Development and application of a molecular marker for rapid identification of pomelo fruit base length

Abstract

The present invention discloses the development and application of a molecular marker for rapidly identifying the length of the fruit base of pomelo fruit, and belongs to the technical field of fruit appearance quality detection. The present invention provides a target genome InDel fragment that is closely linked to the appearance change of pomelo fruit, and the nucleotide sequence of the target genome InDel fragment is shown in SEQ ID No. 1. The present invention develops a set of simple and fast PCR markers based on the target genome InDel fragment, and PCR amplification is performed by primer pairs F and R to identify the length of the fruit base of pomelo. The marker of the present invention has low cost and high accuracy, and can realize the early selection of the length of the fruit base in the pomelo seedling stage, thereby improving the breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of fruit appearance quality detection, and specifically relates to the development and application of a molecular marker for rapidly identifying the base length of pomelo fruit. Background Art

[0002] The fruit base, also called the fruit handle or fruit neck, refers to the length from the pomelo cavity to the fruit pedicle. It is an important part of the pomelo fruit ( Figure 1 ). The Guanxi honey pomelo, Shatian pomelo and Shuijing honey pomelo that are currently grown in large quantities all have long fruit bases. A long fruit base will have a huge impact on the economic benefits of pomelo fruit, mainly manifested in: (1) A long fruit base will significantly reduce the edible rate and appearance quality of the fruit. (2) During the picking and storage and transportation of the fruit, the fruit base of the pomelo fruit is easily broken due to its special structure when subjected to external forces, resulting in a significant reduction in the shelf life and commercial quality of the fruit. (3) During storage and transportation, pomelo fruits with long fruit bases will take up a lot of transportation space and increase transportation costs. In summary, the length of the fruit base of pomelo fruit has become a bottleneck affecting the development of the pomelo industry.

[0003] Hybrid breeding is the most important and effective way to obtain new varieties of citrus fruits such as pomelo, but the hybrid breeding cycle of pomelo is long. It usually takes 8 to 10 years from the beginning of pollination to the genetic stability of fruit traits. During this period, a lot of manpower, material and financial resources are also consumed, which brings severe challenges to the hybrid breeding of pomelo and the selection and promotion of new varieties. Molecular marker-assisted breeding technology has the advantages of easy operation, high accuracy and good repeatability. It is an effective means to solve this problem. This technology can not only identify the target traits in the seedling stage, but also eliminate hybrid offspring that do not meet the target traits, greatly reduce unnecessary manpower, material and financial investment in the pomelo breeding process, and improve the selection and breeding efficiency of new pomelo varieties.

[0004] At present, there is no effective molecular marker for identifying the length of the base of pomelo fruit. Therefore, developing a molecular marker that can quickly identify the length of the base of pomelo fruit and applying it to pomelo hybrid breeding is of great significance to promote the genetic improvement of pomelo varieties and the creation of new varieties. Summary of the invention

[0005] The present invention provides the development and application of a molecular marker for rapidly identifying the length of the fruit base of pomelo fruit, which can rapidly identify the length of the fruit base of pomelo fruit in the seedling stage, thereby improving the efficiency of breeding new pomelo varieties.

[0006] The present invention provides a target genome InDel fragment causing a change in the appearance of a pomelo fruit. The nucleotide sequence of the target genome InDel fragment is shown in SEQ ID No.1.

[0007] Preferably, the pomelo fruit appearance includes the pomelo base length.

[0008] The present invention also provides an InDel molecular marker primer pair developed based on the target genome InDel fragment and suitable for identifying the length of pomelo base.

[0009] Preferably, it comprises an upstream primer having a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3.

[0010] The present invention also provides the use of the target genome InDel fragment or the InDel molecular marker primer pair in the identification of the base length of pomelo fruit.

[0011] The present invention also provides an InDel molecular marker method for identifying the length of the pomelo fruit base, comprising the following steps: using the seedling tissue DNA of the pomelo tree as a template, configuring an amplification system with the above-mentioned InDel molecular marker primer pair, and after amplification, determining the length of the fruit base of the pomelo tree that will bear fruit in the future according to the band properties of the amplified product.

[0012] Preferably, the amplification system, based on 15 μL, includes: 7 μL PCR Mix, 100 ng template, 1 μM each of the upstream and downstream primers, and the balance of ddH2O.

[0013] Preferably, the amplification procedure includes: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 30 sec, annealing at 55°C for 20 sec, extension at 72°C for 30 sec, 35 cycles; extension at 72°C for another 5 min, and storage at 12°C.

[0014] Preferably, when the amplification product has two bands, one long and one short, it indicates a long fruit base; when the amplification product has only one long band, it indicates a short fruit base.

[0015] Preferably, when the amplified product of the pomelo seedling is a long band of 434 bp and a short band of 382 bp, it indicates a long fruit base; when the amplified product is only a band of 434 bp, it indicates a short fruit base.

[0016] Beneficial effects: The present invention provides a target genome InDel fragment that causes changes in the appearance of pomelo fruit, and the nucleotide sequence of the target genome InDel fragment is shown in SEQ ID No. 1. The present invention designs a forward primer F at the upstream of the target genome InDel fragment and a reverse primer R at the downstream to form a primer pair F, R.

[0017] The present invention can utilize the above-mentioned primers to perform molecular marker detection on F and R, and the genotype of each material at the site can be determined only based on the gel image of the amplified product. The present invention obtains an InDel molecular marker for identifying the length of the pomelo fruit base. The use of the molecular marker for the identification of the length of the pomelo fruit base can overcome the shortcomings of the traditional method of judging the length of the pomelo fruit base by the naked eye and phenotypic determination, such as being time-consuming, laborious, and having low accuracy. Molecular marker diagnosis can also be performed on hybrid offspring at the seedling stage, which solves the limitation that the observation of the fruit base traits of pomelo fruits requires at least an 8-year growth cycle. The molecular markers described in the present invention can be applied to different goals in breeding practice, and the markers can be used to screen short fruit base materials when improving quality, extend the shelf life, and enhance commercial properties. In summary, the molecular markers described in the present invention have the advantages of early time and low cost when applied to assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a picture of the fruit base morphology of pomelo fruit;

[0019] Figure 2 This is the long and short fruit base phenotype of the representative offspring of Guanxi Pomelo and Pingshan Pomelo;

[0020] Figure 3 This is the frequency distribution histogram of the fruit base length of 192 offspring of Guanxi Pomelo and Pingshan Pomelo;

[0021] Figure 4 This is the result of genetic positioning of the pomelo fruit base length trait;

[0022] Figure 5 This is a comparison result of the difference of the long and short fruit base sequences of pomelo;

[0023] Figure 6 The figure shows the amplification results of the primer pair in the female parent Guanxi pomelo, the male parent Pingshan pomelo and 38 typical long and short fruit base progenies;

[0024] Figure 7 The figure shows the amplification results of the primer pair in 192 Guanxi pomelo and Pingshan pomelo generations;

[0025] Figure 8 This is a statistical chart of the fruit base length of 24 pomelo natural resources;

[0026] Fig. 9 The figure shows the amplification results of the primer pair in 24 natural pomelo resources. DETAILED DESCRIPTION

[0027] The present invention provides a target genome InDel fragment closely linked to the appearance change of pomelo fruit, and the nucleotide sequence of the target genome InDel fragment is shown as SEQ ID No.1.

[0028] In the embodiment of the present invention, the fruit base length trait of the offspring of the hybrid population of Guanxi Pomelo (long fruit base) × Pingshan Pomelo (short fruit base) was evaluated, and sequencing and bioinformatics analysis were combined to screen out a sequence with the highest degree of correlation with the fruit base length phenotype of pomelo: a 52bp InDel was significantly different in the long fruit base and short fruit base materials, and can be used as a candidate site for the development of molecular markers, which is a fruit base length linkage marker predicted based on sequencing results. In the present invention, a frequency distribution histogram of the fruit base length of the hybrid offspring was drawn, showing an approximate normal distribution, and Gaussian fitting was performed, and it was found that the peak value was around 2.4, and the fruit base length of around 2.4 divided the individual plants into two groups of long and short fruit bases ( Figure 3 ), the phenotypic observation of the hybrid offspring supports the above conclusion: when the fruit base length is less than 2.45, the fruit base length is relatively flat, which is a short fruit base; when the fruit base length is around 2.45, the fruit base is slightly convex; when the fruit base length is greater than 2.45, the fruit base is obviously convex, which is a long fruit base ( Figure 2 ).

[0029] In the present invention, the evaluation method of citrus fruit base length refers to Chinese patent CN202310207470.4, that is, citrus fruit base length = fruit base length measurement value / peel thickness measurement value.

[0030] The nucleotide sequence of the target genome InDel fragment of the present invention is shown in SEQ ID No. 1: AA AATAAATTAAGGTAAATAAAAATTTCATTGTAAGTGTTAACCAGACCTCT.

[0031] The present invention also provides an InDel molecular marker primer pair developed based on the target genome InDel fragment and suitable for identifying the length of pomelo base.

[0032] The present invention preferably designs an upstream primer F upstream of the above-mentioned target genome InDel fragment and designs a downstream primer R downstream, and the sequence of the upstream primer is preferably as shown in SEQ ID No.2: 5'-AAACAAGAAAGCATCGAC-3'; the sequence of the downstream primer is preferably as shown in SEQ ID No.3: 5'-CATTCAAATTCCACATCTAC-3'.

[0033] The present invention also provides the use of the target genome InDel fragment or the InDel molecular marker primer pair in the identification of the base length of pomelo fruit.

[0034] The present invention also provides an InDel molecular marker method for identifying the length of the pomelo fruit base, comprising the following steps: using the seedling tissue DNA of the pomelo tree as a template, configuring an amplification system with the above-mentioned InDel molecular marker primer pair, and after amplification, determining the length of the fruit base of the pomelo tree that will bear fruit in the future according to the band properties of the amplified product.

[0035] The amplification system of the present invention preferably includes 7 μL of PCR Mix, 100 ng of template, 1 μM of upstream and downstream primers, and the balance of ddH2O. The amplification procedure of the present invention preferably includes: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 30 sec, annealing at 55°C for 20 sec, extension at 72°C for 30 sec, 35 cycles; extension at 72°C for 5 min, and storage at 12°C.

[0036] In the present invention, when the amplification product has two bands, one long and one short, it indicates a long fruit base; when the amplification product has only one long band, it indicates a short fruit base; the length of the amplification product varies slightly according to the variety specificity of the material to be tested. For example, in the embodiment of the present invention, when the amplification product of the pomelo seedling is a long band of 434 bp (SEQ ID No. 4) and a short band of 382 bp (SEQ ID No. 5), it indicates a long fruit base; when the amplification product is only a band of 434 bp (SEQ ID No. 4), it indicates a short fruit base.

[0037] In the present invention, SEQ ID No.4: AAACAAGAAAGCATCGACACTTTTTTTTTCCCCCTTGGCTATATTTTCTAACTCTTTAAAGTAAAATTTTGTTTAGCAGATCTCAAATTTCTTTTTAACTGAAATCATGAGCCCAGGTTAGAAAAGTTAACAGGAAATTTGGACACTCAATGAAGAAGATGAAAAAAAGGGAAATGTCGTCATTGAAAATTTATGATTCTAAAGTTGATTTATTT TTGGATCGATCTTACAATATTAGTAAATTGAAGATCGATAAAAAACTAAATTAAGGTGAATAAAAATTTCATTGTAAGTGTTAACCAGACCTCCAAAATAAATTAAGGTAAAATAAAAATTTCATTGTAAGTGTTAACCAGACCTCTTCTCCTCATTTTTGCATTGTGAGTGTTGATTTTTTTTTTTTCAAGTTTTAGAAGTAGATGTGGAATTTGAATG; SEQ ID No.5: AAACAAGAAAGCATCGACACTTTTTTTTTCCCCTGGCTATATTTTCTAACTCTTTAAAGTAAAATTTTGTTTAGCAGATCTCAAATTTCTTTTTAACTGAAATCATGAGCCCAGGTTAGAAAAGTTAACAGGAAATTTGGACACTCAATGAAGAAGATGAAAAAAAGGGAAATGTCGTCATTGAAA ATTTATGATTCTAAAGTTGATTTATTTTTGGATCGATCTTACAATATTAGTAAATTGAAGATCGATAAAAAACTAAATTAAGGTGAATAAAAATTTCATTGTAAGTGTTAACCAGACCTCCTCTCCTCATTTTTGCATTGTGAGTGTTGATTTTTTTTTTCAAGTTTTAGAAGTAGATGTGGAATTTGAATG.

[0038] To further illustrate the present invention, the development and application of a molecular marker for rapid identification of the length of the pomelo fruit base provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] The method for designing and preparing InDel molecular markers for identifying the length of pomelo fruit base based on genome sequencing comprises the following steps:

[0041] The fruit base length traits of 192 hybrid populations of Guanxi Pomelo (long fruit base) × Pingshan Pomelo (short fruit base) were evaluated. The results are shown in Table 1 and Figure 2 As shown in the figure, the fruit base length trait showed obvious separation, and the frequency distribution showed an approximate normal distribution ( Figure 3 ), it is inferred that the trait is a quantitative trait controlled by multiple genes, among which Table 1 and Figure 2 is the numerical value of the fruit base length.

[0042] In order to identify the major gene of this trait, extreme single plant mixed pool sequencing was carried out on the progeny of the hybrid population. The genetic positioning results are as follows Figure 4 As shown, 27.4Mb-27.9Mb of grapefruit chromosome 1 was identified as a candidate segment.

[0043] In order to further screen the variation sites within the candidate segments that are closely linked to the fruit base length and height traits, Beijing Novogene Company was commissioned to complete the whole genome resequencing of 10 progenies of long fruit base hybrid populations and 10 progenies of short fruit base hybrid populations at a sequencing depth of 30×, obtaining a total of more than 300G of data.

[0044] According to the pomelo category to which the materials belonged, the sequencing reads of the 20 materials were aligned to the Wanbaiyou genome (http: / / citrus.hzau.edu.cn / data / Genome_info / HWB.v1.0 / HWB.v1.0.genome.fa) using BWA software to obtain a bam file containing all the variation information in the candidate segment.

[0045] iGV software was used to randomly visualize the variable sites in the candidate segment, and the sequence alignment results of different fruit base lengths were compared and checked one by one. According to the phenotypic conditions of the materials, the ratios of various bases / haplotypes at the sites were statistically analyzed, and the sequence polymorphisms with the highest degree of association with the phenotype in the candidate region were manually checked and screened as candidate sites for the development of molecular markers. It was found that a 52bp InDel was significantly different between the long fruit base and short fruit base materials ( Figure 5 ), this result is the fruit base length linkage marker predicted based on the sequencing results.

[0046] According to the above sequence information, experimental verification was designed, and the InDel sequence (SEQ ID No.1: AAAATAAATTAAGGTAAATAAAAATTTCATTGTAAGTGTTAACCAGACCTCT) was developed as a PCR marker: according to the sequence of the pomelo genome, a forward primer (SEQ ID No.2) was designed upstream of the InDel, and a reverse primer (SEQ ID No.3) was designed downstream to form a primer pair F and R: the product of the long fruit base is a 434 bp long band (SEQ ID No.4) and a 382 bp short band (SEQ IDNo.5), and the product of the short fruit base is a 434 bp band (SEQ ID No.4). Based on the above experimental design, the genotype of the site of each material can be directly determined from the gel map.

[0047] Table 1 Length of the fruit base of Guanxi pomelo × Pingshan pomelo

[0048]

[0049]

[0050]

[0051]

[0052] Example 2

[0053] Identification of fruit base length of 192 hybrid progenies of Guanxi Pomelo × Pingshan Pomelo

[0054] 1. Preparation of genomic DNA

[0055] The genomic DNA of the parents and 192 progeny of the hybrid populations were extracted using the improved CTAB method.

[0056] 2. Use the primer pair F and R developed in Example 1 to amplify and analyze the genomic DNA of all the above-mentioned pomelo.

[0057] The PCR reaction system was as follows: 7 μl PCRMix (purchased from Yisheng Company), 100 ng DNA, 1 μM each of the forward and reverse primers (synthesized at Tianyi Company), and ddH2O supplemented to a final volume of 15 μL.

[0058] Thermal cycle parameters were: 95°C for 5 min; 98°C for 30 sec, 55°C for 20 sec, 72°C for 30 sec, 35 cycles; 72°C for 5 min, stored at 12°C. The reaction was completed on a BIOCENER instrument.

[0059] The amplified product was detected by 2.0% agarose gel electrophoresis in a horizontal electrophoresis tank of Beijing Liuyi Electrophoresis Instrument, using 1xTAE buffer (0.04M Tris-acetate, 0.001M EDTA, pH 8.0), voltage 8V / cm, and electrophoresis for 30min. After electrophoresis, the BIO-RAD gel imaging system (UVP) was used to take pictures and save them.

[0060] By amplifying the offspring of the female parent Guanxi Pomelo, the male parent Pingshan Pomelo, and 38 typical long-short fruit base hybrids, it was found that only 4 of the 19 long-fruit base progeny did not meet the requirements, and only 3 of the 19 short-fruit base progeny did not meet the requirements ( Figure 6 ), and it is believed that this marker has a high explanatory power for the length of the grapefruit base.

[0061] Further statistics on the amplification results of 192 hybrid progenies showed that 148 hybrid progenies had molecular marker bands that matched the trait expression, while 44 hybrid progenies did not ( Figure 7 , Table 2), the overall consistency of the marker reached (148 / 192) × 100% = 77.08%; in Table 2, "√" represents compliance, "×" represents non-compliance, and - represents that the sample material was lost and amplification verification was not performed. The application of this marker provides a simple, rapid and effective screening method for early diagnosis of pomelo fruit base length and hybrid breeding, thereby improving breeding efficiency.

[0062] Table 2192 Molecular marker verification of hybrid progeny of Guanxi Pomelo and Pingshan Pomelo

[0063]

[0064]

[0065] Example 3

[0066] Identification of fruit base length of 24 natural pomelo resources

[0067] 1. Preparation of genomic DNA

[0068] The genomic DNA of 24 natural pomelo resources was extracted using the improved CTAB method.

[0069] 2. Use the primer pair F and R developed in Example 1 to amplify and analyze the genomic DNA of all the above-mentioned pomelo.

[0070] The PCR reaction system was as follows: 7 μl PCRMix (purchased from Yisheng Company), 100 ng DNA, 1 μM each of the forward and reverse primers (synthesized at Tianyi Company), and ddH2O supplemented to a final volume of 15 μL.

[0071] Thermal cycle parameters were: 95°C for 5 min; 98°C for 30 sec, 55°C for 20 sec, 72°C for 30 sec, 35 cycles; 72°C for 5 min, stored at 12°C. The reaction was completed on a BIOCENER instrument.

[0072] The amplified product was detected by 2.0% agarose gel electrophoresis in a horizontal electrophoresis tank of Beijing Liuyi Electrophoresis Instrument, using 1xTAE buffer (0.04M Tris-acetate, 0.001M EDTA, pH 8.0), voltage 8V / cm, and electrophoresis for 30min. After electrophoresis, the BIO-RAD gel imaging system (UVP) was used to take pictures and save them.

[0073] The statistics of the fruit base length of 24 natural pomelo resources showed that there were 9 long fruit handles and 15 short fruit handles ( Figure 8 , Table 3). Further expansion of the 24 pomelo natural resources revealed that only 2 of the 9 long-fruit pomelo natural resources did not meet the criteria, and only 4 of the 15 short-fruit pomelo natural resources did not meet the criteria ( Fig. 9 , Table 3), the overall consistency of the marker reached (18 / 24) × 100% = 75%, and it is believed that the marker has a high degree of explanation for the length of the pomelo base; "√" in Table 3 represents compliance, and "×" represents non-compliance. The application of this marker provides a simple, rapid and effective screening method for the early diagnosis of the length of the pomelo base and hybrid breeding, thereby improving breeding efficiency.

[0074] Table 324 Verification of molecular markers of pomelo natural resources

[0075]

[0076]

[0077] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A target genomic InDel fragment causing a change in the appearance of pomelo fruit, characterized in that: The nucleotide sequence of the target genome InDel fragment is shown in SEQ ID No.

1.

2. The target genome InDel fragment according to claim 1, characterized in that: The pomelo fruit appearance includes the pomelo base length.

3. An InDel molecular marker primer pair suitable for identifying the length of grapefruit bases developed based on the target genome InDel fragment according to claim 1 or 2, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No.

3.

4. Use of the target genome InDel fragment according to claim 1 or 2 or the InDel molecular marker primer pair according to claim 3 in the identification of the base length of pomelo fruit.

5. An InDel molecular marker method for identifying the length of grapefruit base, characterized in that: The method comprises the following steps: using the seedling tissue DNA of the pomelo tree as a template, configuring an amplification system with the InDel molecular marker primer pair of claim 3, performing amplification, and determining the length of the fruit base of the pomelo tree that will bear fruit in the future according to the band properties of the amplified product; When the amplified product is a long band of 434 bp and a short band of 382 bp, it is represented as a long fruit base; when the amplified product is only a band of 434 bp, it is represented as a short fruit base.

6. The InDel molecular labeling method according to claim 5, characterized in that: The amplification system, in 15 μL, includes: 7 μL PCR Mix, 100 ng template, 1 μM each of upstream and downstream primers, and the balance of ddH2O.

7. The InDel molecular labeling method according to claim 5 or 6, characterized in that: The amplification procedure includes: pre-denaturation at 95°C for 5 minutes; denaturation at 98°C for 30 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 30 seconds, 35 cycles; extension at 72°C for another 5 minutes, and storage at 12°C.

Images