A low-caffeine fermented tea and a method of making the same
By co-fermenting tea with Penicillium spp. from Jiangxi Province, the caffeine content in tea is significantly reduced, solving the problem of insufficient caffeine content in existing technologies. This produces low-caffeine fermented tea that meets the drinking needs of specific groups and has advantages such as safety, ease of operation, and low cost.
Patent Information
- Application Number
- CN202410029155.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-09
- Publication Date
- 2025-12-26
- Estimated Expiration
- 2044-01-09
AI Technical Summary
In existing technologies, the method of preparing low-caffeine tea by microbial fermentation of tea leaves does not involve the application of Penicillium jikenensis, and the caffeine content is not sufficiently degraded, which cannot meet the needs of specific groups of people.
A method of co-culturing Penicillium jixiense with tea leaves was adopted to significantly reduce the caffeine content in tea leaves through a co-fermentation process, thus preparing low-caffeine fermented tea. The specific steps include mixing tea leaves with distilled water, sterilization, inoculation with Penicillium jixiense, and co-fermentation in the dark.
The caffeine degradation rate is over 75%, and the caffeine content is as low as 1.0%, which meets international standards. The tea has a mellow, sweet taste with low bitterness and astringency, and the tea soup is dark red. It has the advantages of being green, safe, and non-toxic.
Smart Images

Figure CN118058366B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of tea processing, in particular to a low-caffeine fermented tea and a preparation method thereof. BACKGROUND
[0002] Tea is one of the most popular and widely consumed beverages in China. According to the degree of fermentation, tea can be traditionally classified into green tea, white tea, yellow tea, oolong tea, black tea and dark tea. Microbial fermentation can induce a series of biochemical reactions, such as oxidation, degradation, methylation, glycosylation and polymerization, etc. This microbial fermentation significantly changes the original compounds of tea, such as conferring unique sensory qualities and health-promoting benefits to Liupao tea (a kind of black tea), e.g. reddish-brown color, mellow aroma, smooth taste, low bitterness, and anti-hypertensive, anti-obesity, anti-diabetic activities; regulating blood lipids, relieving metabolic syndrome, intestinal regulation and changing gut microbiota.
[0003] Caffeine (1,3,7-trimethylxanthine) is an important alkaloid belonging to the family of plant-synthesized purine alkaloids. In nature, caffeine exists in tea, cocoa beans, coffee beans and some other plants. In tea leaves, caffeine is usually present at 2-5%. However, excessive use of caffeine can increase the burden on the kidneys and liver, and long-term consumption can cause gastric ulcers and gastric perforation, and may also cause caffeine dependence, neurasthenia, anxiety, etc.
[0004] Low-caffeine fermented tea is a new type of tea suitable for specific groups of people sensitive to caffeine, such as neurasthenics, pregnant women, the elderly, children, etc. It is known that microbial fermentation of tea leaves to prepare fermented tea, but the functions of fermented tea obtained by different microbial species, especially different species, may be different, and there is no relevant report on the preparation of low-caffeine fermented tea by Jiangxi Penicillium and tea fermentation. SUMMARY
[0005] The present application aims to provide a low-caffeine fermented tea and a preparation method thereof to solve the problems of the prior art. By co-culturing Jiangxi Penicillium and tea leaves, the content of caffeine in tea leaves can be significantly reduced to obtain a low-caffeine fermented tea. The method is simple and easy to operate, and has the advantages of low cost, greenness, safety, non-toxicity, etc.
[0006] To achieve the above-mentioned purpose, the present application provides the following solutions:
[0007] The application provides a preparation method of low-caffeine fermented tea, comprising the following steps: fermenting and culturing Penicillium jiangxiense and tea leaves to obtain low-caffeine fermented tea; wherein the Penicillium jiangxiense has a preservation number of CGMCC NO.40915, a preservation time of November 09, 2023, a preservation unit of China General Microbiological Culture Collection Center, and a preservation address of No.1, Beichen West Road, Chaoyang District, Beijing, China Institute of Microbiology.
[0008] Preferably, the method of fermenting and culturing the Penicillium jiangxiense and the tea leaves comprises the following steps:
[0009] mixing and sterilizing the tea leaves and distilled water to obtain a tea leaf culture medium;
[0010] after inoculating the Penicillium jiangxiense into the tea leaf culture medium, fermenting and culturing under light shielding until the mycelium of the Penicillium jiangxiense completely covers the tea leaf culture medium.
[0011] Preferably, after uniformly mixing the tea leaves and the distilled water, standing for 40-90 min, and then sterilizing at 121 DEG C for 30-60 min, the tea leaf culture medium is obtained; wherein the amount of the distilled water is 30%-90% of the dry weight of the tea leaves.
[0012] Preferably, before inoculating the Penicillium jiangxiense into the tea leaf culture medium, the method further comprises the steps of activating the Penicillium jiangxiense by using a PDA culture medium, and transferring the activated Penicillium jiangxiense into wort culture medium to obtain the mycelium of the Penicillium jiangxiense.
[0013] Preferably, the culture condition of the Penicillium jiangxiense by using the wort culture medium is 20-32 DEG C for 10-20 days.
[0014] Preferably, the temperature of the fermenting and culturing is 20-32 DEG C.
[0015] Preferably, the tea leaves include green tea, yellow tea, white tea, green tea, black tea, black tea, and can also be tea stems and tea leaves of the above-mentioned tea leaves; and also include coffee-containing herbal tea. The application is not limited to the above-mentioned tea types, and is not limited to one kind of tea, and one kind of tea can be used alone, or multiple kinds of tea can be used simultaneously.
[0016] The application further provides a low-caffeine fermented tea prepared by the preparation method.
[0017] The application discloses the following technical effects:
[0018] The present application is to make full use of the biological activity of microorganisms and tea, to meet the demand of enriching new tea varieties and deep processing, and to obtain a low-caffeine fermented tea by co-fermenting Jiangxi Penicillium and tea under certain culture conditions. The method for preparing the low-caffeine fermented tea is simple and easy to operate. The Jiangxi Penicillium strain has high activity in degrading caffeine, and has the advantages of low cost, green, safety, non-toxicity and the like. After co-fermentation, the degradation rate of caffeine is more than 75%, and the caffeine content of the obtained low-caffeine fermented tea is as low as 1.0% or less, which meets the international standard of low-caffeine tea. More specifically, the inventors use Jiangxi Penicillium to ferment green tea, and the caffeine content in the obtained fermented tea is reduced from 38.84±0.16 mg / g before fermentation to 8.76±0.1 mg / g, and the degradation rate of caffeine is 77.45%. In addition, the green tea is endowed with unique sensory quality after fermentation, and has mellow, sweet and smooth taste, low bitterness, red and dark soup color, and no toxicity.
[0019] The present application provides a tea beverage product with rich nutrition, low caffeine content and weak bitterness, and a preparation method thereof, and provides a new idea for the development of tea industry. BRIEF DESCRIPTION OF DRAWINGS
[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description only constitute some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0021] Figure 1 is a culture characteristic diagram of Jiangxi Penicillium;
[0022] Figure 2 is a finished product diagram of low-caffeine fermented tea;
[0023] Figure 3 is a soup color comparison diagram of green tea and low-caffeine fermented tea;
[0024] Figure 4 is a high-performance liquid chromatogram (HPLC) of caffeine content in green tea and low-caffeine fermented tea. DETAILED DESCRIPTION
[0025] Now, various exemplary embodiments of the present application will be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.
[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an intermediate value of the parameter is understood to be specifically disclosed anywhere that either the upper or lower limit of the range is disclosed. Any smaller range within a disclosed larger range is also specifically disclosed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.
[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials that are related to the present application. In the case of conflict between the present specification and any document incorporated by reference, the present specification will control.
[0028] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.
[0029] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional elements or steps.
[0030] Example 1
[0031] 1. Strain screening
[0032] Accurately weigh 1 g of tea sample, add to 200 mL of sterile water, shake well, and incubate at 28°C on a shaker at 180 r·min -1 for 48-72 h. Centrifuge to obtain 1 mL of supernatant, mix with 9 mL of sterile physiological saline to obtain a 10 -1 fold dilution of the bacterial suspension, and sequentially dilute by 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7The coating method is adopted to inoculate on PDA medium, 3 parallels for each dilution, 2 repeats, and inverted culture at 28℃. After the colony grows, a single colony is picked and streaked on PDA medium plate for isolation and purification. In a sterile environment, the well-grown mycelium is inoculated on a PDA medium plate, and cultured at a temperature of 23-27℃ for 15 days to obtain a purified cultured strain, and the colony morphology is as shown in Figure 1 .
[0033] 2. Strain identification
[0034] The genomic DNA of the above-mentioned isolated and purified strain is extracted by using a Solarbio fungal DNA extraction kit, the ITS gene of the strain is amplified by a PCR method and sent to Shanghai Shengong Bioengineering Co., Ltd. for sequencing analysis, and the primer for amplifying the ITS gene is as follows:
[0035] The upstream primer sequence (SEQ ID NO: 1) is 5'TCCGTAGGTGAACCTGCGG 3',
[0036] The downstream primer sequence (SEQ ID NO: 2) is 5'TCCTCCGCTTATTGATATGC 3'.
[0037] The PCR reaction condition is: 95℃ pre-denaturation for 4min, 95℃ denaturation for 40s, 55℃ annealing for 50s, 72℃ extension for 1min, 32 cycles of reaction, and 72℃ extension for 10min. By using the BLAST function of NCBI, sequence alignment is performed in the GeneBank database, it is found that the strain screened by the present application has the highest homology with Penicillium jiangxiense, which is 98.40%. Thus, the strain is determined to be Penicillium jiangxiense, and is named as Penicillium jiangxiense GX0002983.
[0038] The Penicillium jiangxiense GX0002983 has been preserved in the China General Microbiological Culture Collection Center on November 9, 2023, the address of the preservation center is No. 1, Beichen West Road, Chaoyang District, Beijing, China, and the preservation number is CGMCC No. 40915.
[0039] Example 2 Preparation of a low-caffeine fermented tea
[0040] 1. Strain preparation
[0041] The Jiangxi Penicillium strain is activated using PDA culture medium, inoculated into malt wort culture medium (Hibio Biotechnology Co., Ltd., HB4176-3), and placed in a 28°C incubator for 15 days. The Jiangxi Penicillium grows vigorously, with good growth and dense mycelium, thereby obtaining the mycelium of the Jiangxi Penicillium.
[0042] 2. Preparation of low-caffeine fermented tea
[0043] A certain amount of green tea is weighed and placed in a culture bottle. Distilled water is added to the green tea at 60% of the dry weight of the green tea, and thoroughly mixed. After standing for 60 min, sterilization is performed at 121°C for 30 min. The Jiangxi Penicillium mycelium with good growth is picked into the above-mentioned tea culture medium, and cultured at 28°C in the dark. After the Jiangxi Penicillium mycelium completely covers the tea culture medium, it is dried to obtain low-caffeine fermented tea. Figure 2
[0044] A certain amount of green tea is weighed and boiled in water. The soup color of the green tea and the low-caffeine fermented tea is compared as shown in Figure 3 After fermentation, the green tea has a mellow, sweet, smooth taste, and a low degree of bitterness, with a dark red soup color.
[0045] Example 3. Preparation of a low-caffeine fermented tea
[0046] 1. Strain preparation
[0047] The Jiangxi Penicillium strain is activated using PDA culture medium, inoculated into malt wort culture medium, and placed in a 20°C incubator for 20 days. The Jiangxi Penicillium grows vigorously, with good growth and dense mycelium, thereby obtaining the mycelium of the Jiangxi Penicillium.
[0048] 2. Preparation of low-caffeine fermented tea
[0049] A certain amount of yellow tea is weighed and placed in a culture bottle. Distilled water is added to the yellow tea at 30% of the dry weight of the yellow tea, and thoroughly mixed. After standing for 40 min, sterilization is performed at 121°C for 40 min. The Jiangxi Penicillium mycelium with good growth is picked into the above-mentioned tea culture medium, and cultured at 20°C in the dark. After the Jiangxi Penicillium mycelium completely covers the tea culture medium, it is dried to obtain low-caffeine fermented tea.
[0050] Example 4. Preparation of a low-caffeine fermented tea
[0051] 1. Strain preparation
[0052] The Jiangxi Penicillium strain is activated using PDA culture medium, inoculated into malt wort culture medium, and placed in a 32°C incubator for 10 days. The Jiangxi Penicillium grows vigorously, with good growth and dense mycelium, thereby obtaining the mycelium of the Jiangxi Penicillium.
[0053] 2. Preparation of low-caffeine fermented tea
[0054] Weigh out black tea and place it in a culture bottle. Add 90% of the dry weight of the black tea to the black tea with distilled water, mix thoroughly, let stand for 90 minutes, and sterilize at 121℃ for 60 minutes. Pick out the well-growing Penicillium jixiense mycelium and transfer it to the above tea culture medium. Incubate at 32℃ in the dark. When the Penicillium jixiense mycelium completely covers the tea culture medium, air dry to obtain low-caffeine fermented tea.
[0055] Example 5: Determination of Caffeine Content in Low-Caffeine Fermented Tea
[0056] The caffeine content in tea was determined by high performance liquid chromatography (HPLC) under the following chromatographic conditions:
[0057] Column: Yuexu XB-C18 (4.6mm*250mm, 5μm);
[0058] Mobile phase: Acetonitrile (A)-water (B) (0–15 min, 5%–10% A; 15–30 min, 10%–16% A; 30–31 min, 16%–95% A; 31–45 min, 95% A; 45–46 min, 95%–5% A; 46–55 min, 5% A), Flow rate: 1.0 mL / min, Column temperature: 35℃, Detection wavelength: 280 nm, Injection volume: 20 μL.
[0059] Preparation of the test solution: Weigh 1g of the fermented tea prepared in Example 1, add 100mL of distilled water, extract at 100℃ for 30min, filter, and dilute the filtrate to 100mL. Then filter through a 0.45μm microporous filter head, perform liquid chromatography for detection and analysis, and calculate the degradation rate of caffeine.
[0060] High-performance liquid chromatography (HPLC) analysis revealed that the caffeine content in Jiangxi Penicillium-fermented green tea decreased from 38.84±0.16 mg / g before fermentation to 8.76±0.1 mg / g, representing a caffeine degradation rate of 77.45%. Figure 4 As shown.
[0061] The fermented teas prepared in Examples 3 and 4 were also used to prepare caffeine, which also significantly reduced the caffeine content in the tea leaves, with caffeine degradation rates of 75.89% and 76.99%, respectively.
[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for preparing a low-caffeine fermented tea, characterized by, The method comprises the following steps: The low-caffeine fermented tea is prepared by fermenting and culturing Penicillium jiangxiense and tea leaves together; wherein the accession number of the Penicillium jiangxiense is CGMCC NO.40915.
2. The production method according to claim 1, wherein The method for fermenting and culturing the Penicillium jiangxiense and the tea leaves together comprises the following steps: The tea leaf medium is prepared by mixing and sterilizing tea leaves and distilled water; After the Penicillium jiangxiense is inoculated into the tea leaf medium, the Penicillium jiangxiense and the tea leaves are fermented and cultured together in the dark until the mycelium of the Penicillium jiangxiense completely covers the tea leaf medium.
3. The production method according to claim 2, wherein After the tea leaves and the distilled water are mixed evenly, the mixture is left to stand for 40-90 min, and then sterilized at 121℃ for 30-60 min to obtain the tea leaf medium; wherein the amount of the distilled water is 30%-90% of the dry weight of the tea leaves.
4. The production method according to claim 2, wherein Before the Penicillium jiangxiense is inoculated into the tea leaf medium, the method further comprises the steps of activating the Penicillium jiangxiense by using a PDA medium, and transferring the activated Penicillium jiangxiense into wort medium to obtain the mycelium of the Penicillium jiangxiense.
5. The production method according to claim 4, wherein The conditions for culturing the Penicillium jiangxiense by using the wort medium are as follows: 20-32℃ for 10-20 days.
6. The production method according to claim 1, wherein The temperature for the fermenting and culturing together is 20-32℃.
7. The production method according to claim 1, wherein The tea leaves comprise at least one of green tea, yellow tea, white tea, green tea, black tea, dark tea and substitute tea containing caffeine.
8. A low-caffeine fermented tea, characterized by, The low-caffeine fermented tea is prepared by the method according to any one of claims 1-7.
Citation Information
Patent Citations
Method for bioconversion of tea caffeine with paecilomyces gunnii
CN103431128A
Novel low-caffeine and weak-bitter-and-astringent-taste tea beverage and preparation method thereof
CN106819238A