREMIE ERLKTYAHLF

[0123] DDKVMKQLKR RRYTGWGRLS RKLINGIRDK QSGKTILDFL KSDGFANRNF MQLIHDDSLT

[0124] FKEDIQKAQV SGQGDSLHEH IANLAGSPAI KKGILQTVKV VDELVKVMGR HKPENIVIEM

[0125] <h2 style=";text-align:left;direction:ltr">ARENQTTQKG QKNSRERMKR IEEGIKELGS QILKEHPVEN TQLQNEKLYL YYLQNGRDMY<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0126] <h2 style=";text-align:left;direction:ltr"> VDQELDINRL SDYDVDHIVP QSFLKDDSID NKVLTRSDKN RGKSDNVPSE EVVKKMKNYW<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0127] <h2 style=";text-align:left;direction:ltr"> RQLLNAKLIT QRKFDNLTKA ERGGLSELDK AGFIKRQLVE TRQITKHVAQ ILDSRMNTKY<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0128] <h2 style=";text-align:left;direction:ltr"> DENDKLIREV KVITLKSKLV SDFRKDFQFY KVREINNYHH AHDAYLNAVV GTALIKKYPK<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0129] <h2 style=";text-align:left;direction:ltr"> LESEFVYGDY KVYDVRKMIA KSEQEIGKAT AKYFFYSNIM NFFKTEITLA NGEIRKRPLI<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0130] <h2 style=";text-align:left;direction:ltr"> ETNGETGEIV WDKGRDFATV RKVLSMPQVN IVKKTEVQTG GFSKESILPK RNSDKLIARK<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0131] <h2 style=";text-align:left;direction:ltr"> KDWDPKKYGG FDSPTVAYSV LVVAKVEKGK SKKLKSVKEL LGITIMERSS FEKNPIDFLE<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0132] <h2 style=";text-align:left;direction:ltr"> AKGYKEVKKD LIIKLPKYSL FELENGRKRM LASAGELQKG NELALPSKYV NFLYLASHYE<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0133] <h2 style=";text-align:left;direction:ltr"> KLKGSPEDNE QKQLFVEQHK HYLDEIIEQI SEFSKRVILA DANLDKVLSA YNKHRDKPIR<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0134] <h2 style=";text-align:left;direction:ltr"> EQAENIIHLF TLTNLGAPAA FKYFDTTIDR KRYTSTKEVL DATLIHQSIT GLYETRIDLS<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0135] <h2 style=";text-align:left;direction:ltr"> QLGGDKRPAA TKKAGQAKKKK<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0136] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.2<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0137] atggccccaa agaagaagcg gaaggtcggt atccacggtg tcccagcagc catggacaag

[0138] aagtactcca ttgggctcga tatcggcaca aacagcgtcg gctggggccgt cattacggac

[0139] gagtacaagg tgccgagca aaaattcaa gttctgggca ataccgatcg ccacaccata

[0140] aagagaacc tcattggcgc cctcctgttc gactccgggg agacggccga agccacggcgg

[0141] ctcaaagaa cagcacggcg cagatatacc cgcagaaaga atcggatctg ctacctgcag

[0142] gagatcttta gtaatgagat gctaaggtg gatgactt tctccatag gctggaggag

[0143] tccttttttgg tggagga taaaaagcac gagcgccacc caatctttgg caatcgtg

[0144] gacgaggtgg cgtaccatga aaagtaccca accatatatc atctgaggaa gaagcttgta

[0145] gagagtactg ataggctga cttgcggttg atctatctcg cgctggcgca tatgatcaa

[0146] tttcggggac acttcctcat cgagggggac ctgaacccag acacagcga tgtcgacaa

[0147] ctctttatcc aactggttca gacttacaat cagctttcg agagaaccc gatcaacgca

[0148] tccggagttg acgccaaagc aatcctgagc gctaggctgt ccaaatcccg gcggctcgaa

[0149] aacctcatcg cacagctccc tggggagaag aagaacggcc tgtttggtaa tcttatcgcc

[0150] ctgtcactcg ggctgacccc caactttaaa tctaacttcg acctggccga agatgccaag

[0151] cttcaactga gcaaagacac ctacgatgat gatctcgaca atctgctggc ccagatcggc

[0152] gaccagtacg cagacctttt tttggcggca aagaacctgt cagacgccat tctgctgagt

[0153] gatattctgc gagtgaacac ggagatcacc aaagctccgc tgagcgctag tatgatcaag

[0154] cgctatgatg agcaccacca agacttgact ttgctgaagg cccttgtcag acagcaactg

[0155] cctgagaagt acaaggaaat tttcttcgat cagtctaaaa atggctacgc cggatacatt

[0156] gacggcggag caagccagga ggaattttac aaatttatta agcccatctt ggaaaaaatg

[0157] gacggcaccg aggagctgct ggtaaagctt aacagagaag atctgttgcg caaacagcgc

[0158] actttcgaca atggaagcat cccccaccag attcacctgg gcgaactgca cgctatactc

[0159] aggcggcaag aggatttcta cccctttttg aaagataaca gggaaaagat tgagaaaatc

[0160] ctcacatttc ggatacccta ctatgtaggc cccctcgccc ggggaaattc cagattcgcg

[0161] tggatgactc gcaaatcaga agagaccatc actccctgga acttcgagga agtcgtggat

[0162] aagggggcct ctgcccagtc cttcatcgaa aggatgacta actttgataa aaatctgcct

[0163] aacgaaaagg tgcttcctaa acactctctg ctgtacgagt acttcacagt ttataacgag

[0164] ctcaccaagg tcaaatacgt cacagaaggg atgagaaagc cagcattcct gtctggagag

[0165] cagaagaaag ctatcgtgga cctcctcttc aagacgaacc ggaaagttac cgtgaaacag

[0166] ctcaaagaag actatttcaa aaagattgaa tgtttcgact ctgttgaaat cagcggagtg

[0167] gaggatcgct tcaacgcatc cctgggaacg tatcacgatc tcctgaaaat cattaaagac

[0168] aaggacttcc tggacaatga ggagaacgag gacattcttg aggacattgt cctcaccctt

[0169] acgttgtttg aagataggga gatgattgaa gaacgcttga aaacttacgc tcatctcttc

[0170] gacgacaaag tcatgaaaca gctcaagagg cgccgatata caggatgggg gcggctgtca

[0171] agaaaactga tcaatgggat ccgagacaag cagagtgga agacaatcct ggattttctt

[0172] aagtccgatg gatttgccaa ccggaacttc atgcagttga tccatgatga ctctctcacc

[0173] tttaaggagg acatccagaa agcacaagtt tctggccagg gggacagtct tcacgagcac

[0174] atcgctaatc ttgcaggtag cccagctatc aaaaaggga tactgcagac cgttaaggtc

[0175] gtggatgaac tcgtcaaagt aatgggaagg cataagcccg agaatcgt tatcgagatg

[0176] gcccgagaga accaaactac ccagaaggga cagaagaca gtagggaag gatgaagagg

[0177] attgaagagg gtataaaaga actggggtcc caaatcctta aggaacaccc agttgaaaac

[0178] acccagcttc agaatgagaa gctctacctg tactacctgc aagaacggcag ggacatgtac

[0179] gtggatcagg aactggacat caatcggctc tccgactacg acgtggatca tatcgtgccc

[0180] cagtcttttc tcaaagatga ttctattgat aataaagtgt tgacaagatc cgataaaaat

[0181] agagggaaga gtgataacgt cccctcagaa gaagttgtca agaaaatgaa aaattattgg

[0182] cggcagctgc tgaacgccaa actgatcaca caacggaagt tcgataatct gactaaggct

[0183] gaacgaggtg gcctgtctga gttggataaa gcaggcttca tcaaaaggca gcttgttgag

[0184] acacgccaga tcaccaagca cgtggcccaa attctcgatt cacgcatgaa caccaagtac

[0185] gatgaaaatg acaaactgat tcgagaggtg aaagttatta ctctgaagtc taagctggtc

[0186] tcagatttca gaaaggactt tcagttttat aaggtgagag agatcaacaa ttaccaccat

[0187] gcgcatgatg cctacctgaa tgcagtggta ggcactgcac ttatcaaaaa atatcccaag

[0188] cttgaatctg aatttgttta cggagactat aaagtgtacg atgttaggaa aatgatcgca

[0189] aagtctgagc aggaaatagg caaggccacc gctaagtact tcttttacag caatattatg

[0190] aattttttca agaccgagat tacactggcc aatggagaga ttcggaagcg accacttatc

[0191] gaaacaaacg gagaaacagg agaaatcgtg tgggacaagg gtagggattt cgcgacagtc

[0192] cggaaggtcc tgtccatgcc gcaggtgaac atcgttaaaa agaccgaagt acagaccgga

[0193] ggcttcca aggaaagtat cctcccgaaa aggaacagcg acaagctgat cgcacgcaaa

[0194] aaagattggg accccaagaa atacggcgga ttcgattctc ctacagtcgc ttacagtgta

[0195] ctggttgtgg ccaaagtgga gaaagggaag tctaaaaaac tcaaaagcgt caaggaactg

[0196] ctgggcatca caatcatgga gcgatcaagc ttcgaaaaaa accccatcga cttctcgag

[0197] gcgaaaggat ataaagaggt caaaaaagac ctcatcatta agcttcccaa gtactctctc

[0198] tttgagcttg aaaacggccg gaaacgaatg ctcgctagtg cgggcgagct gcagaaaggt

[0199] aacgagctgg cactgccctc taaatacgtt aatttctttgt atctggccag ccactatgaa

[0200] aagctcaaag ggtctcccga agataatgag cagaagcagc tgttcgtgga acaacacaaa

[0201] cactaccttg atgagatcat cgagcaaata agcgaattct ccaaaagagt gatcctcgcc

[0202] gacgctaacc tcgataaggt gctttctgct tacaataagc acagggataa gcccatcagg

[0203] gagcaggcag aaaacattat ccacttgttt actctgacca acttgggcgc gcctgcagcc

[0204] ttcaagtact tcgacaccac catagacaga aagcggtaca cctctacaaa ggaggtcctg

[0205] gacgccacac tgattcatca gtcaattacg gggctctatg aaacaagaat cgacctctct

[0206] cagctcggtg gagacaagcg tcctgctgct actaagaaag ctggtcaagc taagaaaaagaataa

[0207] SEQ ID No.3

[0208] MAPKKKRKVG IHGVPAAMDK KYSIGLDIGT NSVGWAVITD EYKVPSKKFK VLGNTDRHSI

[0209] KKNLIGALLF DSGETEATR LKRTARRRRYT RRKNRICYLQ EIFSNEMAKV DDSFFHRLEE

[0210] SFLVEEDKKH ERHPIFGNIV DEVAYHEKYP TIYHLRKKLV DSTDKADLRL IYLALAHMIK

[0211] FRGHFLIEGD LNPDNSDVDK LFIQLVQTYN QLFEENPINA SGVDAKAILS ARLSKSRRLE

[0212] NLIAQLPGEK KNGLFGNLIA LSLGLTPNFK SNFDLAEDAK LQLSKDTYDD DLDNLLAQIG

[0213] DQYADLFLAA KNLSDAILLS DILRVNTEIT KAPLSASMIK RYDEHHQDLT LLKALVRQQL

[0214] PEKYKEIFFD QSKNGYAGYI DGGASQEEFY KFIKPILEKM DGTEELLVKL NREDLLRKQR

[0215] TFDNGSIPHQ IHLGELHAIL RRQEDFYPFL KDNREKIEKI LTFRIPYYVG PLARGNSRFA

[0216] WMTRKSEETI TPWNFEEVVD KGASAQSFIE RMTNFDKNLP NEKVLPKHSL LYEYFTVYNE

[0217] LTKVKYVTEG MRKPAFLSGE QKKAIVDLLF KTNRKVTVKQ LKEDYFKKIE CFDSVEISGV

[0218] EDRFNASLGT YHDLLKIIKD KDFLDNEENE DILEDIVLTL TLFEDREMIE ERLKTYAHLF

[0219] DDKVMKQLKR RRYTGWGRLS RKLINGIRDK QSGKTILDFL KSDGFANRNF MQLIHDDSLT

[0220] FKEDIQKAQV SGQGDSLHEH IANLAGSPAI KKGILQTVKV VDELVKVMGR HKPENIVIEM

[0221] ARANQTTQKG QKNSRERMKR IEEGIKELGS QILKEHPVEN TQLQNEKLYL YYLQNGRDMY

[0222] VDQELDINRL SDYDVDHIVP QSFLKDDSID NKVLTRSDKN RGKSDNVPSE EVVKKMKNYW

[0223] RQLLNAKLIT QRKFDNLTKA ERGGLSELDK AFFIKRQLVE TRQITKHVAQ ILDSRMNTKY

[0224] DENDKLIREV KVITLKSKLV SDFRKDFQFY KVREINNYHH AHDAYLNAVV GTALIKKYPK

[0225] LESEFVYGDY KVYDVRKMIA KSEQEIGKAT AKYFFYSNIM NFFKTEITLA NGEIRKRPLI

[0226] ETNGETGEIV WDKGRDFATV RKVLSMPQVN IVKKTEVQTG GFSKESILPK RNSDKLIARK

[0227] KDWDPKKYGG FDSPTVAYSV LVVAKVEKGK SKKLKSVKEL LGITIMERSS FEKNPIDFLE

[0228] AKGYKEVKD LIIKLPKYSL FELENGRKRM LASAGELQKG NELALPSKYV NFLYLASHYE

[0229] KLKGSPEDNE QKQLFVEQHK HYLDEIIEQI SEFSKRVILA DANLDKVLSA YNKHRDKPIR

[0230] EQAENIIHLF TLTNLGAPAA FKYFDTTIDR CRYTSTKEVL DATLIHQSIT GLYETRIDLS

[0231] QLGGDKRPAA TKKAGQAKKKK

[0232] SEQ ID No.4

[0233] atggccccaa agaagaagcg gaaggtcggt atccacggtg tcccagcagc catggacaag

[0234] aagtactcca ttgggctcga tatcggcaca aacagcgtcg gctgggccgt cattacggac

[0235] gagtacaagg tgccgagcaa aaaattcaaa gttctgggca ataccgatcg ccacagcata

[0236] aagaagaacc tcattggcgc cctcctgttc gactccgggg agacggccga agccacgcgg

[0237] ctcaaaagaa cagcacggcg cagatatacc cgcagaaaga atcggatctg ctacctgcag

[0238] gagatcttta gtaatgagat ggctaaggtg gatgactctt tcttccatag gctggaggag

[0239] tcctttttgg tggaggagga taaaaagcac gagcgccacc caatctttgg caatatcgtg

[0240] gacgaggtgg cgtaccatga aaagtaccca accatatatc atctgaggaa gaagcttgta

[0241] gacagtactg ataaggctga cttgcggttg atctatctcg cgctggcgca tatgatcaaa

[0242] tttcggggac acttcctcat cgagggggac ctgaacccag acaacagcga tgtcgacaaa

[0243] ctctttatcc aactggttca gacttacaat cagcttttcg aagagaaccc gatcaacgca

[0244] tccggagttg acgccaaagc aatcctgagc gctaggctgt ccaaatcccg gcggctcgaa

[0245] aacctcatcg cacagctccc tggggagaag aagaacggcc tgtttggtaa tcttatcgcc

[0246] ctgtcactcg ggctgacccc caactttaaa tctaacttcg acctggccga agatgccaag

[0247] cttcaactga gcaaagacac ctacgatgat gatctcgaca atctgctggc ccagatcggc

[0248] gaccagtacg cagacctttt tttggcggca aagaacctgt cagacgccat tctgctgagt

[0249] gatattctgc gagtgaacac ggagatcacc aaagctccgc tgagcgctag tatgatcaag

[0250] cgctatgatg agcaccacca agacttgact ttgctgaagg cccttgtcag agcactg

[0251] cctgagaagt acaaggaat tttcttcgat cagtctaaaa atggctacgc cggatacatt

[0252] gacggcggag caagccagga ggaattttac aaatttatta agcccatctt ggaaaaaatg

[0253] gacggcaccg aggagctgct ggtaaagctt aacagagaag atctgttgcg caaacagcgc

[0254] actttcgaca atggaagcat cccccaccag attcacctgg gcgaactgca cgctatactc

[0255] aggcggcaag aggatttcta cccctttttg aaagataaca gggaaaagat tgagaaaatc

[0256] ctcacatttc ggatacccta ctatgtaggc cccctcgccc ggggaattc cagattcgcg

[0257] tggatgactc gcaaatcaga agagaccatc actccctgga acttcgagga agtcgtggat

[0258] aagggggcct ctgcccagtc cttcatcga aggatgacta actttgata aaatctgcct

[0259] aacgaaaagg tgcttcctaa acactctctg ctgtacgagt acttcacagt ttataacgag

[0260] ctcaccaagg tcaaatacgt cacagaaggg atgagaaagc cagcattcct gtctggagag

[0261] cagaagaaag ctatcgtgga cctcctcttc aagacgaacc ggaaagttac cgtgaaacag

[0262] ctcaaagaag actatttcaa aaagattgaa tgtttcgact ctgttgaaat cagcggagtg

[0263] gaggatcgct tcaacgcatc cctgggaacg tatcacgatc tcctgaaaat cattaaagac

[0264] aaggacttcc tggacaatga ggagaacgag gacattcttg aggacattgt cctcaccctt

[0265] acgttgtttg aagataggga gatgattgaa gaacgcttga aaacttacgc tcatctcttc

[0266] gacgacaaag tcatgaaaca gctcaagagg cgccgatata caggatgggg gcggctgtca

[0267] agaaaactga tcaatgggat ccgagacaag cagagtggaa agacaatcct ggattttctt

[0268] aagtccgatg gatttgccaa ccggaacttc atgcagttga tccatgatga ctctctcacc

[0269] tttaaggagg acatccagaa agcacaagtt tctggccagg gggacagtct tcacgagcac

[0270] atcgctaatc ttgcaggtag cccagctatc aaaaaggga tactgcagac cgttaaggtc

[0271] gtggatgaac tcgtcaaagt aatgggaagg cataagcccg agaatcgt tatcgagatg

[0272] gcccgagcca accaaactac ccagaagga cagaagaca gtagggaag gatgaagagg

[0273] attgaagagg gtataaaaga actggggtcc caaatcctta aggaacaccc agttgaaaac

[0274] acccagcttc agaatgagaa gctctacctg tactacctgc aagaacggcag ggacatgtac

[0275] gtggatcagg aactggacat caatcggctc tccgactacg acgtggatca tatcgtgccc

[0276] cagtcttttc tcaaagatga ttctattgat aataaagtgt tgacaagatc cgataaaaat

[0277] agggaga gtgataacgt cccctcagaa gaagttgtca agaaaatgaa aaattattgg

[0278] cggcagctgc tgaacgccaa actgatcaca caacggaagt tcgataatct gactaaggct

[0279] gaacgaggtg gcctgtctga gttggataaa gcattcttca tcaaaaggca gcttgttgag

[0280] acacgccaga tcaccagca cgtggccca attctcgatt cacgcatga caccc

[0281] gatgaaaatg acaactgat tcgagaggtg aaagttatta ctctgaagtc taagctggtc

[0282] tcagatttca gaaggactt tcagttttat aaggtgagag agatcaacaa ttaccaccat

[0283] gcgcatgatg cctacctgaa tgcagtggta ggcactgcac ttatcaaaaa atatcccaag

[0284] cttgaatctg aatttgttta cggagactat aaagtgtacg atgttaggaa aatgatcgca

[0285] aagtctgagc aggaaatagg caaggccacc gctaagtact tcttttacag caatattatg

[0286] aattttttca agaccgagat tacactggcc aatggagaga ttcggaagcg accacttatc

[0287] gaacaaacg gagaacagg agaaatcgtg tgggacaagg gtagggattt cgcgacagtc

[0288] cggaaggtcc tgtccatgcc gcaggtgaac atcgttaaaa agaccgaagt agaccgga

[0289] ggcttctcca aggaagtat cctcccgaaa aggaacagcg acaagctgat cgcacgcaaa

[0290] aaagattggg accccaagaa atacggcgga ttcgattctc ctacagtcgc ttacagtgta

[0291] ctggttgtgg ccaaagtgga gaagggaag tctaaaaaac tcaaaagcgt caaggaactg

[0292] ctgggcatca caatcatgga gcgatcaagc ttcgaaaaaa accccatcga cttctcgag

[0293] gcgaaaggat ataaagaggt caaaaaagac ctcatcatta agcttcccaa gtactctctc

[0294] tttgagcttg aaaacggccg gaaacgaatg ctcgctagtg cgggcgagct gcagaaaggt

[0295] aacgagctgg cactgccctc taaatacgtt aatttctttgt atctggccag ccactatgaa

[0296] aagctcaaag ggtctcccga agataatgag cagaagcagc tgttcgtgga acaacacaaa

[0297] cactaccttg atgagatcat cgagcaaata agcgaattct ccaaaagagt gatcctcgcc

[0298] gacgctaacc tcgataaggt gctttctgct tacaataagc acagggataa gcccatcagg

[0299] gagcaggcag aaacattat ccacttgttt actctgacca acttgggcgc gcctgcagcc

[0300] ttcaagtact tcgacaccac catagacaga aagcggtaca cctctacaaa ggaggtcctg

[0301] gacgccacac tgattcatca gtcaattacg gggctctatg aaacaagaat cgacctctct

[0302] cagctcggtg gagacaagcg tcctgctgct actaagaaag ctggtcaagc taagaaaaagaaataa

[0303] SEQ ID No.5

[0304] MAPKKKRKVG IHGVPAAMDK KYSIGLDIGT NSVGWAVITD EYKVPSKKFK VLGNTDRHSI

[0305] KKNLIGALLF DSGETAEATR LKRTARRRYT RRKNRICYLQ EIFSNEMAKV DDSFFHRLEE

[0306] SFLVEEDKKH ERHPIFGNIV DEVAYHEKYP TIYHLRKKLV DSTDKADLRL IYLALAHMIK

[0307] FRGHFLIEGD LNPDNSDVDK LFIQLVQTYN QLFEENPINA SGVDAKAILS ARLSKSRRLE

[0308] NLIAQLPGEK KNGLFGNLIA LSLGLTPNFK SNFDLAEDAK LQLSKDTYDD DLDNLLAQIG

[0309] DQYADLFLAA KNLSDAILLS DILRVNTEIT KAPLSASMIK RYDEHHQDLT LLKALVRQQL

[0310] PEKYKEIFFD QSKNGYAGYI DGGASQEEFY KFIKPILEKM DGTEELLVKL NREDLLRKQR

[0311] TFDNGSIPHQ IHLGELHAIL RRQEDFYPFL KDNREKIEKI LTFRIPYYVG PLARGNSRFA

[0312] WMTRKSEETI TPWNFEEVVD KGASAQSFIE RMTNFDKNLP NEKVLPKHSL LYEYFTVYNE

[0313] LTKVKYVTEG MRKPAFLSGE QKKAIVDLLF KTNRKVTVKQ LKEDYFKKIE CFDSVEISGV

[0314] EDRFNASLGT YHDLLKIIKD KDFLDNEENE DILEDIVLTL TLFEDREMIE ERLKTYAHLF

[0315] DDKVMKQLKR RRYTGWGRLS RKLINGIRDK QSGKTILDFL KSDGFANRNF MQLIHDDSLT

[0316] FKEDIQKAQV SGQGDSLHEH IANLAGSPAI KKGILQTVKV VDELVKVMGR HKPENIVIEM

[0317] ARANQTTQKG QKNSRERMKR IEEGIKELGS QILKEHPVEN TQLQNEKLYL YYLQNGRDMY

[0318] VDQELDINRL SDYDVDHIVP QSFLKDDSID NKVLTRSDKN RGKSDNVPSE EVVKKMKNYW

[0319] RQLLNAKLIT QRKFDNLTKA ERGGLSELDK AGPIKRQLVE TRQITKHVAQ ILDSRMNTKY

[0320] DENDKLIREV KVITLKSKLV SDFRKDFQFY KVREINNYHH AHDAYLNAVV GTALIKKYPK

[0321] LESEFVYGDY KVYDVRKMIA KSEQEIGKAT AKYFFYSNIM NFFKTEITLA NGEIRKRPLI

[0322] ETNGETGEIV WDKGRDFATV RKVLSMPQVN IVKKTEVQTG GFSKESILPK RNSDKLIARK

[0323] KDWDPKKYGG FDSPTVAYSV LVVAKVEKGK SKKLKSVKEL LGITIMERSS FEKNPIDFLE

[0324] AKGYKEVKKD LIIKLPKYSL FELENGRKRM LASAGELQKG NELALPSKYV NFLYLASHYE

[0325] KLKGSPEDNE QKQLFVEQHK HYLDEIIEQI SEFSKRVILA DANLDKVLSA YNKHRDKPIR

[0326] EQAENIIHLF TLTNLGAPAA FKYFDTTTIDR KRYTSTKEVL DATLIHQSIT GLYETRIDLS

[0327] QLGGDKRPAA TKKAGQAKKKK

[0328] SEQ ID No.6

[0329] atggccccaa agaagaagcg gaaggtcggt atccacggtg tcccagcagc catggacaag

[0330] aagtactcca ttgggctcga tatcggcaca aacagcgtcg gctggggccgt cattacggac

[0331] gagtacaagg tgccgagca aaaattcaa gttctgggca ataccgatcg ccacaccata

[0332] aagagaacc tcattggcgc cctcctgttc gactccgggg agacggccga agccacggcgg

[0333] ctcaaagaa cagcacggcg cagatatacc cgcagaaaga atcggatctg ctacctgcag

[0334] gagatcttta gtaatgagat gctaaggtg gatgactt tctccatag gctggaggag

[0335] tccttttttgg tggagga taaaaagcac gagcgccacc caatctttgg caatcgtg

[0336] gacgaggtgg cgtaccatga aaagtaccca accatatatc atctgaggaa gaagcttgta

[0337] gacagtactg ataaggctga cttgcggttg atctatctcg cgctggcgca tatgatcaaa

[0338] tttcggggac acttcctcat cgaggggac ctgaacccag aaacagcga tgtcgacaaa

[0339] ctctttatcc aactggttca gacttacaat cagcttttcg aagagaaccc gatcaacgca

[0340] tccggagttg acgccaaagc aatcctgagc gctaggctgt ccaaatcccg gcggctcgaa

[0341] aacctcatcg cacagctccc tggggagaag aagaacggcc tgtttggtaa tcttatcgcc

[0342] ctgtcactcg ggctgacccc caactttaaa tctaacttcg acctggccga agatgccaag

[0343] cttcaactga gcaaagacac ctacgatgat gatctcgaca atctgctggc ccagatcggc

[0344] gaccagtacg cagacctttt tttggcggca aagaacctgt cagacgccat tctgctgagt

[0345] gatatctgc gagtgaacac ggagatcacc aaagctccgc tgagcgctag tatgatcaag

[0346] cgctatgatg agcaccacca agacttgact ttgctgaagg cccttgtcag acagcaactg

[0347] cctgagaagt acaaggaaat tttcttcgat cagtctaaaa atggctacgc cggatacatt

[0348] gacggcggag caagccagga ggaattttac aaatttatta agcccatctt ggaaaaaatg

[0349] gacggcaccg aggagctgct ggtaaagctt aacagagaag atctgttgcg caaacagcgc

[0350] actttcgaca atggaagcat cccccaccag attcacctgg gcgaactgca cgctatactc

[0351] aggcggcaag aggatttcta cccctttttg aaagataaca gggaaaagat tgagaaaatc

[0352] ctcacatttc ggatacccta ctatgtaggc cccctcgccc ggggaattc cagattcgcg

[0353] tggatgactc gcaaatcaga agagaccatc actccctgga acttcgagga agtcgtggat

[0354] aagggggcct ctgcccagtc cttcatcga aggatgacta actttgata aaatctgcct

[0355] aacgaaaagg tgcttcctaa acactctctg ctgtacgagt acttcacagt tttaacgag

[0356] ctcaccaagg tcaatacgt cacagaaggg atgagaaagc cagcattcct gtctggagag

[0357] cagaagaaag ctatcgtgga cctcctcttc aagacgaacc ggaaagttac cgtgaaacag

[0358] ctcaaagaag actatttcaa aaagattgaa tgtttcgact ctgttgaaat cagcggagtg

[0359] gaggatcgct tcacgcatc cctgggaacg tatcacgatc tcctgaaaat cattaagac

[0360] aaggacttcc tggacaatga ggagaacgag gatacttg aggacattgt cctcaccct

[0361] acgttgtttg aagataggga gatgattgaa gaacgcttga aaacttacgc tcatctcttc

[0362] gacgacaag tcatgaaca gctcaagagg cgccgatata caggatgggg gcggctgtca

[0363] agaaaactga tcaatgggat ccgagacaag cagagtgga agacaatcct ggattctt

[0364] aagtccgatg gatttgccaa ccggaacttc atgcagttga tccatgatga ctctctcacc

[0365] tttaaggagg acatccagaa agcacaagtt tctggccagg gggacagtct tcacgagcac

[0366] atcgctaatc ttgcaggtag cccagctatc aaaaagggaa tactgcagac cgttaaggtc

[0367] gtggatgaac tcgtcaagt aatgggaagg cataagcccg agaatacgt tatcgagatg

[0368] gcccgagcca accaaactac ccagaaggga cagagaaca gtagggaag gatgagagg

[0369] attgaagagg gtataaaaga actggggtcc caatcctta aggacaccc agttgaaac

[0370] acccagcttc agaatgagaa gctctacctg tactacctgc aagaacggcag ggacatgtac

[0371] gtggatcagg aactggacat caatcggctc tccgactacg acgtggatca tatcgtgccc

[0372] cagtcttttc tcaaagatga ttctattgat aataaagtgt tgacaagatc cgataaaaat

[0373] agggaga gtgataacgt cccctcagaa gaagttgtca agaaaatgaa aaattattgg

[0374] cggcagctgc tgaacgccaa actgatcaca caacggaagt tcgataatct gactaaggct

[0375] gacgaggtg gcctgtctga gttggataaa gcaggcccca tcaaaaggca gcttgttgag

[0376] acacgccaga tcaccagca cgtggccca attctcgatt cacgcatga caccc

[0377] gatgaaaatg acaaactgat tcgagaggtg aaagttatta ctctgaagtc taagctggtc

[0378] tcagatttca gaaaggactt tcagttttat aaggtgagag agatcaacaa ttaccaccat

[0379] gcgcatgatg cctacctgaa tgcagtggta ggcactgcac ttatcaaaaa atatcccaag

[0380] cttgaatctg aatttgttta cggagactat aaagtgtacg atgttaggaa aatgatcgca

[0381] aagtctgagc aggaaatagg caaggccacc gctaagtact tcttttacag caatattatg

[0382] aattttttca agaccgagat tacactggcc aatggagaga ttcggaagcg accacttatc

[0383] gaacaaacg gagaacagg agaaatcgtg tgggacaagg gtagggattt cgcgacagtc

[0384] cggaaggtcc tgtccatgcc gcaggtgaac atcgttaaaa agaccgaagt agaccgga

[0385] ggcttctcca aggaagtat cctcccgaaa aggaacagcg acaagctgat cgcacgcaaa

[0386] aaagattggg accccaagaa atacggcgga ttcgattctc ctacagtcgc ttacagtgta

[0387] ctggttgtgg ccaaagtgga gaagggaag tctaaaaaac tcaaaagcgt caaggaactg

[0388] ctgggcatca caatcatgga gcgatcaagc ttcgaaaaaa accccatcga ctttctcgag

[0389] gcgaaaggat ataaagaggt caaaaaagac ctcatcatta agcttcccaa gtactctctc

[0390] tttgagcttg aaaacggccg gaacgaatg ctcgctagtg cgggcgagct gcagaaaggt

[0391] aacgagctgg cactgccctc taaatacgtt aatttcttgt atctggccag ccactatgaa

[0392] aagctcaaag ggtctcccga agataatgag cagaagcagc tgttcgtgga acaacacaaa

[0393] cactaccttg atgagatcat cgagcaaata agcgaattct ccaaaagagt gatcctcgcc

[0394] gacgctaacc tcgataaggt gctttctgct tacaataagc acagggataa gcccatcagg

[0395] gagcaggcag aaaacattat ccacttgttt actctgacca acttgggcgc gcctgcagcc

[0396] ttcaagtact tcgacaccac catagacaga aagcggtaca cctctacaaa ggaggtcctg

[0397] gacgccacac tgattcatca gtcaattacg gggctctatg aaacaagaat cgacctctct

[0398] cagctcggtg gagacaagcg tcctgctgct actaagaaag ctggtcaagc taagaaaaagaaataa

[0399] Example 1 Identification of the cleavage pattern of nuclease IN Cas9-1

[0400] 1. Construction of Cas9 mutants

[0401] Cas9 mutagenesis primers:

[0402] IN Cas9-1-F: GATGGCCCGAGCCAACCAAACTAC (SEQ ID NO.7);

[0403] IN Cas9-1-R: TCGATAACGATATTCTCGG (SEQ ID NO.8);

[0404] 1) Use the NEB mutation kit (Q5 Site-Directed Mutagenesis Kit, #E0554S) to construct a Cas9 mutant. First, use the Cas9 mutant G915F as a template for PCR amplification. The reaction is as follows:

[0405]

[0406] Reaction conditions: 98°C, 30 sec;

[0407] 98℃,10sec

[0408] 60℃,20sec

[0409] 72℃,6.5min

[0410] 25 cycles;

[0411] 72℃, 3min;

[0412] 2) KLD (Kinase, Ligase & DpnI) treatment, the reaction is as follows:

[0413]

[0414]

[0415] Reaction conditions: room temperature for 10 minutes

[0416] 3) All the reaction products in 2) were used to transform competent bacteria Stbl3, and cultured overnight on LB plates containing ampicillin (Amp, 100 mg / L) at 37° C. Single clones were picked, and the plasmids were extracted and sent for sequencing, wherein the correct nucleotide sequence of nuclease INCas9-1 is shown in SEQ ID No. 4.

[0417] In addition, SpCas9 was randomly mutated according to the above construction method to obtain mutants E766A+R780A, INCas9-2, E766A+△F916, E766A+R919P, E766A+Q920P, E766A+R976A, G915F+F916P, G915F+△F916, G915F+R919P, G915F+Q 920P, G915F+R976A, F916P+R919P, F916P+Q920P, F916P+R976A, △F916+R919P, △F916+Q920P, △F916+R976A, R919P+Q920P, R919P+R976A, Q920P-R976A were used as controls, and the sequences of these control mutants were all different from those of the IN Cas9-1 of the present invention.

[0418] 2. Cas9 nuclease mutants for DNA editing

[0419] (1) Construct sgRNAs targeting β-globin.

[0420] The sgRNAs target sequences:

[0421] β-globin sgRNA1:ATTGTTGTTGCCTTGGAGTG (SEQ ID NO.9);

[0422] β-globin sgRNA2: CTGGTCCCCTGGTAACCTGG (SEQ ID NO. 10);

[0423] The sgRNAs targeting sequences for β-globin were purchased from Sangon Biotech (Shanghai) Co., Ltd., with forward and reverse deoxy oligonucleotides with 5' overhang ends "ACCG" and "AAAC" that can complement each other.

[0424] (2) Obtaining complementary double-stranded DNA with hanging ends

[0425] 1) Dissolve the oligonucleotide to 100 μM in ddH2O and dilute to 20 μM;

[0426] 2) Add forward and reverse deoxy oligonucleotides to the following reaction system:

[0427]

[0428] Reaction conditions: 95℃ water bath for 5min, then open the lid of the water bath to lower the temperature to about 60℃, cover with lid and cool to room temperature.

[0429] (3) Enzyme digestion of pGL3-U6-sgRNA-PGK-Puro vector

[0430] 1) The vector plasmid was digested with BsaI restriction endonuclease, and the reaction system was as follows:

[0431]

[0432] Reaction conditions: 37°C, 1.5 hours;

[0433] 2) Gel recovery and purification of DNA fragments according to the instructions of the gel recovery kit (Axygen).

[0434] (4) Ligation of the digested vector and the double-stranded DNA with hanging ends

[0435] The connection system is as follows:

[0436]

[0437] Reaction conditions: room temperature for 1.5 hours;

[0438] (5) Transformation of ligation products

[0439] The ligation product was transformed with Stbl3 competent cell and cultured overnight at 37°C on LB plates containing ampicillin (Amp, 100 mg / L).

[0440] (6) Picking single clones for sequencing

[0441] 1) Pick a single colony from the ampicillin antibiotic LB plate and culture it in LB (Amp, 100 mg / L) liquid overnight;

[0442] 2) Plasmid extraction: follow the instructions of the plasmid extraction kit (Axygen);

[0443] 3) The extracted plasmid was sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0444] (7) Sequencing successful plasmids for intermediate extraction

[0445] 1) The plasmid successfully sequenced was re-transformed with Stbl3 competent medium and cultured overnight on LB plates containing Amp (100 mg / L);

[0446] 2) In the morning, pick a single colony and culture it in 2 ml LB (Amp, 100 mg / L) liquid medium for 8 hours, then transfer it to 200 ml LB (Amp, 100 mg / L) liquid medium and culture it overnight;

[0447] 3) Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).

[0448] (8) Cell transfection using Lipofectamine 3000

[0449] 1) HEK293T cells were cultured in a culture flask at 37°C in a cell culture incubator containing 5% CO2. When the cells grew to 80-90% of the flask, the grown cells were plated in a 12-well plate with DMEM complete antibiotic-free medium and cultured overnight.

[0450] 2) When the cells in the 12-well plate grew to 80-90%, the prepared Cas9 and Cas9 mutant plasmids (800 ng) and sgRNAs plasmids (600 ng each) were transfected into the cells using Lipofectamine 3000, with two replicates for each sample.

[0451] 3) Two days after transfection, cells were collected and genomic extraction kit ( The genome was extracted using Genomic DNA Purification kit (Promega).

[0452] (9) Preparation of high-throughput sequencing library

[0453] Primers are designed approximately 30 bp downstream of the precise ligation site where the junction is expected to be deleted in the DNA fragment, and then the 5' end of the primer is added with an Illumina sequencing adapter with a barcode. The upstream primer can be designed at a position away from the splicing site and added with an Illumina sequencing adapter. PCR amplification is performed, and then beads are used for purification. The DNA product is dissolved in water, mixed in equal amounts to form a library for high-throughput sequencing.

[0454] (10) High-throughput sequencing data processing

[0455] The above results are as follows: when the sgRNA combination formed by two sgRNAs and the Cas9 nuclease are used to edit the genomic DNA fragment, the Cas9 nuclease cuts the double-stranded genomic DNA under the mediation of the two sgRNAs to produce four broken ends (DSB), and these broken ends (DSB) produce DNA fragment editing with DNA fragment deletion under the action of the cell repair system. Then, the DNA fragment deletion was detected, and the high-throughput sequencing technology was used to detect the situation of the DNA fragment deletion junction. In addition to the precise connection (Joined precisely) that was consistent with expectations, there was a certain proportion of 1bp base addition (Insertion) at the DNA fragment deletion junction.

[0456] Wild-type SpCas9 nuclease (Cas9WT, WT) and IN Cas9-1 and other Cas9 mutants E766A+R780A, IN Deletion of DNA fragments at the genomic β-globin site mediated by Cas9-2, E766A+△F916, E766A+R919P, E766A+Q920P, E766A+R976A, G915F+F916P, G915F+△F916, G915F+R919P, G915F+Q920P, G915F+R976A, F916P+R919P, F916P+Q920P, F916P+R976A, △F916+R919P, △F916+Q920P, △F916+R976A, R919P+Q920P, R919P+R976A, Q920P+R976A in the sgRNA combination. High-throughput sequencing was used to detect the deletion of junctions in DNA fragments and to count the proportion of 1 bp base insertion ( Figure 3 ), the statistical results are shown in Table 1:

[0457] Table 1

[0458]

[0459]

[0460] As shown in Table 1, under the mediation of sgRNA, the (+C) ratios of the other Cas9 nuclease mutants are all lower than that of INCas9-1, indicating that when the IN Cas9-1 nuclease mutant cuts the DNA chain that is not complementary to the sgRNA, the proportion of cutting at 4bp upstream of PAM is significantly increased. Therefore, we prefer IN Cas9-1 as a single-base precise insertion nuclease mutant. Compared with SpCas9 nuclease (Cas9WT), E766A nuclease mutant, and G915F nuclease mutant, the proportion of IN Cas9-1 nuclease mutant (+C) is significantly increased, of which (+C) accounts for 17.48% in Cas9WT, 20.89% in E766A, 33.08% in G915F, and 43.42% in IN Cas9-1 ( Figure 4 ).

[0461] In addition to the altered ratio of single-base insertions, the IN Cas9-1 nuclease mutant altered the cleavage and repair patterns of Cas9 ( Figure 5-8 ), the changes in the repair results are shown in the figure. After a detailed analysis of the data, it is found that the proportion of precise ligation is significantly reduced. Fig. 9 As shown in Table 2:

[0462] Table 2

[0463] Selected Cas9 nuclease Precise ligation ratio WT Cas9 50.92％ E766A 40.27％ G915F 31.07％ IN Cas9-1 17.88％

[0464] From the above results, we can see that the proportion of precise ligation is 50.92% in SpCas9 nuclease (Cas9WT), 40.27% in E766A nuclease mutant, 31.07% in G915F nuclease mutant, and only 17.88% in IN Cas9-1 nuclease mutant. Therefore, we believe that under the cleavage of IN Cas9-1 nuclease mutant, the cleavage mode of this site is more inclined to cleave at 4 positions upstream of PAM of the non-complementary chain of the target sequence and produce a sticky end (+C), rather than cleaving at 3 positions upstream of PAM to produce a blunt end, and the final repair result is a precise single base insertion, rather than a precise connection (precise ligation).

[0465] Example 2 Identification of the cleavage pattern of nuclease IN Cas9-2

[0466] 1. Construction of Cas9 mutants

[0467] Referring to the construction of the Cas9 mutant in Example 1, the nucleotide sequence of the correct nuclease IN Cas9-2 is shown in SEQ ID No.6.

[0468] 2. Cas9 nuclease mutants for DNA editing

[0469] Referring to the process of DNA fragment editing by Cas9 nuclease mutant in Example 1, PCR amplification was performed using Cas9 mutant F916P as a template, wherein:

[0470] Cas9 mutagenesis primers:

[0471] IN Cas9-2-F: GATGGCCCGAGCCAACCAAACTAC (SEQ ID NO.7);

[0472] IN Cas9-2-R: TCGATAACGATATTCTCGG (SEQ ID NO. 8).

[0473] The above results are as follows: when the sgRNA combination formed by two sgRNAs and the Cas9 nuclease are used to edit the genomic DNA fragment, the Cas9 nuclease cuts the double-stranded genomic DNA under the mediation of the two sgRNAs to produce four broken ends (DSB), and these broken ends (DSB) produce DNA fragment editing with DNA fragment deletion under the action of the cell repair system. Then, the DNA fragment deletion was detected, and the high-throughput sequencing technology was used to detect the situation of the DNA fragment deletion junction. In addition to the precise connection (Joined precisely) that was consistent with expectations, there was a certain proportion of 2bp base addition (Insertion) at the DNA fragment deletion junction.

[0474] Wild-type SpCas9 nuclease (Cas9WT, WT) and IN Cas9-2 and other Cas9 mutants E766A+R780A, IN Cas9-1, E766A+△F916, E766A+R919P, E766A+Q920P, E766A+R976A, G915F+F916P, G915F+△F916, G915F+R919P, G915F+Q920P, G915F+R976A, F916P+R919P, F916P+Q920P, F916P+R976A, △F916+R919P, △F916+Q920P, △F916+R976A, R919P+Q920P, R919P+R976A, Q920P+R976A mediates the deletion of DNA fragments at the genomic β-globin site in the sgRNA combination. High-throughput sequencing was used to detect the deletion of junctions in DNA fragments and to count the proportion of 2bp base insertions ( Fig.10 ), the statistical results are shown in Table 3:

[0475] Table 3

[0476]

[0477]

[0478] As shown in Table 3, under the mediation of sgRNA, the (+CC) ratios of the other Cas9 nuclease mutants are all lower than that of INCas9-2, indicating that when the IN Cas9-2 nuclease mutant cuts the DNA chain that is not complementary to the sgRNA, the proportion of cutting at 5bp upstream of PAM is significantly increased. Therefore, we prefer IN Cas9-2 as a double-base precise insertion nuclease mutant. Compared with SpCas9 nuclease (Cas9WT), E766A nuclease mutant, and F916P nuclease mutant, the proportion of IN Cas9-2 nuclease mutant (+CC) is significantly increased, of which (+CC) accounts for 1.27% in Cas9WT, 5.39% in E766A, 24.19% in F916P, and 46.87% in IN Cas9-2 ( Fig.11 ).

[0479] In addition to the altered ratio of dinucleotide insertions, the IN Cas9-2 nuclease mutant altered the cleavage and repair patterns of Cas9 ( Figure 5-6 , Figure 12-13 ), the changes in the repair results are shown in the figure. A detailed analysis of the data also found that the proportion of precise ligation was significantly reduced. Fig.14 As shown in Table 4:

[0480] Table 4

[0481] Selected Cas9 nuclease Precise ligation ratio WT Cas9 50.92％ E766A 40.27％ F916P 25.61％ IN Cas9-2 14.30％

[0482] From the above results, we can see that the proportion of precise ligation is 50.92% in SpCas9 nuclease (Cas9WT), 40.27% in E766A nuclease mutant, 31.07% in G915F nuclease mutant, and only 14.30% in IN Cas9-2 nuclease mutant. Therefore, we believe that under the cleavage of IN Cas9-2 nuclease mutant, the cleavage mode of this site is more inclined to cleave at 5 positions upstream of PAM of the non-complementary chain of the target sequence and produce a sticky end (+CC), rather than cleaving at 3 positions upstream of PAM to produce a blunt end, and the final repair result is a precise double base insertion, which replaces precise ligation as the dominant factor in the editing result.

[0483] In summary, the ratio of protruding break ends to blunt break ends generated by the Cas9 nuclease (IN Cas9-1 and IN Cas9-2) of the present invention when cutting the target genomic DNA fragment is different from that of the wild-type Cas9 nuclease. The Cas9 nuclease (IN Cas9-1 and IN Cas9-2) of the present invention can achieve cutting of the target genomic DNA fragment at a specific position and generate protruding break ends, and bases complementary to the protruding break ends can be added in a way of filling and connecting, thereby achieving precise DNA fragment editing at a specific position.

[0484] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. A nuclease, characterized in that The amino acid sequence of the nuclease is shown as SEQ ID No.3 or SEQ ID No.

5.

2. An isolated polynucleotide, characterized in that The nucleotide sequence of the polynucleotide is shown as SEQ ID No.4 or SEQ ID No.

6.

3. An expression vector, characterized in that: The expression vector comprises the polynucleotide according to claim 2 and a plasmid backbone.

4. An in vitro gene editing method, characterized in that: The gene editing method is: 1) contacting the target gene with the nuclease according to claim 1 and a polynucleotide encoding gRNA to achieve editing of the target gene; or, 2) contacting the target gene with the polynucleotide of claim 2 and the polynucleotide encoding the gRNA to achieve editing of the target gene; or, 3) contacting the target gene with the expression vector described in claim 3 and the polynucleotide encoding the gRNA to achieve editing of the target gene.

5. The gene editing method according to claim 4, characterized in that: The gene editing method is to use the nuclease as described in claim 1 to cut the DNA double strands to produce protruding broken ends, and the in vitro cells add bases complementary to the protruding broken ends in a fill-in connection manner to achieve single-site editing of the DNA fragment.

6. The gene editing method according to claim 4, characterized in that: Taking the single nucleotide insertion efficiency of wild-type Cas9 nuclease as a benchmark, the gene editing method is a gene editing method for improving the single nucleotide insertion efficiency.

Images