A method for preparing human basic fibroblast growth factor
Through a two-step synergistic purification process and high-density fermentation conditions, the problems of high cost, low efficiency and high endotoxin content of human alkaline fibroblast growth factor are solved, and high efficiency and low cost high-purity protein preparation is achieved.
Patent Information
- Application Number
- CN202410401413.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-03
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-04-03
AI Technical Summary
In the prior art, the preparation of human alkaline fibroblast growth factors has problems such as high cost, low efficiency and high endotoxin content, which limits its wide application.
A two-step synergistic purification process was adopted, including chromatography purification using phenyl agarose gel and DEAE agarose gel, and re-activity by SP agarose gel XL, combining high-density fermentation conditions and specific induction conditions to improve the purity and activity of the protein.
It realizes the efficient preparation of human alkaline fibroblast growth factors with high purity, high activity, and low endotoxin content, reducing production costs and suitable for laboratory to industrial production level process amplification.
Smart Images

Figure CN118063586B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to a method for preparing human basic fibroblast growth factor. Background Art
[0002] Basic fibroblast growth factor (bFGF) is a member of the fibroblast growth factors (FGFs) family. In 1986, Abraham obtained the primary structure and cDNA sequence of bFGF. There is only one copy of the bFGF gene in the human genome, which is located on chromosome 4q 26-27. The gene size is approximately 40 kb, and the coding sequence consists of 3 exons separated by two introns. The upstream alternative start codon CUG initiates the translation of isoforms with molecular weights ranging from 18 kD to 25 kD. The 18 kD form of bFGF is distributed in the cytoplasm and mediates cell migration and the expression of integrins α5, α6, and β1. The 22 kD - 25 kD forms are localized in the nucleus and promote cell growth. The precursor of bFGF after translation consists of 155 amino acid residues with a molecular weight of 18 kD, and its mature peptide contains 146 amino acid residues, including a large number of basic amino acid residues, with an isoelectric point pI of 9.6. The secondary structure of bFGF consists of 12 β-sheets and has 4 cysteine residues, but no intramolecular disulfide bonds are formed. bFGF is an important regulator of cell growth and differentiation, having activities such as angiogenesis promotion, cell proliferation, cell chemotaxis, and cell migration, and plays an important role in cell differentiation and organism development.
[0003] bFGF can be expressed in a prokaryotic expression system, but the soluble expression of bFGF in Escherichia coli is not high. This is because bFGF is easily degraded and most of it exists in the form of inclusion bodies, making the large-scale preparation of bFGF cumbersome and expensive, which to a certain extent limits the wide application of this protein. In addition, the prokaryotic protein expression system represented by the Escherichia coli expression system has main disadvantages such as the lack of post-translational processing mechanisms for proteins, such as the formation of disulfide bonds, protein glycosylation, and correct folding, and the complex separation and purification of expression products, with a relatively small probability of obtaining a biologically active protein, requiring renaturation, high cost, and long cycle. Endotoxins are generated after ultrasonic disruption and need special processes to remove, and the removal may affect the protein purity and activity at the same time, with high requirements for the purification process.
[0004] In summary, developing an effective method for preparing basic fibroblast growth factor is of great significance for the application of basic fibroblast growth factor. Summary of the Invention
[0005] In view of the deficiencies of the prior art and practical needs, the present invention provides a method for preparing human basic fibroblast growth factor, aiming to efficiently prepare human basic fibroblast growth factor (wild-type or recombinant) with high purity, high activity and low endotoxin content.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] In a first aspect, the present invention provides a method for preparing human basic fibroblast growth factor, and the preparation method includes:
[0008] Culturing a host cell expressing human basic fibroblast growth factor, inducing the host cell to express human basic fibroblast growth factor, disrupting the cells and collecting the precipitate to obtain a crude protein, and purifying the crude protein to recover the human basic fibroblast growth factor; the purification includes performing a first chromatography and a second chromatography in sequence, and the packing material of the first chromatography includes any one or a combination of at least two of phenyl agarose gel, butyl agarose gel, n-butyl agarose gel or n-octyl agarose gel, and the packing material of the second chromatography includes any one or a combination of at least two of DEAE agarose gel, Q agarose gel or QAE agarose gel.
[0009] In the present invention, the purification process of human basic fibroblast growth factor is ingeniously designed. By synergistically combining phenyl agarose gel packing material chromatography and DEAE agarose gel packing material chromatography, while significantly improving the protein purity, the endotoxin content is effectively reduced, which is suitable for process amplification from laboratory scale to industrial production scale; the chromatography packing materials used have high loading capacity, fast flow rate, simple packing, high column efficiency, and are easy to clean, disinfect and regenerate, so the packing materials have a long service life and are suitable for large-scale industrial production.
[0010] It can be understood that the present invention designs cell culture and purification processes for human basic fibroblast growth factor, which can be applied to any wild-type or recombinant human basic fibroblast growth factor. Host cells capable of expressing human basic fibroblast growth factor in the art, such as Escherichia coli, etc., can be applied to the method of the present invention without special restrictions.
[0011] It can be understood that the phenyl agarose gel and DEAE agarose gel, etc. in the present invention are well-known Sepharose (agarose) gel chromatography packing materials in the art, such as Phenyl Sepharose TM 6FF(HS)(Cytiva, 17097303) and DEAE Sepharose TM FF(Cytiva, 17070905), etc. Those skilled in the art can know and select commercially available chromatography packing materials of the same type.
[0012] Preferably, after purification, a renaturation step is further included.
[0013] Preferably, the renaturation includes performing a third chromatography, and the packing material for the third chromatography includes SP Sepharose XL.
[0014] In the present invention, a renaturation method for human basic fibroblast growth factor is further designed. Chromatography is performed using SP Sepharose XL packing material, which avoids the formation of protein aggregates during the general renaturation process, has a higher renaturation yield, and can further improve the purity of the target protein (above 95%) and reduce the endotoxin content (below 10 EU / mg).
[0015] Preferably, the first chromatography specifically includes:
[0016] Using any one or a combination of at least two of phenyl Sepharose, butyl Sepharose, n-butyl Sepharose or n-octyl Sepharose to pack a chromatography column, flushing the chromatography column with a first equilibration buffer, loading the sample, flushing the impurity proteins with a mixture of a first elution buffer and a second elution buffer until the baseline is stable, and then eluting the target protein with a mixture of the first elution buffer and the second elution buffer.
[0017] Preferably, the first equilibration buffer contains tris(hydroxymethyl)aminomethane (Tris), urea, EDTA, NaCl and ammonium sulfate.
[0018] Preferably, the first equilibration buffer contains Tris at a final concentration of 40 - 60 mM, urea at a final concentration of 5 - 7 M; EDTA at a final concentration of 4 - 6 mM, NaCl at 400 - 600 mM and ammonium sulfate at 400 - 600 mM.
[0019] Preferably, the first elution buffer contains arginine, Tris, urea and EDTA.
[0020] Preferably, the first elution buffer contains arginine at a final concentration of 170 - 230 mM, Tris at a final concentration of 40 - 60 mM, EDTA at a final concentration of 3 - 9 mM and urea at a final concentration of 5 - 7 M.
[0021] Preferably, the second elution buffer contains arginine, Tris, urea, EDTA and NaCl.
[0022] Preferably, the second elution buffer contains arginine at a final concentration of 170 - 230 mM, Tris at a final concentration of 40 - 60 mM, EDTA at a final concentration of 3 - 9 mM, urea at a final concentration of 5 - 7 M, and NaCl at a final concentration of 0.8 - 1.2 M.
[0023] Preferably, the flushing of the miscellaneous proteins comprises mixing 15% - 25% of the first elution buffer and 75% - 85% of the second elution buffer based on 100% by volume.
[0024] Preferably, the elution comprises mixing 65% - 75% of the first elution buffer and 25% - 35% of the second elution buffer based on 100% by volume.
[0025] Preferably, the second chromatography specifically comprises:
[0026] Using any one or a combination of at least two of DEAE agarose gel, Q agarose gel or QAE agarose gel to pack a chromatography column, flushing the chromatography column with the second equilibration buffer, loading the sample, flushing the miscellaneous proteins with a mixture of the third elution buffer and the fourth elution buffer until the baseline is stable, and then eluting the target protein with a mixture of the third elution buffer and the fourth elution buffer.
[0027] Preferably, the second equilibration buffer contains Tris and urea.
[0028] Preferably, the second equilibration buffer contains Tris with a final concentration of 40 - 60 mM and urea with a final concentration of 5 - 7 M.
[0029] Preferably, the third elution buffer contains Tris and urea.
[0030] Preferably, the third elution buffer contains Tris with a final concentration of 40 - 60 mM and urea with a final concentration of 5 - 7 M.
[0031] Preferably, the fourth elution buffer contains Tris, urea and NaCl.
[0032] Preferably, the fourth elution buffer contains Tris with a final concentration of 40 - 60 mM, urea with a final concentration of 5 - 7 M and NaCl with a final concentration of 0.8 - 1.2 M.
[0033] Preferably, the flushing of the miscellaneous proteins comprises mixing 80% - 90% of the third elution buffer and 10% - 20% of the fourth elution buffer based on 100% by volume.
[0034] The elution comprises mixing 60% - 70% of the third elution buffer and 30% - 40% of the fourth elution buffer based on 100% by volume.
[0035] Preferably, the third chromatography specifically comprises:
[0036] Use an SP Sepharose XL chromatography column, rinse the chromatography column with the third equilibration buffer, load the sample, perform renaturation rinsing with the renaturation buffer, rinse the miscellaneous proteins with a mixture of the fifth elution buffer and the sixth elution buffer until the baseline is stable, and then elute the target protein with a mixture of the fifth elution buffer and the sixth elution buffer.
[0037] Preferably, the third equilibration buffer contains sodium acetate, arginine, and urea.
[0038] Preferably, the third equilibration buffer contains sodium acetate at a final concentration of 90 - 110 mM, arginine at a final concentration of 90 - 110 mM, and urea at a final concentration of 7 - 9 M.
[0039] Preferably, the renaturation buffer contains EDTA, sodium acetate, polyethylene glycol, arginine, and 2-(cyclohexylamino)ethanesulfonic acid.
[0040] Preferably, the renaturation buffer contains EDTA at a final concentration of 0.5 - 2 mM, sodium acetate at a final concentration of 20 - 80 mM, polyethylene glycol 2000 at a concentration of 3 - 8 g / L, arginine at a final concentration of 100 - 200 mM, and CHES (2-(cyclohexylamino)ethanesulfonic acid) at a final concentration of 100 - 200 mM.
[0041] Preferably, the fifth elution buffer contains sodium acetate and arginine.
[0042] Preferably, the fifth elution buffer contains sodium acetate at a final concentration of 20 - 40 mM and arginine at a final concentration of 100 mM.
[0043] Preferably, the sixth elution buffer contains sodium acetate, arginine, and NaCl.
[0044] Preferably, the sixth elution buffer contains sodium acetate at a final concentration of 20 - 40 mM, arginine at a final concentration of 90 - 110 mM, and NaCl at a final concentration of 0.8 - 1.2 M.
[0045] Preferably, the rinsing of the miscellaneous proteins includes mixing 80% - 90% of the fifth elution buffer and 10% - 20% of the sixth elution buffer by volume percentage based on 100%.
[0046] Preferably, the elution includes mixing 40% - 60% of the fifth elution buffer and 40% - 60% of the sixth elution buffer by volume percentage based on 100%.
[0047] Preferably, the cultivation includes strain resuscitation and fermentation cultivation.
[0048] Preferably, the strain resuscitation includes performing primary seed cultivation and secondary seed cultivation in sequence.
[0049] Preferably, the medium for secondary seed culture contains tryptone, yeast extract, and NaCl.
[0050] Preferably, the conditions for fermentation culture include:
[0051] The temperature is 36 - 38 °C, the pH value is 6.8 - 7.2, the DO series speed maintains DO ≥ 30%, when OD 600 is above 7, the dissolved oxygen rises rapidly (DO Spike) and the pH increases by ≥ 0.1 unit / min, feeding is carried out, the flow rate in the first hour is 95 - 105 mL / h, and then the flow rate is adjusted to 100 - 200 mL / h, and the ventilation volume is automatically adjusted to maintain 30 - 40% DO.
[0052] In the present invention, the design of high-density fermentation culture conditions helps to increase the protein production.
[0053] Preferably, the conditions for fermentation culture include:
[0054] The culture is set at 37 °C, the stirring speed is 100 - 300 rpm, the ventilation volume is automatically adjusted to about 30 L / min, the pH is adjusted by automatically adding ammonia water or 2M H2SO4 through the system to maintain the pH value of the culture system at about 7.0. From 0 - 5 h, the temperature is step-controlled at 37.00 + 0.05 °C, pH 7.0 + 0.05, the tank pressure is 0.05 MPa, the ventilation volume is 20 - 40 L / min, and the DO series speed (200 - 600 rpm) maintains DO ≥ 30% until the speed reaches 600 rpm and then remains constant until the end of fermentation. The DO is about 30% in the first 5 h of fermentation. After 5 h, when OD 600 is above 7 at this time, DO Spike, the pH increases by ≥ 0.1 unit / min, and feeding starts. At this time, the carbon source in the medium is basically exhausted. The flow rate in the first hour is 100 mL / h, and then the flow rate is adjusted according to the growth status of the bacteria to 100 - 200 mL / h, and the ventilation volume is automatically adjusted to maintain 30 - 40% dissolved oxygen.
[0055] Preferably, the basic medium for fermentation contains 16 g / L tryptone, 10 g / L yeast extract, 6 g / L NaCl, 40 g / L glucose, 2 g / L KH2PO4, 4 g / L K2HPO4, 7 g / L Na2HPO4·12H2O, 1.2 g / L (NH4)2SO4, 0.2 g / L NH4Cl, 1 g / L MgSO4·7H2O.
[0056] Preferably, the feeding medium contains 70 g / L glucose, 83 g / L yeast, 83 g / L tryptone, and 6.7 g / L MgSO4·7H2O.
[0057] Preferably, the medium for secondary seed culture contains 10 - 20 g / L tryptone (more preferably 13 - 17), 5 - 11 g / L yeast extract (more preferably 9 - 11), and 3 - 7 g / L NaCl (more preferably 4 - 6).
[0058] The present invention designs a specific secondary seed culture medium, which can significantly improve the production speed of the strain and achieve rapid resuscitation.
[0059] Preferably, the inducer for induction includes isopropyl-β-D-thiogalactoside (IPTG).
[0060] Preferably, the working concentration of the isopropyl-β-D-thiogalactoside is 1 - 25 mM, preferably 1 - 3 mM, more preferably 0.8 - 1.2 mM, and preferably 1 mM.
[0061] In the present invention, by setting the IPTG concentration, the yield can be improved while the cost is saved.
[0062] Preferably, the start time of induction is 18 h after fermentation culture.
[0063] Preferably, the temperature for induction is 36 - 43 °C, preferably 37 - 42 °C, more preferably 41.5 - 42.5 °C, and preferably 42 °C.
[0064] In the present invention, by controlling a specific temperature during re-induction, the growth of the bacterial cells can be maintained for a longer time, which is beneficial to the accumulation of biomass.
[0065] Preferably, the induction time is 2 - 5 h, such as 2.5 h, 3 h, 3.5 h, 4 h, or 4.5 h, etc.
[0066] Preferably, after collecting the precipitate, it further includes the step of extracting inclusion bodies.
[0067] Preferably, extracting the inclusion bodies includes mixing the collected precipitate with an inclusion body lysate, collecting the supernatant, and obtaining an inclusion body solution.
[0068] In the present invention, the inclusion bodies are extracted using an inclusion body lysate containing guanidine hydrochloride. After high-speed centrifugation, the protein expression level in the obtained inclusion body lysate accounts for about 50% of the total protein amount. The purity is greatly improved after simple centrifugation treatment, which is suitable for large-scale production and actual operation.
[0069] Preferably, the inclusion body lysate contains Tris, NaCl, EDTA, and guanidine hydrochloride.
[0070] Preferably, the inclusion body lysate contains 50 mM Tris, 500 mM NaCl, 5 mM EDTA and 6 M guanidine hydrochloride.
[0071] As a preferred technical solution, the preparation method of the human basic fibroblast growth factor comprises the following steps:
[0072] (1) Take the host cells expressing the human basic fibroblast growth factor for primary seed culture, secondary seed culture and fermentation culture, and use isopropyl-β-D-thiogalactoside to induce the host cells to express the human basic fibroblast growth factor;
[0073] (2) Disrupt the cells, collect the precipitate and mix it with the inclusion body lysate, collect the supernatant to obtain the crude protein, perform the first chromatography on the crude protein, use any one or a combination of at least two of phenyl agarose gel, butyl agarose gel, n-butyl agarose gel or n-octyl agarose gel to pack the chromatography column, wash the chromatography column with the first equilibration buffer, load the sample, wash the miscellaneous proteins with the mixture of the first elution buffer and the second elution buffer until the baseline is stable, and then elute the target protein with the mixture of the first elution buffer and the second elution buffer; the inclusion body lysate contains Tris, NaCl, EDTA and guanidine hydrochloride, the first equilibration buffer contains Tris, urea, EDTA, NaCl and ammonium sulfate, the first elution buffer contains arginine, Tris, urea and EDTA, and the second elution buffer contains arginine, Tris, urea, EDTA and NaCl;
[0074] (3) Perform the second chromatography on the product collected in step (2), use any one or a combination of at least two of DEAE agarose gel, Q agarose gel or QAE agarose gel to pack the chromatography column, wash the chromatography column with the second equilibration buffer, load the sample, wash the miscellaneous proteins with the mixture of the third elution buffer and the fourth elution buffer until the baseline is stable, and then elute the target protein with the mixture of the third elution buffer and the fourth elution buffer, the second equilibration buffer contains Tris and urea, the third elution buffer contains Tris and urea, and the fourth elution buffer contains Tris, urea and NaCl;
[0075] (4) Perform a third chromatography on the product collected in step (3). Use SP Sepharose XL to pack a chromatography column, rinse the chromatography column with the third equilibration buffer, load the sample, perform renaturation rinsing with the renaturation buffer, rinse the miscellaneous proteins with a mixture of the fifth elution buffer and the sixth elution buffer until the baseline is stable, and then elute the target protein with a mixture of the fifth elution buffer and the sixth elution buffer. The third equilibration buffer contains sodium acetate, arginine, and urea. The renaturation buffer contains EDTA, sodium acetate, polyethylene glycol, arginine, and 2-(cyclohexylamino)ethanesulfonic acid. The fifth elution buffer contains sodium acetate and arginine. The sixth elution buffer contains sodium acetate, arginine, and NaCl.
[0076] Compared with the prior art, the present invention has the following beneficial effects:
[0077] The present invention designs a brand-new fermentation and purification process for human basic fibroblast growth factor, including designing high-density fermentation conditions to achieve high-density fermentation, controlling induction conditions to further increase protein production and save costs, and designing a two-step collaborative purification process and a specific renaturation process, which effectively improves the purity of the target protein, reduces the endotoxin content, saves production costs, and is suitable for process amplification from laboratory processes to industrial production levels; it is suitable for large-scale industrial production. Description of the Drawings
[0078] Figure 1 It is a growth curve graph of bacterial fermentation;
[0079] Figure 2 It is an SDS-PAGE gel diagram of bacterial proteins after induction at different temperatures;
[0080] Figure 3 It is an SDS-PAGE gel diagram of bacterial proteins after induction with different concentrations of inducer;
[0081] Figure 4 It is a schematic diagram of the high-density fermentation and purification operation process;
[0082] Figure 5 It is an SDS-PAGE gel diagram of bacterial proteins of the strain before and after induction;
[0083] Figure 6 It is an SDS-PAGE gel diagram of the inclusion body lysate and the bacteria after ultrasonic disruption;
[0084] Figure 7 It is for using Phenyl Sepharose TM 6FF chromatography process diagram;
[0085] Figure 8 It is for using Phenyl Sepharose TMSDS-PAGE gel image of the protein obtained by 6FF chromatography;
[0086] Figure 9 For the DEAE Sepharose TM FF chromatography process diagram in Example 5;
[0087] Figure 10 For the DEAE Sepharose TM SDS-PAGE gel image of the protein obtained by FF chromatography;
[0088] Figure 11 Results diagram of the purity and endotoxin content of the protein obtained in the first and second purification steps in Example 5;
[0089] Figure 12 For the DEAE Sepharose TM SDS-PAGE gel image of the protein obtained by FF chromatography in Comparative Example 2;
[0090] Figure 13 Process diagram of using SP Sepharose XL chromatography;
[0091] Figure 14 SDS-PAGE gel image of the protein obtained by using SP Sepharose XL chromatography;
[0092] Figure 15 Comparison diagram of the results of different renaturation methods;
[0093] Figure 16 SDS-PAGE gel image of the finally recovered protein;
[0094] Figure 17 Protein diagram after freeze-drying. Detailed implementation manners
[0095] To further illustrate the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.
[0096] The equipment used in the specific embodiments of the present invention is shown in Table 1.
[0097] Table 1
[0098]
[0099]
[0100] In a specific embodiment of the present invention, Escherichia coli E. coli BL21(DE3) expressing recombinant human basic fibroblast growth factor was taken as an example to verify the preparation method of the present invention.
[0101] The amino acid and nucleic acid sequences of recombinant human basic fibroblast growth factor (named CBDbFGF, theoretical isoelectric point 9.69, theoretical molecular weight 19271.99) are shown as follows:
[0102] M G T K K T L R T G T G S A G S A A G S G G V D A A G S I T T L P A LP E D G G S G A F P P G H F K D P K R L Y C K N G G F F L R I H P D G R V D GV R E K S D P H I K L Q L Q A E E R G V V S I K G V C A N R Y L A M K E D G RL L A S K C V T D E C F F F E R L E S N N Y N T Y R S R K Y T S W Y V A L K RT G Q Y K L G S K T G P G Q K A I L F L P M S A K S;
[0103] atgggtactaagaaaaccctgcgtactggtaccggtagcgcgggcagtgctgcgggttctggcggtgtcgacgcagccgggagcatcaccacgctgcccgccttgcccgaggatggcggcagcggcgccttcccgcccggccacttcaaggaccccaagcggctgtactgcaaaaacgggggcttcttcctgcgcatccaccccgacggccgagttgacggggtccgggagaagagcgaccctcacatcaagctacaacttcaagcagaagagagaggagttgtgtctatcaaaggagtgtgtgctaaccgttacctggctatgaaggaagatggaagattactggcttctaaatgtgttacggatgagtgtttcttttttgaacgattggaatctaataactacaatacttaccggtcaaggaaatacaccagttggtatgtggcactgaaacgaactgggcagtataaacttggatccaaaacaggacctgggcagaaagctatactttttcttccaatgtctgctaagagctga。
[0104] Example 1
[0105] Preparation of seed bacteria
[0106] 1. Glycerol stock culture: Thaw the E. coli BL21(DE3) glycerol stock culture expressing CBDbFGF stored at -80°C at 25°C (the seed bacteria are stored in 15% glycerol to prepare glycerol-preserved bacteria and cryopreserved at -80°C).
[0107] 2. Plate monoclonal: Inoculate onto an LB-kanamycin plate by the three-step streaking method and culture overnight at 37°C to grow monoclonal colonies.
[0108] 3. Primary seed: Transfer the plate monoclonal bacteria to 10 mL of 2YT (kanamycin 50 μg / mL), culture at 37°C and 200 rpm for 13 h.
[0109] 4. Secondary seed: Transfer 7% of the primary seed bacteria to 100 mL of 2YT medium (kanamycin 50 μg / mL), culture at 37°C and 200 rpm for 13 h
[0110] (Reagent 1) Seed Bacteria Medium Formula: Preparation volume is 1L. Weigh 15g of tryptone, 10g of yeast extract, and 5g of NaCl; add approximately 800mL of deionized water, stir well to dissolve; add 1N KOH dropwise to adjust the pH value to 7.0; add deionized water to make the volume of the medium up to 1L; after autoclaving, store at room temperature.
[0111] Optimization of the Seed Bacteria Medium Formula:
[0112] The formula composition and dosage of 1L of Type A Seed Bacteria Medium are: 15g of tryptone, 10g of yeast extract, 5g of NaCl, sterilized by water solution.
[0113] The formula composition and dosage of 1L of Type B Seed Bacteria Medium are: 15g of tryptone, 10g of yeast extract, 15g of NaCl, sterilized by water solution.
[0114] The formula composition and dosage of 1L of Type C Seed Bacteria Medium are: 10g of tryptone, 5g of yeast extract, 10g of NaCl, sterilized by water solution.
[0115] The formula composition and dosage of 1L of Type D Seed Bacteria Medium are: 10g of tryptone, 5g of yeast extract, 5g of NaCl, sterilized by water solution.
[0116] Detect the OD 600 value of the secondary seeds at different time points in 4 kinds of seed bacteria media. Note that the data at each time point is obtained from the average value of 3 groups of parallel samples. The results are shown in Table 2. Type A seed bacteria medium can promote the growth of bacteria faster, while Type B, C, and D seed bacteria media are relatively slower. Therefore, Type A seed bacteria medium is preferred.
[0117] Table 2
[0118] 0.5h 3h 6h 9h 12h 15h A 0.121 0.234 0.538 0.954 1.641 2.193 B 0.119 0.258 0.465 0.845 1.218 1.657 C 0.130 0.263 0.499 0.876 1.306 1.792 D 0.127 0.229 0.329 0.624 0.847 1.324
[0119] Example 2
[0120] Fermenter Preparation
[0121] 1. Fermenter sterilization: The total volume is 14L, the liquid filling volume is 8L. Before sterilization, add 1mL of antifoaming agent, calibrate the pH electrode, polarize the pH and DO electrodes by energization for ≥6h before preparation, calibrate the pH to 6.86 - 4.01 (with a slope of about 1.0), and calibrate the DO zero point with power off.
[0122] 2. Polarize the pH and DO electrodes by energization for ≥6h before preparation, calibrate the pH to 6.86 - 4.01 (with a slope of about 1.0), and calibrate the DO zero point with power off.
[0123] 3. Calibrate the flow rates of the 2M H2SO4 feeding bottle - acid pump and the ammonia water feeding bottle - alkali pump.
[0124] 4. Dissolve each component of the basal medium in 7.5 L of water, adjust the pH to 6.8, make up the volume to 8 L, transfer it to the fermenter, and add 1 mL of antifoaming agent.
[0125] 5. Install the electrodes, air filter, air supply conduit, and tail gas conduit (the end is wrapped with 16 layers of gauze and 4 layers of newspaper), seal the tank lid, feeding port, air supply conduit, and sampling tube, waterproof the electrode connectors and the rotating shaft with tin foil, and sterilize the tank at 121 °C for 20 min.
[0126] After cooling to 25 °C, when installing the fermenter, supply air, supply condensed water, and power on (motor, temperature probe, pH electrode, and DO electrode) in sequence, set the rotation speed to 200 rpm, keep the temperature constant at 37 °C, connect the acid / alkali feeding bottle and exhaust the air.
[0127] 6. When at 37 °C, 200 rpm, air flow rate of 5 L / min, and tank pressure of 0.05 MPa, adjust the pH to 6.80 ± 0.05 with acid / alkali, calibrate the saturated DO, the slope < 5, and the smaller the slope, the smaller the deviation.
[0128] (Reagent 2) Basal medium (1 L):
[0129] Weigh 16 g of tryptone, 10 g of yeast extract, 6 g of NaCl, 40 g of glucose, 2 g of KH2PO4, 4 g of K2HPO4, 7 g of Na2HPO4·12H2O, 1.2 g of (NH4)2SO4, 0.2 g of NH4Cl, and 1 g of MgSO4·7H2O, add about 800 mL of deionized water, stir well to dissolve; add dropwise 1 N KOH to adjust the pH value to 7.0; add deionized water to make up the volume of the medium to 1 L; after high temperature and high pressure, store it at room temperature.
[0130] (Reagent 3) The formula composition and dosage of the feeding medium for 1 L are: 70 g of glucose, 83 g of yeast, 83 g of tryptone, and 6.7 g of MgSO4·7H2O.
[0131] Example 3
[0132] This example designs the induction conditions.
[0133] Selection of induction temperature
[0134] Inoculate the secondary seed bacteria into the fermenter at an inoculation amount of 8%, add 10 mL of kanamycin (final concentration 50 μg / mL) before inoculation, and perform aseptic operation throughout the process; set the fermentation temperature in the fermenter at 37 °C, the stirring speed at 100 - 300 rpm, the aeration volume is automatically adjusted to about 30 L / min, and the pH is adjusted by automatically adding ammonia water or 2M H2SO4 through the system to maintain the pH value of the culture system at about 7.0. From 0 to 5 h, the temperature is step-controlled at 37.00 + 0.05 °C, pH 7.0 + 0.05, tank pressure 0.05 MPa, and the aeration volume is 20 - 40 L / min. The DO is in series with the rotation speed (200 - 600 rpm) to maintain DO ≥ 30% until the rotation speed reaches 600 rpm and then the rotation speed is constant until the end of fermentation. The DO is about 30% in the first 5 h of fermentation. After 5 h, when OD 600 is above 7 at this time, DO spikes, the pH increases by ≥ 0.1 unit / min, and feeding starts. At this time, the carbon source in the medium is basically exhausted. The flow rate in the first hour is 100 mL / h, and then the flow rate is adjusted to 100 - 200 mL / h according to the growth status of the bacteria. The aeration volume is automatically adjusted to maintain a dissolved oxygen of 30 - 40%. Defoamer is added regularly. The logarithmic phase is approximately from 6 h to the end of the 18th h. During this period, the DO is adjusted to about 40%. After the 16th h of fermentation, OD 600 is above 50. According to Figure 1 the shown bacterial fermentation growth curve, after 18 h, the bacterial growth enters the lag phase, no longer in the logarithmic growth phase, the bacterial vitality decreases, the number of dead bacteria increases, and the cell density begins to gradually decrease. Since the cell density has a greater impact on the protein expression level, the induction efficiency is the highest when the bacteria maintain a high density, so the preferred induction time is 4 h. At the same time, we found that appropriately increasing the culture temperature helps to maintain a high density of the bacteria and also helps to increase the expression level of the target protein.
[0135] Scheme A: At the 17th h of fermentation, the temperature of the fermenter needs to be adjusted to 42 °C, and the temperature is step-controlled at 42.0 °C ± 0.05 °C. The DO is in series with the rotation speed (200 - 600 rpm) to maintain DO ≥ 30% until the rotation speed reaches 600 rpm and then the rotation speed is constant. After stabilizing for more than 0.5 h, add 1 mM IPTG at 18 h to induce protein expression, and end the harvest of bacteria after 4 h of induction. After 18 h, the growth rate of the bacteria during the protein expression induction period slows down, and the feeding rate is correspondingly reduced. During the subsequent process of fermentation, samples are taken once per hour to detect the biomass (OD 600 , wet weight, residual sugar content), prepare electrophoresis samples from the 10-fold diluted fermentation broth and perform electrophoresis detection of the expression level after the end of fermentation. In the middle and late logarithmic phase, OD 600 is above 60. The entire fermentation process can be completed within 24 h, and the biomass accumulates to OD 600 above 50 at the end.
[0136] Scheme B: At the 17th hour of fermentation, the temperature of the fermenter is not adjusted and remains at 37°C. The temperature step control is 37.0°C ± 0.05°C. The DO is in series with the rotation speed (200 - 600 rpm) to maintain DO ≥ 30%, until the rotation speed reaches 600 rpm and then the rotation speed is constant. At 18 h, 1 mM IPTG is added to induce protein expression, and the bacteria are harvested after 4 h of induction. After 18 h, during the period of induced protein expression, the growth rate of the bacteria slows down, and the feeding rate is correspondingly reduced. During the process after fermentation, samples are taken once per hour to detect the biomass (OD 600 ), wet weight, and residual sugar content). The fermented liquid diluted 10 times is prepared into an electrophoresis sample and subjected to electrophoresis detection of the expression level after fermentation. In the middle and late logarithmic phase, OD 600 is above 40.
[0137] For Scheme A and B, during the whole fermentation process, samples of bacteria in the tank are taken once per hour to detect OD 600 , and the results are compared continuously for 24 h. As Figure 1 shown, it is found that the growth rate of the bacteria slows down at 18 h. At this time, when the temperature of the fermenter is raised to 42°C compared with the tank temperature remaining at 37°C, the growth of the bacteria can be maintained for a longer time, which is beneficial to the accumulation of biomass. Figure 1 The results show that the cell density in the tank sample at 42°C is higher than that at 37°C after culturing for 18 h. Does it mean that the protein expression amount per unit volume induced at 42°C will be significantly higher than that per unit volume of bacteria at 37°C after induction? Through the analysis of the results of the SDS-PAGE gel diagram, it is proved that the protein expression amount induced at 42°C will be significantly higher than that at 37°C, as Figure 2 shown.
[0138] Screening of inducer concentration
[0139] At the 17th hour of fermentation, the temperature of the fermenter needs to be raised to 42°C, and the temperature step control is 42.0°C ± 0.05°C. The DO is in series with the rotation speed (200 - 600 rpm) to maintain DO ≥ 30%, until the rotation speed reaches 600 rpm and then the rotation speed is constant. After stabilizing for more than 0.5 h, at 18 h, 1 mM IPTG is added to induce protein expression, and the bacteria are harvested after 4 h of induction. After 18 h, entering the induced protein expression period: We set four different dose points of 0.3 mM, 1 mM, 3 mM, 10 mM, and 25 mM. By sampling and running a 15% SDS-PAGE gel, according to the results of photographing by the gel imager, as Figure 3 shown, the expression amount of the target protein at 0.3 mM is slightly lower, and there is no obvious difference among the dose points of 1 mM, 3 mM, 10 mM, and 25 mM. Considering that IPTG is relatively expensive, in line with the principle of ensuring quality, saving costs, and increasing production, we choose 1 mM IPTG concentration as the optimal cost-effective parameter.
[0140] Example 4
[0141] In this example, high-density fermentation and purification were carried out, and the operation process is as Figure 4 shown.
[0142] 1. Inoculation: The secondary seed bacteria were inoculated into the A-type seed bacteria medium at an inoculation amount of 8%, and 10 mL of kanamycin (final concentration 50 μg / mL) was added before inoculation. The whole process was carried out under aseptic conditions;
[0143] 2. Fermentation: The culture was set at 37 °C, the stirring speed was 100 - 300 rpm, the aeration volume was automatically adjusted to about 30 L / min, and the pH was adjusted by automatically adding ammonia water or 2M H2SO4 through the system to maintain the pH value of the culture system at about 7.0. From 0 to 5 h, the temperature was step-controlled at 37.00 + 0.05 °C, pH 7.0 + 0.05, the tank pressure was 0.05 MPa, the aeration volume was 20 - 40 L / min, and the DO in series with the rotation speed (200 - 600 rpm) was maintained at DO ≥ 30% until the rotation speed reached 600 rpm and then the rotation speed was kept constant until the end of fermentation. Before 5 h of fermentation, the DO was about 30%. After 5 h, when the OD 600 was above 7 at this time, DO Spike occurred, the pH increased by ≥ 0.1 unit / min, and feeding started. At this time, the carbon source in the medium was basically exhausted. The flow rate in the first hour was 100 mL / h, and then the flow rate was adjusted to 100 - 200 mL / h according to the growth status of the bacteria. The aeration volume was automatically adjusted to maintain a dissolved oxygen of 30 - 40%, and antifoaming agent was added regularly. The logarithmic phase was approximately from 6 h to the end of the 18th h, and during this period, the DO was adjusted to about 40%. After the 16th h of fermentation, the OD 600 was above 50. At the 17th h of fermentation, the temperature of the fermenter needed to be adjusted to 42 °C, and the temperature was step-controlled at 42.0 °C ± 0.05 °C. The DO in series with the rotation speed (200 - 600 rpm) was maintained at DO ≥ 30% until the rotation speed reached 600 rpm and then the rotation speed was kept constant. After stabilizing for more than 0.5 h, 1 mM IPTG was added at 18 h to induce protein expression, and the bacteria were harvested after 4 h of induction. After 18 h, the growth rate of the bacteria during the induction of protein expression slowed down, and the feeding rate was correspondingly reduced. During the subsequent process of fermentation, samples were taken once per hour to detect the biomass (OD 600 , wet weight, residual sugar content), and the 10-fold diluted fermentation broth was prepared as an electrophoresis sample and the expression level was detected by electrophoresis after the end of fermentation. In the middle and late logarithmic phase, the OD 600 was above 60. The whole fermentation process could be completed within 24 h. At the end, the biomass accumulated to an OD 600 above 40, and the wet weight was ≥ 100 g / L. The tail gas generated during fermentation was filtered through a 0.22 μm membrane and discharged, and there were no environmental pollution problems during the whole fermentation process.
[0144] 3. Harvesting bacteria from the fermenter: After fermentation is completed, the fermentation broth is aseptically discharged, centrifuged (8000 rpm, 4 °C, 30 min), and the bacteria are collected. The bacteria need to be washed once with PBS buffer and then centrifuged again (8000 rpm, 4 °C, 30 min).
[0145] (Reagent 4) Fed-batch medium 1 L: 70 g glucose, 83 g yeast, 83 g tryptone, 6.7 g MgSO4·7H2O, trace elements (1000×) 30 mL.
[0146] (Reagent 5) 500 mL sterile fed-batch bottle containing 200 mL of 25%-28% ammonia water.
[0147] (Reagent 6) Dilute sulfuric acid: 50 mL of concentrated sulfuric acid is slowly dissolved in 100 mL of water, and the volume is made up to 200 mL to prepare 2 M H2SO4, which is filled in a 500 mL sterile fed-batch bottle.
[0148] (Reagent 7) Kanamycin (concentration: 50 mg / mL): Filter sterilized, aseptically dispensed into 5 mL / 15 mL centrifuge tubes, and stored at -20 °C.
[0149] (Reagent 8) IPTG (concentration: 1 M): 23.8 g is dissolved in 100 mL of water, filter sterilized, aseptically dispensed into 5 mL / 15 mL centrifuge tubes, and stored at -20 °C.
[0150] Seed testing
[0151] 1. Shake flask: Inoculate the secondary seed bacteria at a ratio of 1:1000 into a 1000 mL Erlenmeyer flask containing 200 mL of 2YT medium, and culture at 37 °C and 200 rpm for 10 h. Then, lower the culture temperature to 30 °C and continue culturing for 10 h.
[0152] 2. Sample preparation: Take 30 μL of the shake flask bacterial solution and mix it with an equal volume of 2× loading buffer to prepare the pre-induction electrophoresis sample; take 30 μL of the fermenter fermentation broth before centrifugation and mix it with an equal volume of 2× loading buffer to prepare the post-induction electrophoresis sample.
[0153] 3. Electrophoresis: 12% separating gel, load 5 μL per lane, and electrophorese until the bromophenol blue front runs out of the gel. After rinsing the gel with deionized water, stain it with a rapid staining solution until the bands are clear, then rinse with deionized water to remove the light blue background, and photograph to record the electrophoresis results. As Figure 5 shown, SDS-PAGE detection shows that a new band appears at about 19 kD in the post-induction sample compared to the pre-induction sample, indicating that the bacterial strain is qualified.
[0154] Ultrasonic disruption
[0155] Take a certain amount of fermented bacteria cells and resuspend them by pipetting with lysis buffer at a ratio of 1:100 (m / v). In an ice-water bath, homogenize the cells using a high-pressure homogenizer for 5 min, and then break the cells using an ultrasonic crusher in the ice-water bath. The ultrasonic crushing parameters are (5 s working, 5 s intermittent, 120 min, 1000 w) until the bacterial solution is no longer viscous. After staining and smearing, and microscopic examination, when there are basically no intact bacteria cells, centrifuge (12000 rpm, 4 °C, 30 min) to collect the precipitate.
[0156] Dissolve the precipitate with 200 mL of inclusion body lysis solution containing 6 M guanidine hydrochloride, and then centrifuge (12000 rpm, 16 °C, 30 min) to obtain the inclusion body lysis solution. After filtering successively through a 0.45 μm filter and a 0.22 μm filter. The results of SDS-PAGE electrophoresis are as Figure 6 shown. Lanes 1 and 2 are the bacteria cells after ultrasonic crushing, and lane 3 is the inclusion body lysis solution. It can be seen that the expression level of the target protein accounts for about 20% - 30% of the total protein amount and can stably exist in the lysis buffer. After high-speed centrifugation, the protein expression level of the inclusion body lysis solution dissolved with 6 M guanidine hydrochloride accounts for about 50% of the total protein amount. The purity has been greatly improved after simple centrifugation treatment, which is suitable for large-scale production and actual operation.
[0157] Lysis buffer: 50 mM Tris, 200 mM arginine, 5 mM EDTA, 1 mM PMSF; pH 8.3.
[0158] Inclusion body lysis solution: 50 mM Tris, 500 mM NaCl, 5 mM EDTA, 6 M guanidine hydrochloride, pH 8.3.
[0159] Example 5
[0160] This example is for purification.
[0161] Equipment model: AKTApilot from GE Company, chromatography system, UNICORN control system.
[0162] 1. Purification step one
[0163] Loading specification of chromatography column 1: Column bed volume 1 L, column inner diameter 100 mm.
[0164] Chromatography medium 1: Phenyl Sepharose TM 6FF(HS)(Cytiva, 17097303).
[0165] Equilibrium buffer 1: final concentration of 50 mM Tris, final concentration of 6 M urea; final concentration of 5 mM EDTA; 500 mM NaCl; 500 mM ammonium sulfate, pH 8.3.
[0166] Elution buffer A1: final concentration of 200 mM arginine, final concentration of 50 mM Tris, final concentration of 5 mM EDTA, final concentration of 6 M urea; pH 8.3.
[0167] Elution buffer B1: final concentration of 200 mM arginine, final concentration of 50 mM Tris, final concentration of 5 mM EDTA, final concentration of 6 M urea, final concentration of 1.0 M NaCl; pH 8.3.
[0168] Wash Buffer A1: final concentration of 50 mM Tris, final concentration of 1.0 M NaCl, final concentration of 8 M urea; pH 9.0.
[0169] Wash buffer B1: 50 mM acetic acid - sodium acetate buffer, final concentration of 1.0 M NaCl, final concentration of 8 M urea; pH 4.0.
[0170] Wash buffer C1: final concentration of 0.5 M NaOH, final concentration of 0.5 M NaCl.
[0171] The first - step purification process designed in the present invention has the advantages of high flow rate, high loading capacity, and high - salt tolerance. The extract can be directly loaded onto the chromatography column, and the purification mode in which the target protein binds to the chromatography column and the unbound protein flows through greatly shortens the process time. Elution buffer A1 and elution buffer B1 are used for co - linear salt gradient elution, which can preliminarily separate the target protein and endotoxin, ensuring that 80% of the endotoxin can be removed, effectively reducing the endotoxin content in the target protein. However, some endotoxin will still be eluted together with the protein and cannot be removed. The separation is monitored by measuring the absorbance at 280 nm and 490 nm.
[0172] Specific steps:
[0173] 1.1 After ultrasonic disruption of the bacterial cells, 500 mL of the inclusion body solution is diluted to 2500 mL with 2000 mL of the equilibrium buffer.
[0174] 1.2 Rinse the column with 3000 mL of equilibrium buffer 1 to balance the column in an appropriate stable buffer system, with a flow rate of 100 mL / min.
[0175] 1.3 Load the processed chromatography column with the sample. Pass the sample buffer solution through the chromatography column at a flow rate of 100 mL / min. The sample loading volume is 2000 mL ± 100 mL.
[0176] 1.4 Use an elution buffer B1 at 80% (volume fraction) + elution buffer A1 at 20% (volume fraction) to wash away the impurity proteins at a flow rate of 20 mL / min for 3 column volumes until the baseline of the effluent is stable.
[0177] 1.5 Start with an elution buffer B1 at 80% (volume fraction) + elution buffer A1 at 20% (volume fraction) at a flow rate of 20 mL / min and end with an elution buffer B1 at 30% (volume fraction) + elution buffer A1 at 70% (volume fraction), linearly wash for 1 column volume to elute the target protein. Start collecting when the absorbance at 280 nm in the UV peak diagram exceeds 50 mAU, and stop collecting when the detected peak drops back to 50 mAU near the baseline. The elution time is 15 min. The manually collected eluate is the target protein, with a volume of approximately 300 mL. The chromatography process is as Figure 7 shown by the red arrow. Analyze the results by SDS-PAGE electrophoresis. As Figure 8 shown, the purity of the target protein is above 70%; and the endotoxin of the collected protein is detected by the Limulus reagent gel method to be less than 200 EU / mg.
[0178] 1.6 Late-stage maintenance process of the chromatography column: Use a flow rate of 100 mL / min and alternately wash the chromatography column 1 with washing buffer A1 and washing buffer B1 for a total of 3 times (washing buffer A1 solution: 1.5 column volumes, washing buffer B1 solution: 1.5 column volumes; washing buffer A1 solution: 1.5 column volumes, washing buffer B1 solution: 1.5 column volumes; washing buffer A1 solution: 1.5 column volumes, washing buffer B1 solution: 1.5 column volumes). Wash the affinity chromatography column with washing buffer C1 for more than 60 min. The volume of washing buffer C1 solution is 1.5 column volumes. Let it stand for 30 min and then wash another 1.5 column volumes; wash with water for 3 column volumes and wash with 20% ethanol solution for 1.5 column volumes at a flow rate of 100 mL / min. The flow direction of the regeneration solution in the column is opposite to the sample flow direction during sample loading and purification to ensure stable and reliable column efficiency;
[0179] 1.7 Finally, rinse the affinity column and all the passages of the entire system with 50 L of sterile water at a low flow rate of 20 mL / min, and finally fill the affinity column and the entire equipment pipeline system with 20% ethanol.
[0180] 2. Purification step two
[0181] Chromatography medium 2: DEAE Sepharose TM FF (Cytiva, 17070905).
[0182] The specifications of the weak anion exchange chromatography column used: column bed volume 1.0 L, column inner diameter 100 mm
[0183] Equilibration buffer 2: final concentration of 50 mM Tris, final concentration of 6 M urea; pH 8.3.
[0184] Elution buffer A2: final concentration of 50 mM Tris, final concentration of 6 M urea; pH 8.3.
[0185] Elution buffer B2: final concentration of 50 mM Tris, final concentration of 6 M urea, final concentration of 1 M NaCl; pH 8.3.
[0186] Washing buffer A2: 1.0 M aqueous NaOH solution.
[0187] Washing buffer B2: 50 mM acetic acid - sodium acetate buffer, final concentration of 1.0 M NaCl, final concentration of 8 M urea; pH 4.0.
[0188] Specific operation:
[0189] 2.1 Flush the column with equilibration buffer 2 at a flow rate of 100 mL / min for 2000 mL until the baseline is leveled.
[0190] 2.2 For the sample collected in step 1.5, dilute it with equilibration buffer 2 at a ratio of 1:3 (V / V), that is, for 300 mL of the sample from the first purification step, mix it well with 900 mL of equilibration buffer 2, and load the sample at a flow rate of 100 mL / min during this period.
[0191] 2.3 Flush the impurities with 13% (volume fraction) elution buffer B2 + 87% (volume fraction) elution buffer A2 at a flow rate of 20 mL / min, and flush 1 column volume with 32% (volume fraction) elution buffer B2 + 68% (volume fraction) elution buffer A2 to elute the target protein. Start collecting when the absorbance at 280 nm in the UV peak diagram exceeds 50 mAU, and stop collecting when the detected peak drops back to 50 mAU near the baseline. The elution time is 20 min. The manually collected eluate is the target protein, with a volume of approximately 400 mL. The chromatography process is as Figure 9 shown. Analyze the results by SDS - PAGE electrophoresis. As Figure 10 shown, the purity of the target protein is above 90%; and the endotoxin of the collected protein is detected to be less than 200 EU / mg by the Limulus reagent gel method.
[0192] 2.4 Late-stage maintenance process of chromatography column: Use a flow rate of 100 mL / min, and rinse the chromatography column 2 with washing buffer A2 for 2 - 3 column volumes, wash with water for 3 column volumes, wash with washing buffer B2 for 3 column volumes), wash with water for 3 column volumes, wash with 20% ethanol for 1.5 column volumes, with a flow rate of 100 mL / min. The flow direction of the regeneration solution in the column is opposite to the sample flow direction during loading and purification to ensure stable and reliable column efficiency;
[0193] 2.4 Finally, rinse the affinity column and all passages of the entire system with 50 L of sterile water at a low flow rate of 20 mL / min, and finally fill the affinity column and the entire equipment pipeline system with 20% ethanol.
[0194] The second purification process designed in the present invention cooperates with the first step. Only by passing the sample through DEAE Sepharose TM FF once can the purity be increased from 70% to 90%, and the endotoxin content of the protein is greatly reduced, from more than 200 EU / mg to 20 EU / mg ( Figure 11 ).
[0195] Example 6
[0196] Purification is carried out in this example.
[0197] Compared with Example 5, the only difference is:
[0198] Chromatography medium 1: Butyl Sepharose (Cytiva, 17097803).
[0199] Equilibration buffer 1: Final concentration of 40 mM Tris, final concentration of 7 M urea (Urea); final concentration of 6 mM EDTA; 400 mM NaCl; 600 mM ammonium sulfate.
[0200] Elution buffer A1: Final concentration of 170 mM arginine, final concentration of 40 mM Tris, final concentration of 3 mM EDTA, final concentration of 5 M urea;
[0201] Elution buffer B1: Final concentration of 230 mM arginine, final concentration of 40 mM Tris, final concentration of 9 mM EDTA, final concentration of 5 M urea, final concentration of 0.8 M NaCl;
[0202] In step 1.4, use a flow rate of 20 mL / min to rinse the miscellaneous proteins with 75% (volume fraction) elution buffer B1 + 25% (volume fraction) elution buffer A1 for 3 column volumes until the baseline of the effluent is stable.
[0203] In step 1.5, use an elution buffer B1 flow rate of 20 mL / min starting with 75% (v / v) elution buffer B1 + 25% (v / v) elution buffer A1 and ending with 35% (v / v) elution buffer B1 + 65% (v / v) elution buffer A1, linearly rinse for 1 column volume to elute the target protein.
[0204] Chromatography medium 2: QAE Sepharose (Cytiva, 17019003)
[0205] Equilibration buffer 2: Final concentration of 40 mM Tris, final concentration of 7 M urea;
[0206] Elution buffer A2: Final concentration of 40 mM Tris, final concentration of 5 M urea;
[0207] Elution buffer B2: Final concentration of 60 mM Tris, final concentration of 7 M urea, final concentration of 1.2 M NaCl;
[0208] In step 2.3, use an elution buffer B2 flow rate of 20 mL / min to rinse impurities with 20% (v / v) elution buffer B2 + 80% (v / v) elution buffer A2, and rinse for 1 column volume with 40% (v / v) elution buffer B2 + 60% (v / v) elution buffer A2 to elute the target protein.
[0209] The chromatography process and purification results are similar to those in Example 5.
[0210] Example 7
[0211] This example performs purification.
[0212] Compared with Example 5, the only difference is:
[0213] Chromatography medium 1: Butyl Sepharose (Cytiva, 17098004).
[0214] Equilibration buffer 1: Final concentration of 60 mM Tris, final concentration of 5 M urea (Urea); final concentration of 4 mM EDTA; 600 mM NaCl; 400 mM ammonium sulfate.
[0215] Elution buffer (elution buffer) A1: Final concentration of 230 mM arginine, final concentration of 40 mM Tris, final concentration of 9 mM EDTA, final concentration of 7 M urea;
[0216] Elution buffer B1: Final concentration of 170 mM arginine, final concentration of 60 mM Tris, final concentration of 3 mM EDTA, final concentration of 7 M urea, final concentration of 1.2 M NaCl;
[0217] In step 1.4, the flow rate of 20 mL / min was used to wash the miscellaneous proteins with 85% (volume fraction) elution buffer B1 + 15% (volume fraction) elution buffer A1 for 3 column volumes until the baseline of the effluent was stable.
[0218] In step 1.5, starting with 85% (volume fraction) elution buffer B1 + 15% (volume fraction) elution buffer A1 at a flow rate of 20 mL / min and ending with 25% (volume fraction) elution buffer B1 + 75% (volume fraction) elution buffer A1, the target protein was eluted by linearly washing for 1 column volume.
[0219] Chromatography medium 2: Q Sepharose gel (Cytiva, 17051004)
[0220] Equilibration buffer 2: final concentration of 60 mM Tris, final concentration of 5 M urea;
[0221] Elution buffer A2: final concentration of 60 mM Tris, final concentration of 7 M urea;
[0222] Elution buffer B2: final concentration of 40 mM Tris, final concentration of 5 M urea, final concentration of 0.8 M NaCl;
[0223] In step 2.3, the flow rate of 20 mL / min was used to wash the impurities with 10% (volume fraction) elution buffer B2 + 90% (volume fraction) elution buffer A2, and the target protein was eluted by washing with 30% (volume fraction) elution buffer B2 + 70% (volume fraction) elution buffer A2 for 1 column volume.
[0224] The chromatography process and purification results were similar to those in Example 5.
[0225] Comparative Example 1
[0226] This comparative example was different from Example 5 only in that Sephadex TM G-25 was used to replace DEAE Sepharose TM FF for chromatography.
[0227] Purification step 1
[0228] Refer to Example 5.
[0229] Purification step 2
[0230] Chromatography medium: Sephadex TM G-25 (Cytiva, 17508702).
[0231] Elution buffer G: containing KH2PO4 at a final concentration of 0.27 g / L, Na2HPO4·12H2O at 1.42 g / L, KCl at 0.2 g / L, and NaCl at 8.8 g / L, pH 7.3 adjusted with phosphoric acid.
[0232] Washing buffer A3: 1.0 M aqueous NaOH solution at final concentration.
[0233] 1. Use pump A to elute with elution buffer G at a flow rate of 200 mL / min for 5 column volumes to level the baseline.
[0234] 2. Use pump B at a flow rate of 200 mL / min, and the sample is the target protein sample obtained in the first purification step above, with a sample loading volume of 50 mL.
[0235] 3. Use pump A to elute the target protein with elution buffer G at a flow rate of 200 mL / min. According to the UV peak diagram, start collecting when the UV wavelength at 280 nm during the peak rise is detected above 50 mAU, and stop collecting when the detected peak drops back to around 50 mAU. The collected eluate is the target protein.
[0236] Analyze the results by SDS-PAGE electrophoresis. The purity of the target protein is above 70%; and the endotoxin of the collected protein is detected to be less than 200 EU / mg by the Limulus reagent gel method.
[0237] Comparative Example 2
[0238] The difference between this comparative example and Example 5 is only that Sephadex TM G-25 is used to replace PhenylSepharose TM 6FF in the first purification step.
[0239] The first purification step
[0240] Chromatography medium: Sephadex TM G-25 (Cytiva, 17508702).
[0241] Elution buffer G: containing KH2PO4 at a final concentration of 0.27 g / L, Na2HPO4·12H2O at 1.42 g / L, KCl at 0.2 g / L, and NaCl at 8.8 g / L, pH 7.3 adjusted with phosphoric acid.
[0242] Washing buffer A3: 1.0 M aqueous NaOH solution at final concentration.
[0243] 1. Use pump A to elute with elution buffer G at a flow rate of 200 mL / min for 5 column volumes to level the baseline.
[0244] 2. The pump B uses a flow rate of 200 mL / min, and the sample loading volume (inclusion body solution) is 50 mL.
[0245] 3. The pump A uses a flow rate of 200 mL / min to elute the target protein with elution buffer G. According to the UV peak graph, collection starts when the UV wavelength at 280 nm during peak emergence is detected to be higher than 50 mAU, and stops when the detected peak drops back to around 50 mAU. The collected eluate is the target protein.
[0246] Purification step two
[0247] Refer to Example 5
[0248] Analyze the results by SDS-PAGE electrophoresis, as Figure 12 shown. Lane 1 is the ultrasonic lysate of the bacterial cells; lane 2 is the purified sample, and the purity of the target protein is about 75%; and the endotoxin of the collected protein detected by the Limulus reagent gel method is less than 300 EU / mg.
[0249] It can be seen from the data comparison in Table 3 that when using chromatography packing materials Phenyl and Sephadex TM G-25, DEAE and Sephadex TM G-25 for purification, the purity of the samples is relatively low and the endotoxin residue is relatively high. However, with the special design of the invention, using the two-step combination of chromatography packing materials Phenyl and DEAE for purification, not only the endotoxin content is greatly reduced, but also the purity of the sample can be increased to more than 90%.
[0250] Table 3
[0251] Sample purity Endotoxin content Two-step purification of DEAE and G-25 75% Less than 300 EU / mg Two-step purification of Phenyl and G-25 70% Less than 200 EU / mg Two-step purification of Phenyl and DEAE 90% Less than 20 EU / mg
[0252] Example 8
[0253] This example performs purification step three (refolding) on the basis of the two-step purification in Example 5.
[0254] Cation exchange chromatography medium 3: SP Sepharose XL (Cytiva, 17507304)
[0255] The specifications of the cation exchange chromatography column used: column bed volume 1.0 L, column inner diameter 100 mm.
[0256] Equilibration buffer 3: Sodium acetate buffer with a final concentration of 100 mM, 100 mM arginine, 8 M urea; pH 5.7.
[0257] Elution buffer A3: Sodium acetate buffer with a final concentration of 30 mM, 100 mM arginine; pH 5.7.
[0258] Elution buffer B3: Sodium acetate buffer with a final concentration of 30 mM, arginine 100 mM, NaCl with a final concentration of 1 M; pH 5.7
[0259] Washing buffer A3: 1.0 M aqueous NaOH solution with a final concentration.
[0260] Washing buffer B3: 50 mM sodium acetate buffer, NaCl with a final concentration of 1.0 M, urea with a final concentration of 8 M; pH 4.0
[0261] Renaturation buffer system: EDTA with a final concentration of 1 mM, 50 mM sodium acetate buffer, polyethylene glycol 2000 at 5 g / L, arginine 100 mM, CHES (2 - cyclohexylaminoethanesulfonic acid) 150 mM; pH 5.7
[0262] Specific operation:
[0263] 3.1 First, rinse the column with equilibration buffer 3 at a flow rate of 100 mL / min for 3000 mL to level the baseline.
[0264] 3.2 Adjust the buffer sample collected in 2.3 of Example 5 with equilibration buffer 3, adjust the pH to 5.7, and the total volume is approximately 1000 mL.
[0265] 3.3 Load the sample from step 3.2 at a flow rate of 100 mL / min.
[0266] 3.4 Rinse the column with equilibration buffer 3 for 1000 mL to equilibrate the column in an appropriate stable buffer system at a flow rate of 100 mL / min;
[0267] 3.5 Continue to rinse the cation exchange chromatography medium column with equilibration buffer 3 and the renaturation buffer system in a linear gradient from 0 to 100% at a flow rate of 10 mL / min for 1.5 column volumes, and then continue to rinse with the renaturation buffer system at a flow rate of 10 mL / min for 1000 mL to level the baseline. The total volume of the renaturation solution is approximately 2 L.
[0268] 3.6 Wash out the miscellaneous proteins with an elution buffer B3 of 15% (volume fraction) + an elution buffer A3 of 85% (volume fraction) at a flow rate of 100 mL / min for 15 min without collection; wash out the target protein with an elution buffer B3 of 50% (volume fraction) + an elution buffer A3 of 50% (volume fraction) at a flow rate of 100 ml / min for 1000 mL to elute the target protein. According to the UV peak diagram, start collecting when the UV wavelength at the peak is detected to be higher than 50 mAU at 280 nm, and stop collecting when the detected peak drops back to around 50 mAU. The elution time is 3 min. The manually collected eluate is the target protein with a volume of approximately 200 mL; wash out the miscellaneous proteins with an elution buffer B3 of 100% (volume fraction) at a flow rate of 100 mL / min for 3 column volumes to elute the miscellaneous proteins without collection, and stop eluting when the detected peak drops back to near the baseline. The entire process is as Figure 13 shown; the resulting sample is analyzed by SDS-PAGE electrophoresis, and as Figure 14 shown, the purity of the target protein is 98%; and the endotoxin of the collected protein is detected by the Limulus reagent gel method to be 5 EU / mg.
[0269] 3.7 Wash the column with sterile purified water at a flow rate of 100 mL / min for 3000 mL to level the baseline. Wash with a washing buffer A3 of 50% (volume fraction) + sterile purified water of 50% (volume fraction) at a flow rate of 100 mL / min for 60 min. Then wash with 100% (volume fraction) sterile purified water for 5000 mL to level the baseline.
[0270] Wash with a washing buffer B3 of 100% (volume fraction) at a flow rate of 100 mL / min for 60 min. Then wash with 100% (volume fraction) sterile purified water for 5000 mL to level the baseline. Finally, store it in a 20% ethanol solution.
[0271] In the prokaryotic expression system, inclusion body proteins usually need to be dissolved in 6M guanidine hydrochloride or 8M urea. The denatured protein needs to be renatured to the native conformation of the protein to have biological functions. Our process method selects chemically stable Sepharose (agarose) gel filtration packing materials (Phenyl Sepharose TM 6FF, DEAE Sepharose TMPurification and renaturation were carried out under denaturing conditions using FF and SP Sepharose XL. Process advantages: Avoid the formation of protein aggregates during the general renaturation process, so the renaturation yield is higher, and there is no need to dilute the sample in large quantities. Combining renaturation and purification into one greatly saves time and increases the recovery rate. Moreover, this method is suitable for industrialization. Firstly, it is very suitable for the process scale-up from laboratory processes to industrial production levels. Secondly, the chromatography packing material used has a high loading capacity, fast flow rate, simple packing, high column efficiency, and is easy to clean, disinfect and regenerate, so the packing life is very long. Therefore, the protein biomolecules purified by this method have extremely high cost performance and are suitable for large-scale industrial production.
[0272] Example 9
[0273] In this example, purification step three (renaturation) was carried out on the basis of the two-step purification in Example 5. Compared with Example 8, the only difference is:
[0274] Equilibration buffer 3: Sodium acetate buffer with a final concentration of 90 mM, 110 mM arginine, 7 M urea;
[0275] Elution buffer A3: Sodium acetate buffer with a final concentration of 20 mM, 90 mM arginine;
[0276] Elution buffer B3: Sodium acetate buffer with a final concentration of 40 mM, 110 mM arginine, and a final concentration of 1.2 M NaCl;
[0277] Renaturation buffer system: Final concentration of 0.5 mM EDTA, 20 mM sodium acetate buffer, 8 g / L polyethylene glycol 2000, 200 mM arginine, 100 mM CHES (2-cyclohexylaminoethanesulfonic acid);
[0278] In step 3.6, the flow rate of 100 mL / min was used to wash the miscellaneous proteins with 20% (volume fraction) elution buffer B3 + 80% (volume fraction) elution buffer A3 for 15 min without collection; the flow rate of 100 ml / min was used to wash the target protein with 40% (volume fraction) elution buffer B3 + 60% (volume fraction) elution buffer A3 for 1000 mL to elute the target protein.
[0279] The chromatography process and renaturation results are similar to those in Example 8.
[0280] Example 10
[0281] In this example, purification step three (renaturation) was carried out on the basis of the two-step purification in Example 5. Compared with Example 8, the only difference is:
[0282] Equilibration buffer 3: Sodium acetate buffer with a final concentration of 110 mM, 90 mM arginine, 9 M urea;
[0283] Elution buffer A3: Sodium acetate buffer with a final concentration of 40 mM and arginine with a final concentration of 100 mM;
[0284] Elution buffer B3: Sodium acetate buffer with a final concentration of 20 mM, arginine with a final concentration of 90 mM, and NaCl with a final concentration of 0.8 M;
[0285] Renaturation buffer system: EDTA with a final concentration of 2 mM, sodium acetate buffer with a final concentration of 80 mM, polyethylene glycol 2000 with a concentration of 3 g / L, arginine with a final concentration of 100 mM, and CHES (2-cyclohexylaminoethanesulfonic acid) with a final concentration of 200 mM;
[0286] In step 3.6, the flow rate of 100 mL / min was used to wash the impurity proteins with 10% (volume fraction) elution buffer B3 + 90% (volume fraction) elution buffer A3, and the elution time was 15 min without collection; the flow rate of 100 ml / min was used to wash the target protein with 60% (volume fraction) elution buffer B3 + 40% (volume fraction) elution buffer A3, and 1000 mL was eluted to obtain the target protein.
[0287] The chromatography process and renaturation results were similar to those in Example 8.
[0288] Example 11
[0289] In this example, the dilution renaturation method and dialysis renaturation method were selected for renaturation.
[0290] Generally, the higher the purity of the inclusion body protein sample, the better the renaturation effect. Therefore, for the sample used for renaturation, the sample collected in step 2.3 of Example 5 was selected. The volume of this sample was approximately 400 mL. If it was diluted 20 times, approximately 8 L of renaturation solution would be required. Just this one production step increased the production cost by 4 times; moreover, the renaturation time of the general dilution method was about 5 days.
[0291] The dialysis renaturation method was selected. Generally, the higher the purity of the inclusion body protein sample, the better the renaturation effect. Therefore, for the sample used for renaturation, the sample collected in step 2.3 of Example 5 was selected. The volume of this sample was approximately 400 mL. It was placed in a dialysis bag and immersed in 3600 mL of renaturation solution. The renaturation solution was changed every 24 h for 3 consecutive days, and a total of 10.8 L of renaturation solution was consumed. The production cost was approximately 5.5 times that of the Sepharose gel solid-phase adsorption method, and the required time was 3 days.
[0292] According to Table 3 and Figure 15Analysis of experimental data results (Lane 1: sample of solid-phase adsorption renaturation method, Lane 2: sample of dilution renaturation method, Lane 3: sample of dialysis renaturation method): The sample purity obtained by the Sepharose gel solid-phase adsorption method is over 90%, the required renaturation liquid is 2 L, and the required renaturation time is 1 day, far superior to: the sample purity obtained by the dilution renaturation method is 75%, the required renaturation liquid is 8 L, and the required renaturation time is 5 days; the sample purity obtained by the dialysis renaturation method is 80%, the required renaturation liquid is 10.8 L, and the required renaturation time is 3 days. Moreover, the dilution renaturation method and the dialysis renaturation method also require re-purification on the chromatography column, and the process is more complex. Therefore, the Sepharose gel solid-phase adsorption method has strong specificity for the renaturation of recombinant human basic fibroblast growth factor, integrating renaturation and purification. After purification by this method, the renaturation efficiency and purity are significantly improved, and the endotoxin content is reduced. Therefore, the solid-phase adsorption renaturation method using Sepharose is the most suitable choice.
[0293] Table 4
[0294]
[0295] Example 12
[0296] In this example, the target protein was collected and frozen.
[0297] Instrument: Tangential flow system Equipment: Centramate TM (Millbore FS013K05CLVC)
[0298] Using the tangential flow system, the sample collected in 3.6 of Example 8 was replaced into the preservation buffer solution 4.
[0299] Preservation buffer solution 4: KH2PO4 with a final concentration of 0.27 g / L, Na2HPO4·12H2O with a final concentration of 1.42 g / L, KCl with a final concentration of 0.2 g / L, NaCl with a final concentration of 8.8 g / L, Arg with a final concentration of 10 g / L, trehalose with a final concentration of 10 g / L, sucrose with a final concentration of 20 g / L, cysteine with a final concentration of 1 g / L, pH 7.3 adjusted with phosphoric acid.
[0300] Washing buffer A4: Acetate-sodium acetate buffer with a final concentration of 100 mM, NaCl with a final concentration of 1.0 M; pH 5.0.
[0301] Washing buffer B4: Tris with a final concentration of 50 mM, NaCl with a final concentration of 1 M, urea with a final concentration of 8 M; pH 9.0.
[0302] Washing buffer C4: NaOH solution with a final concentration of 1.0 M.
[0303] 4.1 The peristaltic pump pipeline A4 uses a flow rate of 50 mL / min, and uses 2000 mL of washing buffer C4 to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline B4 circulates, and the peristaltic pump pipeline C4 flows out.
[0304] 4.2 The peristaltic pump pipeline A4 uses a flow rate of 100 mL / min, and uses 2000 mL of injection water to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline B4 circulates, and the peristaltic pump pipeline C4 flows out.
[0305] 4.3 The peristaltic pump pipeline A4 uses a flow rate of 100 mL / min, and uses 500 mL of preservation buffer solution 4 to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline 4B circulates, and the peristaltic pump pipeline C4 flows out.
[0306] 4.3 The peristaltic pump pipeline A4 uses a flow rate of 100 mL / min. Add 200 mL of the sample collected in 3.6 + 200 mL of preservation buffer solution 4. The peristaltic pump pipeline 4B circulates, and the peristaltic pump pipeline C4 flows out 200 mL. After circulating 8 times, empty the tangential flow system equipment to collect the sample. The obtained sample is analyzed by SDS-PAGE electrophoresis. As Figure 16 shown, the purity of the target protein is above 95%; and the endotoxin of the collected protein is detected by the Limulus reagent gel method to be less than 10 EU / mg.
[0307] 4.4 The peristaltic pump pipeline A4 uses a flow rate of 100 mL / min, and uses 2000 mL of injection water to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline B4 circulates, and the peristaltic pump pipeline C4 flows out.
[0308] 4.5 The peristaltic pump pipeline A4 uses a flow rate of 50 mL / min, and uses 2000 mL of washing buffer C4 to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline B4 circulates, and the peristaltic pump pipeline C4 flows out.
[0309] 4.6 The peristaltic pump pipeline A4 uses a flow rate of 100 mL / min, and uses 2000 mL of injection water to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline B4 circulates, and the peristaltic pump pipeline C4 flows out.
[0310] 4.7 The peristaltic pump pipeline A4 uses a flow rate of 100 mL / min, and uses 800 mL of 20% ethanol solution to clean all pipelines and tangential flow system equipment. The peristaltic pump pipeline B4 circulates, and the peristaltic pump pipeline C4 flows out.
[0311] Lyophilized preservation
[0312] 5.1 Detect the concentration of the target protein obtained in the purification step 4.3 by the lowrry method, and appropriately adjust the protein concentration to 1 mg / mL.
[0313] 5.2 Dispense the protein into 3 mL vials and pre-freeze at -80 °C.
[0314] 5.3 Pre-freeze the shelves of the freeze dryer at -40 °C for 5 h
[0315] 5.4 Program the freeze dryer
[0316] Program 1: Set the shelf temperature to -40 °C;
[0317] Program 2: The shelf temperature is -40 °C, and the drying tray is placed on the shelf for 30 min
[0318] Program 3: Set the shelf temperature to -40 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.100 mbar, and the time to 10 min;
[0319] Program 4: Slowly raise the temperature of the shelf to -25 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.100 mbar, and the time to 5 h;
[0320] Program 5: Keep the temperature of the shelf stable at -25 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.100 mbar, and the time to 5 h;
[0321] Program 6: Slowly raise the temperature of the shelf to -20 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.100 mbar, and the time to 5 h;
[0322] Program 7: Keep the temperature of the shelf stable at -20 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.100 mbar, and the time to 5 h;
[0323] Program 8: Keep the temperature of the shelf stable at 0 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.100 mbar, and the time to 10 h;
[0324] Program 9: Keep the temperature of the shelf stable at 0 °C, the safety pressure to 0.220 mbar, the vacuum degree to 0.010 mbar, and press the rubber stopper.
[0325] 5.5 Use a capping machine, store at 4 °C after capping, as Figure 17 shown.
[0326] In summary, the present invention designs a brand-new fermentation and purification process for human basic fibroblast growth factor, including designing high-density fermentation conditions to achieve high-density fermentation, controlling induction conditions to further increase protein production and save costs, as well as designing a two-step collaborative purification process and a specific renaturation process, effectively improving the purity of the target protein, reducing the endotoxin content, with the purity reaching over 95%, the endotoxin content being less than 10 EU / mg, saving production costs, suitable for process scale-up from laboratory processes to industrial production levels; suitable for large-scale industrial production.
[0327] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement to the present invention, the equivalent substitution of each raw material of the product of the present invention, the addition of auxiliary components, the selection of specific methods, etc. all fall within the protection scope and the disclosure scope of the present invention.
Claims
1. A method for preparing human basic fibroblast growth factor, characterized in that: The preparation method comprises: Cultivating host cells expressing human basic fibroblast growth factor, inducing the host cells to express human basic fibroblast growth factor, disrupting the cells and collecting precipitates to obtain crude protein, and purifying the crude protein to recover the human basic fibroblast growth factor; The culture includes strain recovery and fermentation culture; the fermentation culture conditions include: temperature of 36-38°C, pH of 6.8-7.2, DO series speed to maintain DO ≥ 30%, when OD 600 When the DO is above 7 and the dissolved oxygen rises by ≥0.1 unit / min, feed is performed. The flow rate is 95-105 mL / h in the first hour, and then the flow rate is adjusted to 100-200 mL / h. The ventilation volume is automatically adjusted to maintain a DO of 30-40%; The induction inducer includes isopropyl-β-D-thiogalactoside; the working concentration of the isopropyl-β-D-thiogalactoside is 1-25 mM; the induction temperature is 36-43°C; the induction time is 2-5 h; After collecting the precipitate, the step of extracting the inclusion bodies is also included; the extraction of the inclusion bodies includes mixing the collected precipitate with an inclusion body dissolving solution, collecting the supernatant, and obtaining an inclusion body solution; the inclusion body dissolving solution contains tris(hydroxymethyl)aminomethane, NaCl, EDTA and guanidine hydrochloride; The purification comprises sequentially performing a first chromatography and a second chromatography, wherein the filler of the first chromatography comprises any one of phenyl agarose gel, butyl agarose gel, n-butyl agarose gel or n-octyl agarose gel, or a combination of at least two thereof, and the filler of the second chromatography comprises any one of DEAE agarose gel, Q agarose gel or QAE agarose gel, or a combination of at least two thereof; The purification further includes a renaturation step; The renaturation comprises performing a third chromatography, and the filler of the third chromatography comprises SP Sepharose XL.
2. The method for preparing human basic fibroblast growth factor according to claim 1, characterized in that: The first chromatography specifically comprises: A chromatography column is assembled using any one of phenyl agarose gel, butyl agarose gel, n-butyl agarose gel or n-octyl agarose gel, or a combination of at least two of them, the chromatography column is washed with a first equilibration buffer, a sample is loaded, the impurities are washed with a mixture of a first elution buffer and a second elution buffer until the baseline is stable, and then the target protein is eluted with a mixture of the first elution buffer and the second elution buffer.
3. The method for preparing human basic fibroblast growth factor according to claim 2, characterized in that: The first equilibration buffer contains Tris, urea, EDTA, NaCl and ammonium sulfate.
4. The method for preparing human basic fibroblast growth factor according to claim 2, characterized in that: The first elution buffer contains arginine, tris, urea and EDTA.
5. The method for preparing human basic fibroblast growth factor according to claim 2, characterized in that: The second elution buffer contains arginine, Tris, urea, EDTA and NaCl.
6. The method for preparing human basic fibroblast growth factor according to claim 2, characterized in that: The washing of impurities includes mixing 15% to 25% of a first elution buffer and 75% to 85% of a second elution buffer, based on 100% by volume.
7. The method for preparing human basic fibroblast growth factor according to claim 2, characterized in that: The elution includes mixing 65% to 75% of a first elution buffer and 25% to 35% of a second elution buffer, based on a volume percentage of 100%.
8. The method for preparing human basic fibroblast growth factor according to claim 1, characterized in that: The second chromatography specifically comprises: A chromatography column is assembled using any one of DEAE agarose gel, Q agarose gel or QAE agarose gel or a combination of at least two of them, the chromatography column is washed with the second equilibration buffer, the sample is loaded, the impurities are washed with a mixture of the third elution buffer and the fourth elution buffer until the baseline is stable, and then the target protein is eluted with a mixture of the third elution buffer and the fourth elution buffer.
9. The method for preparing human basic fibroblast growth factor according to claim 8, characterized in that: The second equilibration buffer contains Tris and urea.
10. The method for preparing human basic fibroblast growth factor according to claim 8, characterized in that: The third elution buffer contains Tris and urea.
11. The method for preparing human basic fibroblast growth factor according to claim 8, characterized in that: The fourth elution buffer contains Tris, urea and NaCl.
12. The method for preparing human basic fibroblast growth factor according to claim 8, characterized in that: The washing of the impurities includes mixing 80% to 90% of the third elution buffer and 10% to 20% of the fourth elution buffer, based on 100% by volume.
13. The method for preparing human basic fibroblast growth factor according to claim 8, characterized in that: The elution includes mixing 60% to 70% of the third elution buffer and 30% to 40% of the fourth elution buffer, based on 100% by volume.
14. The method for preparing human basic fibroblast growth factor according to claim 1, characterized in that: The third chromatography specifically comprises: Use SP Sepharose XL to pack the chromatography column, rinse the chromatography column with the third equilibration buffer, load the sample, perform renaturation washing with the renaturation buffer, rinse the impurities with a mixture of the fifth elution buffer and the sixth elution buffer until the baseline is stable, and then elute the target protein with a mixture of the fifth elution buffer and the sixth elution buffer.
15. The method for preparing human basic fibroblast growth factor according to claim 14, characterized in that: The third equilibration buffer contains sodium acetate, arginine and urea.
16. The method for preparing human basic fibroblast growth factor according to claim 14, characterized in that: The refolding buffer contains EDTA, sodium acetate, polyethylene glycol, arginine and 2-cyclohexylaminoethanesulfonic acid.
17. The method for preparing human basic fibroblast growth factor according to claim 14, characterized in that: The fifth elution buffer contains sodium acetate and arginine.
18. The method for preparing human basic fibroblast growth factor according to claim 14, characterized in that: The sixth elution buffer contains sodium acetate, arginine and NaCl.
19. The method for preparing human basic fibroblast growth factor according to claim 14, characterized in that: The washing of the impurities includes mixing 80% to 90% of the fifth elution buffer and 10% to 20% of the sixth elution buffer, based on 100% by volume.
20. The method for preparing human basic fibroblast growth factor according to claim 14, characterized in that: The elution includes mixing 40% to 60% of the fifth elution buffer and 40% to 60% of the sixth elution buffer, based on 100% by volume.
21. The method for preparing human basic fibroblast growth factor according to claim 1, characterized in that: The strain recovery comprises sequentially performing primary seed culture and secondary seed culture.
22. The method for preparing human basic fibroblast growth factor according to claim 21, characterized in that: The culture medium for the secondary seed culture contains tryptone, yeast powder and NaCl.
23. The method for preparing human basic fibroblast growth factor according to claim 22, characterized in that: The culture medium for the secondary seed culture contains 10-20 g / L tryptone, 5-11 g / L yeast powder and 3-7 g / L NaCl.
24. The method for preparing human basic fibroblast growth factor according to any one of claims 1 to 23, characterized in that: The preparation method comprises the following steps: (1) taking a host cell expressing human basic fibroblast growth factor and performing primary seed culture, secondary seed culture and fermentation culture, and inducing the host cell to express human basic fibroblast growth factor using isopropyl-β-D-thiogalactoside; (2) disrupting cells, collecting precipitates and mixing them with inclusion body solution, collecting supernatant to obtain crude protein, performing a first chromatography on the crude protein, using a chromatography column composed of any one or a combination of at least two of phenyl agarose gel, butyl agarose gel, n-butyl agarose gel or n-octyl agarose gel, washing the chromatography column with a first equilibration buffer, loading the sample, washing the impurities with a mixture of a first elution buffer and a second elution buffer until the baseline is stable, and then eluting the target protein with a mixture of the first elution buffer and the second elution buffer; the inclusion body solution contains tris(hydroxymethylaminomethane), NaCl, EDTA and guanidine hydrochloride, the first equilibration buffer contains tris(hydroxymethylaminomethane), urea, EDTA, NaCl and ammonium sulfate, the first elution buffer contains arginine, tris(hydroxymethylaminomethane), urea and EDTA, and the second elution buffer contains arginine, tris(hydroxymethylaminomethane), urea, EDTA and NaCl; (3) performing a second chromatography on the product collected in step (2), using a chromatography column composed of any one or a combination of at least two of DEAE agarose gel, Q agarose gel or QAE agarose gel, washing the chromatography column with a second equilibration buffer, loading the sample, washing the impurities with a mixture of a third elution buffer and a fourth elution buffer until the baseline is stable, and then eluting the target protein with a mixture of a third elution buffer and a fourth elution buffer, wherein the second equilibration buffer contains tris(hydroxymethylaminomethane) and urea, the third elution buffer contains tris(hydroxymethylaminomethane) and urea, and the fourth elution buffer contains tris(hydroxymethylaminomethane), urea and NaCl; (4) The product collected in step (3) is subjected to a third chromatography, using an SP Sepharose XL chromatography column, washing the chromatography column with a third equilibration buffer, loading the sample, performing renaturation washing with a refolding buffer, washing the impurities with a mixture of a fifth elution buffer and a sixth elution buffer until the baseline is stable, and then eluting the target protein with a mixture of a fifth elution buffer and a sixth elution buffer, wherein the third equilibration buffer contains sodium acetate, arginine and urea, the refolding buffer contains EDTA, sodium acetate, polyethylene glycol, arginine and 2-cyclohexylaminoethanesulfonic acid, the fifth elution buffer contains sodium acetate and arginine, and the sixth elution buffer contains sodium acetate, arginine and NaCl.
Citation Information
Patent Citations
Method for producing secretion expression recombinant human fibroblast growth factor-21
CN101376888A