A primer-probe combination, kit and its application for the diagnosis of red-green color vision anomaly
By applying optimized primer probe combination based on dPCR technology in the diagnosis of red and green abnormality, the problems of cumbersome detection steps, high cost and inappropriate internal reference gene design in the existing technology are solved, and the diagnosis of red and green abnormality with high sensitivity, accuracy and precision is achieved, which is suitable for large-scale use.
Patent Information
- Application Number
- CN202410303503.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-15
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2044-03-15
AI Technical Summary
In the diagnosis of red and green abnormality, the detection results depend on multiple sites, cumbersome steps, high cost and inappropriate internal reference gene design, resulting in insufficient accuracy and limited application scope.
An optimized primer probe combination based on digital PCR (dPCR) technology was developed for variant detection of OPN1LW and OPN1MW genes. This combination includes a specifically amplified primer probe that enables detection of red-green aberrations with high sensitivity, accuracy and precision without relying on quantitative standards and standard curves.
The accurate diagnosis of red and green abnormalities is achieved, and the detection results are close to the accuracy of color blind mirrors, and are low-cost, suitable for large-scale use, and have good industrial application prospects.
Smart Images

Figure CN118064572B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of gene detection, and particularly relates to the application of a primer-probe combination for the diagnosis of red-green color vision anomaly. Background Art
[0002] Human color vision is formed by the proper mixing of three colors sensed by three types of cone cells (red, green, and blue) that sense different colors in the retina. The inaccurate discrimination of colors and poor color discrimination ability of the human eye, different from ordinary people, are color vision anomalies (abnormal color vision). According to the degree of color vision anomaly, it can be divided into color blindness and color weakness. Among them, red-green color blindness is the most common. Color vision disorders can be divided into color blindness and color weakness according to the degree. The color discrimination ability of color-weak individuals varies greatly among individuals. Some color-weak individuals have a color discrimination ability close to that of normal color vision individuals, while some color-weak individuals are close to color blindness.
[0003] Currently, the commonly used clinical detections include the following (Ge Jian, Wang Ningli. Ophthalmology [M]. Beijing: People's Medical Publishing House, 2015.; Gao Qiang, Ma Ruiqing, Qiang Yan. Detection and classification of abnormal color vision by hue test and anomaloscope [J]. Laser & Optoelectronics Progress, 2023, 60(09): 501-508.):
[0004] (1) Pseudoisochromatic plates. Also known as color blindness books. In the same color picture, there are pictures composed of spots with the same brightness but different colors, and also pictures composed of spots with the same color but different brightness. Normal people distinguish according to colors, while color-blind people can only judge by brightness and thus give wrong answers. It is suitable for large-scale general screening, can efficiently screen out individuals with abnormal color vision, but cannot provide an accurate diagnosis of color vision anomaly, nor can it distinguish color blindness, color weakness, the degree of color weakness, red color vision or green color vision anomaly.
[0005] (2) Hue arrangement method. Under fixed lighting conditions, the examinee is required to arrange many colored items with the same shape and size but different colors in sequence, and arrange the objects with the closest colors together. The degree and type of color vision disorder are judged according to whether the arrangement is normal. Usually, the FM-100-Hue or D-15 test is used. The FM-100-Hue and D-15 tests can be carried out on various electronic devices. The passing rate of the D-15 test for color weakness is 73.6%, and the passing rate for color blindness is 5.8%; this method can only screen out color blindness or severe color weakness. It is difficult for the FM-100-Hue to distinguish ordinary color weakness.
[0006] (3) Anomaloscope. The anomaloscope uses appropriate mixing of red light and green light to form yellow light, and allows the subject to adjust the proportion of red light and green light to determine the type and degree of color vision disorder. The anomaloscope is currently recognized as the most accurate instrument for detecting and classifying abnormal color vision. However, it is expensive, inconvenient to carry, and requires professional technical personnel to operate. On average, it takes about 30 minutes for one subject, which is not suitable for large-scale clinical examinations.
[0007] Genetic testing, as a direct diagnostic method, can be used for the diagnosis of hereditary color vision defects. The test results can determine whether the subject has color blindness or color weakness, and distinguish the type and severity. However, the OPN1LW and OPN1MW genes are highly homologous, so conventional high-throughput sequencing technologies cannot be accurately aligned to the reference genome and cannot be accurately interpreted, and this method is costly. Sanger sequencing can detect specific SNP sites, but can only distinguish homozygous / heterozygous, but cannot determine the proportion of mutant types. The MLPA detection technology invented by Haer-Wigman L et al. can quantify the copy numbers of the OPN1LW and OPN1MW genes, but is not suitable for large-scale use (Haer-Wigman L, den Ouden A, van Genderen MM, Kroes HY, Verheij J, Smailhodzic D, Hoekstra AS, Vijzelaar R, Blom J, Derks R, Tjon-Pon-Fong M, Yntema HG, Nelen MR, Vissers LELM, Lugtenberg D, Neveling K. Diagnostic analysis of the highly complex OPN1LW / OPN1MW gene cluster using long-read sequencing and MLPA. NPJ Genom Med. 2022 Nov 9;7(1):65.).
[0008] Currently, there is an urgent need in the art for a genetic testing method that is accurate in detection, suitable for large-scale use, and does not rely on special equipment. Summary of the Invention
[0009] Digital PCR (dPCR) technology has the advantages of high sensitivity, strong anti-interference ability, and absolute quantification without relying on a standard curve. Due to the extremely high sensitivity of dPCR, the specificity requirements for the primer-probe combination in the detection system are very high, and the design of the primer-probe combination is difficult. Therefore, an optimized kit for detecting OPN1LW and OPN1MW gene mutations applicable to dPCR has been developed. The primer-probe combination based on dPCR detection provided by the present invention does not need to rely on quantitative standards and standard curves, has high sensitivity, accuracy, and precision. Since the detection results are not affected by the amplification efficiency, the repeatability is high and it is easier to standardize.
[0010] The prior art CN117248008A discloses a genetic screening method for red-green color vision abnormalities, which is based on the dPCR detection of the OPN1MW gene and the OPN1MW gene. The detection sites include p.Y309F, p.S116T, p.S180A, p.I230T, c.-112A>C, and p.I178V, and the internal reference gene is LCR.
[0011] Although CN117248008A applies dPCR detection, it has the following defects: the detection results depend on multiple sites, the steps are cumbersome, and the cost is high; the internal reference primers are designed based on the housekeeping gene (LCR) on the X chromosome, resulting in the need to interpret the results separately according to gender, and the results will be inaccurate when there are abnormalities in the copy number of the X chromosome, that is, it is not applicable to the detection of samples with abnormal X chromosome copy numbers, and the scope of application is limited.
[0012] In order to overcome the defects of the prior art, the present invention hereby proposes the following technical solutions:
[0013] In the first aspect, the present invention provides a primer-probe combination for diagnosing red-green color vision abnormalities, and the primer-probe combination includes:
[0014] (1) The first primer-probe group, which contains a first primer pair, a first probe, and a second probe that specifically amplify the OPN1LW gene and p.T285A of the OPN1MW gene;
[0015] (2) The second primer-probe group, which contains a second primer pair, a third probe, and a fourth probe that specifically amplify c.-112 of the OPN1MW gene;
[0016] Among them, the 5' ends of the first probe, the second probe, the third probe, and the fourth probe are modified with fluorescent groups, and the 3' ends are modified with quenching groups, and the fluorescent groups are different from each other.
[0017] In some examples, the first primer pair includes primers with nucleotide sequences shown in SEQ ID NO: 1-2.
[0018] SEQ ID NO:1: CGCGCATGGTGGTGGTGATG。
[0019] SEQ ID NO:2: GGCAGCCATCAAAGGGTGG。
[0020] In some examples, the first probe has a nucleotide sequence as shown in SEQ ID NO:3. The second probe has a nucleotide sequence as shown in SEQ ID NO:4.
[0021] In the present invention, the first probe and the second probe are designed for p.285 of the OPN1LW gene and the OPN1MW gene, and are used to detect the SNP at position 285 to identify specific gene types. If p.285 is T (the corresponding base is A), it is the OPN1LW gene; if p.285 is A (the corresponding base is G), it is the OPN1MW gene.
[0022] SEQ ID NO:3: ACCCTACACCTTCTT。
[0023] SEQ ID NO:4: ACCATACGCCTTCTT。
[0024] In some examples, the second primer pair includes primers with nucleotide sequences as shown in SEQ ID NO:5-6.
[0025] SEQ ID NO:5: CCCAATTAAGAGATCAGATG。
[0026] SEQ ID NO:6: CACGGTGCTTTATACCGGCCA。
[0027] In some examples, the third probe has a nucleotide sequence as shown in SEQ ID NO:7. The fourth probe has a nucleotide sequence as shown in SEQ ID NO:8.
[0028] In the present invention, the first probe is designed for c.-112 of the OPN1MW gene, and is used to detect the SNP at position -112 to identify specific base types. If c.-112 is CC, it is a homozygous mutation; if c.-112 is AC or AA, it is a non-homozygous mutation.
[0029] SEQ ID NO:7: TAGGATTTGGGAGCTTT。
[0030] SEQ ID NO:8: TAGGATTTGGGCGCTTT。
[0031] In some examples, the primer-probe combination further includes an internal reference primer pair and an internal reference probe.
[0032] Those skilled in the art should reasonably know that the internal reference primers and probes are designed based on internal reference genes (also known as housekeeping genes). An internal reference gene refers to a class of genes with stable expression in an organism. It is generally used as an internal reference during experiments. It can be considered a gene with very stable expression in various situations, in various different tissues, at different time points, and under various different external and internal conditions, including genes on autosomes and the X chromosome. The internal reference genes selected in this kit are autosomal internal reference genes, such as: GAPDH, ACTB, RPP30, B2M, SDHA, etc. Compared with the internal reference genes on the X chromosome, selecting autosomal internal references can simplify the result judgment and is applicable to the detection of samples with abnormal X chromosome copy numbers.
[0033] In some examples, the internal reference primers and the internal reference probe specifically amplify the ACTB gene.
[0034] In some preferred examples, the internal reference primer pair includes primers with nucleotide sequences as shown in SEQ ID NO: 9-10.
[0035] SEQ ID NO: 9: GAACTCTGCAGGTTCTATTTG.
[0036] SEQ ID NO: 10: CGAGCCAGTGTTAGTACCTAC.
[0037] In some preferred examples, the internal reference probe has a nucleotide sequence as shown in SEQ ID NO: 11.
[0038] SEQ ID NO: 11: CCAGATGAGCTCTTT.
[0039] In some examples, the fluorescent groups include, but are not limited to: FAM, HEX, Cy3, VIC, ROX, NED, Cy5 or A425.
[0040] In some examples, the quenching groups include, but are not limited to: BHQ1, BHQ2, BHQ3, BHQ650TAMRA, DABCYL or MGB.
[0041] In some preferred examples, the fluorescent group of the first probe is FAM and the quenching group is MGB.
[0042] In some preferred examples, the fluorescent group of the second probe is ROX and the quenching group is MGB.
[0043] In some preferred examples, the fluorescent group of the third probe is CY5 and the quenching group is MGB.
[0044] In some preferred examples, the fluorescent group of the fourth probe is A425 and the quenching group is MGB.
[0045] In some preferred examples, the fluorescent group of the fifth probe is VIC and the quenching group is MGB.
[0046] In a second aspect, the present invention provides a kit, which comprises any one of the foregoing primer-probe combinations.
[0047] In some examples, the kit further comprises at least one of the following:
[0048] Buffer, DNA polymerase, UNG enzyme, dNTPs, magnesium salt, positive control and / or negative control.
[0049] In some preferred examples, the buffer is TaqPath TM ProAmp TM Master Mix.
[0050] The present invention optimizes the reaction system for dPCR amplification, especially the amplification buffer, making the copy number quantification and mutation detection more accurate and specific.
[0051] In some preferred examples, the negative control can be nuclease-free water.
[0052] In some preferred examples, the positive control can comprise a recombinant plasmid of the internal reference genes ACTB, OPN1LW and OPN1MW genes p.285 and c.-112.
[0053] In a third aspect, the present invention provides the application of any one of the foregoing primer-probe combinations or kits in the preparation of products for the diagnosis of red-green color vision deficiency.
[0054] In some examples, the products include diagnostic reagents, diagnostic devices or diagnostic systems.
[0055] In a fourth aspect, the present invention provides a system for the diagnosis of red-green color vision deficiency, the system comprising:
[0056] A detection device, a calculation device and an output device.
[0057] In some examples, the detection device includes a sampler and a detector, the sampler is used to collect samples from a subject, and the detector uses any one of the foregoing primer-probe combinations or kits to detect the copy numbers of the OPN1LW gene and the OPN1MW gene p.T285A and the OPN1MW gene c.-112.
[0058] In some examples, the sources of the samples include, but are not limited to: oral swabs, throat swabs, tissues, blood, etc.
[0059] In some preferred examples, the detector has the function of digital PCR (dPCR) detection.
[0060] In some examples, the computing device includes a memory and a processor. A computer program is stored in the memory, and the processor is configured to execute the computer program stored in the memory to achieve the following discrimination:
[0061] 1) If the copy number (L) of OPN1LW gene p.285T = 0 and the copy number (M) of OPN1MW gene p.285A = 0, then the subject has red blindness and green blindness;
[0062] 2) If the copy number (L) of OPN1LW gene p.285T = 0 and the copy number (M) of OPN1MW gene p.285A = 1, then the subject has red blindness;
[0063] 3) If the copy number (L) of OPN1LW gene p.285T = 0 and the copy number (M) of OPN1MW gene p.285A ≥ 2; then the subject has red blindness or red color weakness;
[0064] 4) If the copy number (L) of OPN1LW gene p.285T = 1 and the copy number (M) of OPN1MW gene p.285A = 0, then the subject has green blindness;
[0065] 5) If the copy number (L) of OPN1LW gene p.285T = 1 and the copy number (M) of OPN1MW gene p.285A ≥ 1, then after detecting the homozygous mutation of OPN1LW gene c.-112A>C, the following discrimination is carried out:
[0066] If it belongs to the c.-112A>C homozygous mutation, then the subject has green blindness or green color weakness;
[0067] If it does not belong to the c.-112A>C homozygous mutation, then the subject is normal or needs to be further identified by LR-PCR;
[0068] 6) If the copy number (L) of OPN1LW gene p.285T ≥ 2 and the copy number (M) of OPN1MW gene p.285A = 0, then the subject has green blindness or green color weakness;
[0069] 7) If the copy number (L) of OPN1LW gene p.285T ≥ 2 and the copy number (M) of OPN1MW gene p.285A ≥ 1, the subject is normal or further identification by LR-PCR is required.
[0070] In some examples, the output device is used to output the detection result of the detection device and / or the discrimination result of the calculation device.
[0071] In a fifth aspect, the present invention provides a method for detecting the copy numbers of OPN1MW gene and OPN1LW gene p.T285A, the method comprising the following steps:
[0072] (i) Collect a sample to be tested and release or isolate the DNA of the sample to be tested;
[0073] (ii) Perform dPCR detection using any one of the foregoing primer-probe combinations or kits;
[0074] (iii) Interpret the result based on the detection data obtained in step (ii).
[0075] In a sixth aspect, the present invention provides a method for detecting the copy number of OPN1LW gene c.-112, the method comprising the following steps:
[0076] i) Collect a sample to be tested and release or isolate the DNA of the sample to be tested;
[0077] ii) Perform dPCR detection using any one of the foregoing primer-probe combinations or kits;
[0078] iii) Interpret the result based on the detection data obtained in step ii).
[0079] In a seventh aspect, the present invention provides a method for diagnosing red-green color vision abnormality, the method comprising the following steps:
[0080] (a) Collect a sample of the subject and release or isolate the DNA of the sample;
[0081] (b) Perform dPCR detection using any one of the foregoing primer sets, kits or systems;
[0082] (c) Interpret the result based on the detection data.
[0083] In some examples, the result interpretation includes the following steps:
[0084] a) If the copy number (L) of OPN1LW gene p.285T = 0 and the copy number (M) of OPN1MW gene p.285A = 0, then the subject has red blindness and green blindness;
[0085] b) If the copy number (L) of OPN1LW gene p.285T = 0 and the copy number (M) of OPN1MW gene p.285A = 1, then the subject has red color blindness;
[0086] c) If the copy number (L) of OPN1LW gene p.285T = 0 and the copy number (M) of OPN1MW gene p.285A ≥ 2; then the subject has red color blindness or red color weakness;
[0087] d) If the copy number (L) of OPN1LW gene p.285T = 1 and the copy number (M) of OPN1MW gene p.285A = 0, then the subject has green color blindness;
[0088] e) If the copy number (L) of OPN1LW gene p.285T = 1 and the copy number (M) of OPN1MW gene p.285A ≥ 1, after detecting the homozygous mutation of OPN1LW gene c.-112A>C, the following discrimination is made:
[0089] If it belongs to the c.-112A>C homozygous mutation, then the subject has green color blindness or green color weakness;
[0090] If it does not belong to the c.-112A>C homozygous mutation, then the subject is normal or needs to be further identified by LR-PCR;
[0091] f) If the copy number (L) of OPN1LW gene p.285T ≥ 2 and the copy number (M) of OPN1MW gene p.285A = 0, then the subject has green color blindness or green color weakness;
[0092] g) If the copy number (L) of OPN1LW gene p.285T ≥ 2 and the copy number (M) of OPN1MW gene p.285A ≥ 1, the subject is normal or needs to be further identified by LR-PCR.
[0093] The present invention provides a primer-probe combination for dPCR detection, which does not rely on quantitative standards and standard curves, has high sensitivity, accuracy and precision, and the detection results are very close to the currently recognized anomaloscope which is the most accurate for abnormal color vision detection and classification. Since the detection results are not affected by the amplification efficiency, the repeatability is high and it is easier to standardize. In addition, the present invention can accurately identify abnormal color vision by only detecting two loci (p.285, c.-112 loci). Compared with the prior art, it also has the advantage of low cost, is suitable for large-scale use, and has a better industrial application prospect.
[0094] The present invention not only provides primers and probes suitable for detecting the p.285 and c.-112 sites of the OPN1LW gene and the OPN1MW gene by dPCR, but also improves the internal reference primers and probes. By selecting primers and probes designed based on autosomal internal reference genes, it is more convenient to interpret the results, without the need to separately interpret the results according to gender, thus improving the detection accuracy.
[0095] The present invention also optimizes the reaction system. After a large number of screenings and validations, a buffer suitable for the reaction system of the present invention is finally obtained, making the copy number quantification and mutation detection more accurate and specific. BRIEF DESCRIPTION OF THE DRAWINGS
[0096] Figure 1 It is a flowchart of the detection method of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0097] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will be applied, and where appropriate, terms used in the singular form will also include the plural form, and vice versa.
[0098] Unless the context clearly indicates otherwise, the expressions "a" and "an" used herein include plural referents. For example, referring to "a cell" includes multiple such cells and equivalents known to those skilled in the art, and so on.
[0099] The term "about" used herein represents a range of ±20% of the value following it. In some embodiments, the term "about" represents a range of ±10% of the value following it. In some embodiments, the term "about" represents a range of ±5% of the value following it.
[0100] The numerical ranges used herein should be understood to have enumerated all the numbers within that range. For example, the range of 1 to 20 should be understood to include any number, combination of numbers, or sub-range from the following group: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0101] As used herein, the term "comprises" or "comprising" means "including but not limited to". This term is intended to be open-ended, specifying the presence of any stated feature, element, integer, step, or component, but not precluding the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. Thus, the term "comprising" includes the more restrictive terms "consisting of" and "consisting essentially of". In one embodiment, the term "comprising" as used throughout the application, particularly in the claims, may be replaced by the term "consisting of".
[0102] As used herein, the terms "optionally", "either", "any", or "any one" mean that the subsequent described event or circumstance may but need not occur, and this description includes the instances where the event or circumstance occurs or does not occur. As used in the present invention, "a" and "an" are used in the present invention to refer to one or more than one grammatical object.
[0103] As used herein, the term "and / or" should be understood to mean any one of the alternatives or any combination of any two or more of the alternatives.
[0104] As used herein, the term "color vision anomalopia" refers to a decrease or absence in the visual organ's perception of color vision. Clinically, it is divided into two types: color weakness and color blindness. Color blindness refers to the loss of color discrimination ability; color weakness refers to a decrease in the ability to recognize colors. Clinically, color discrimination difficulties occur, which can involve red and green or affect yellow-blue and red-green. Treatment is targeted at the primary disease. Among them, red-green color blindness is the most common congenital color vision anomaly, which is caused by an abnormality in the gene encoding red and green cone proteins on the X chromosome, and there are more male patients. Blue color blindness is rare, and its pathogenic gene is located on chromosome 7 and is recessively inherited.
[0105] As used herein, the term "daltonism; red-green colorblindness" refers to partial color blindness, where patients cannot distinguish between red and green and see two color tones: the long-wave (red, orange, yellow, green) part is yellow, and the short-wave (cyan, blue, purple) part is blue. It is divided into red color blindness and green color blindness. Among them, "red color blindness", also known as first color blindness. Patients mainly cannot distinguish red and cannot distinguish between red and dark green, magenta, and purple. They often regard green as yellow, purple as blue, and mix yellow and blue as white. "Green color blindness", also known as second color blindness, patients cannot distinguish between light green and dark red, purple and cyan blue, magenta and gray, and regard green as gray or dark black.
[0106] As used herein, the term "color weakness" refers to a condition where a patient can recognize colors but has a lower sensitivity. Color-weak patients have a poor ability to distinguish colors and can only see colors when they are relatively saturated; they can only distinguish changes in hue when there is a large difference in wavelength.
[0107] As used herein, the term "LR-PCR" refers to long-range PCR or long-fragment PCR (Long range PCR). The principle of the LR-PCR technique is to utilize the advantage of long reads to directly span the entire LR-PCR amplicon and retain phase information, which can more accurately identify pseudogenes. Specifically, the LR-PCR technique uses long-distance PCR amplification to directly span complex regions in the genome, avoiding the problem of non-specific amplification that may occur in traditional PCR methods. At the same time, this technique can retain the phase information between amplicons, which helps to more accurately identify pseudogenes.
[0108] As used herein, the term "p.T285A" refers to the 285th amino acid in the amino acid sequences encoded by the OPN1LW gene and the OPN1MW gene. The amino acid sequences of the two genes have high homology. If the 285th amino acid is T (Thr, threonine), it indicates that the gene is the OPN1LW gene; if the 285th amino acid is A (Ala, alanine), it indicates that the gene is the OPN1MW gene.
[0109] As used herein, the term "c.-112A>C" refers to the mutation of the nucleotide at position 112 upstream of the cDNA sequence of the OPN1MW gene from base A to base C. If only base C is detected at this site, it indicates a homozygous mutation; if only base A or both base A and base C are present at this site, it is a non-homozygous mutation.
[0110] To make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below in conjunction with embodiments. For those conditions not specified in the embodiments, they shall be carried out according to conventional conditions or conditions recommended by the manufacturer. For all reagents or instruments without indicating the manufacturer, they are all conventional products that can be purchased commercially. To better illustrate the present invention, numerous specific details are given in the following specific embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present invention. Such structures and technologies are also described in many publications, such as "Molecular Cloning: A Laboratory Manual (Fourth Edition)" (Cold Spring Harbor Laboratory Press), Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience publications.
[0111] The main reagents or equipment involved in the present invention are shown in Table 1.
[0112] Table 1
[0113]
[0114] Example 1 Application of Primer-Probe Combination in the Diagnosis of Red-Green Color Vision Anomaly
[0115] The primer-probe combination of this example is shown in Table 2.
[0116] Table 2
[0117]
[0118]
[0119] Extract the DNA of clinical samples and perform dPCR detection using the following amplification system (Table 3).
[0120] Table 3
[0121] Reagent Name Volume (μL) <![CDATA[TaqPath TM ProAmp TM Master Mix]]> 3 285-F (10 μM) 1 μL 285-R (10 μM) 1 μL 285T-P (10 μM) 0.5 μL 285A-P (10 μM) 0.5 μL 112-F (10 μM) 1 μL 112-R (10 μM) 1 μL 112A-P (10 μM) 0.5 μL 112C-P (10 μM) 0.5 μL ACTB-F (10 μM) 0.6 μL ACTB-R (10 μM) 0.6 μL ACTB-P (10 μM) 0.3 μL Template (~2 ng / μL) 3 <![CDATA[ddH2O]]> Make up to 15 μL
[0122] Among them, TaqPath TM ProAmp TM Master Mix contains DNA polymerase, UNG enzyme, dNTPs, MgCl2, etc.
[0123] The amplification program is: 95°C, 2 min; (95°C, 5 s; 60°C, 45 s) for 40 cycles.
[0124] After the dPCR amplification is completed, the data is sorted according to the dPCR results, and the copy numbers and site mutation information of the OPN1LW and OPN1MW genes are further analyzed.
[0125] The copy number (CN) of the corresponding gene is calculated according to the fluorescence concentration (copies / μL) ratio of the OPN1LW (FAM) and OPN1MW (ROX) genes to the internal reference gene ACTB (VIC), and the interpretation criteria are shown in Table 4. The fluorescence concentration is the reading given by the instrument after dPCR amplification.
[0126] Table 4
[0127] Ratio Result Judgment Ratio ≤ 0.1 CN = 0 0.4 ≤ Ratio ≤ 0.6 CN = 1 Ratio ≥ 0.8 CN ≥ 2
[0128] After obtaining the copy number through analysis, the color blindness and color weakness conditions are judged based on the copy numbers and site mutation information of the OPN1LW and OPN1MW genes. The specific process is as Figure 1 shown.
[0129] Accuracy test of the primer-probe combination in Example 2
[0130] The primer-probe combination and reaction system (including amplification system and amplification program) in this example are the same as those in Example 1.
[0131] 2.1 Detection of LW / MW copy number (detection at p.285 site)
[0132] In this experiment, MLPA detection was used as the control group.
[0133] MLPA (multiplex ligation-dependent probe amplification) refers to the multiplex ligation probe amplification technique, which is a new technique for qualitative and semi-quantitative analysis of the DNA sequence to be detected. This technique is efficient and specific, and can detect changes in the copy numbers of 45 nucleotide sequences in one reaction, and has been applied to the research of multiple fields and various diseases.
[0134] The detection results and analysis are shown in Table 5.
[0135] Table 5
[0136]
[0137]
[0138] The results show that the copy numbers of OPN1LW and OPN1MW in the blood DNA of 30 clinical samples measured using the primer-probe combination in this example are completely consistent with the MLPA analysis results, and the sensitivity and specificity are both 100.0%.
[0139] 2.2 Detection of the OPN1MW c.-112A>C locus
[0140] In this experiment, the results of first-generation sequencing were used as a control.
[0141] The detection results are shown in Table 6.
[0142] Table 6
[0143]
[0144]
[0145] The results showed that for the OPN1MW c.-112A>C locus in the blood DNA of 30 clinical samples measured using the primer-probe combination of this example, it was completely consistent with the results of first-generation sequencing, and both the sensitivity and specificity were 100.0%.
[0146] Example 3 Comparison between the detection using the primer-probe combination and color blindness glasses examination
[0147] The primer-probe combination and reaction system (including amplification system and amplification program) of this example were the same as those in Example 1.
[0148] Blood sample DNA of 200 subjects who had undergone color blindness glasses examination was detected. Among the samples of 30 subjects who were positive in the color blindness glasses examination, 28 were judged to be color blind or color weak using this primer-probe combination, and 2 cases needed to be further verified by long-range PCR (LR-PCR).
[0149] Among the samples of 170 subjects who were negative in the color blindness glasses examination, 169 were judged to have normal color vision using this kit, and 1 case needed to be further verified by LR-PCR.
[0150] All 3 samples that needed to be further verified by LR-PCR were finally determined to be color weak.
[0151] Therefore, the sensitivity of this primer-probe combination was 93.3% (28 / 30), the specificity was 99.4% (169 / 170), the accuracy was 98.5% (197 / 200), the positive coincidence rate was 100% (28 / 28), the negative coincidence rate was 100% (169 / 169), and the total coincidence rate was 100%.
[0152] Comparative Example 1
[0153] In this comparative example, the OPN1MW c.-112A>C locus was detected to compare the detection effects of the primer-probe (SEQ ID NO: 5-8) designed by the present invention for the c.-112A>C locus and the reference primer-probe. The sequences of the reference primer-probe are shown in Table 7.
[0154] The detection method and specific parameters are the same as those in Example 1 and Example 2.
[0155] Table 7
[0156] Sequence Name Sequence Number Sequence (5’-3’) Labeling Group 112F-S SEQ ID NO:12 TAAGTCCCAGGCCCAATTAAGA - 112R-S SEQ ID NO:13 ATACCGGCCAGTGGGATCA - 112PA-S SEQ ID NO:14 TGTAGGATTTGGGAGCT 5’CY5,3’MGB 112PC-S SEQ ID NO:15 TGTAGGATTTGGGCGCT 5’A425,3’MGB
[0157] The detection results are shown in Table 8. For the samples detecting the homozygous mutation (CC genotype) at the c.-112 site, only the A425 channel of the primer-probe of the present invention has fluorescence concentration, and the fluorescence concentration of the CY5 channel is 0, while the reference primer-probe also has non-specific fluorescence concentration in the CY5 channel; for the samples detecting the wild type (AA genotype) at the c.-112 site, only the CY5 channel has fluorescence concentration, and the fluorescence concentration of the A425 channel is 0, while the reference primer-probe also has non-specific fluorescence concentration in the A425 channel; for the samples detecting the heterozygous mutation (AC genotype) at the c.-112 site, both the CY5 and A425 channels of the two groups of primer-probes have fluorescence concentration. The above results indicate that the primer-probe group provided by the present invention has better specificity in differentiating the genotypes at the c.-112 site.
[0158] Table 8
[0159]
[0160] Comparative Example 2
[0161] The present invention has improved the buffer for the dPCR system, and TaqPath TM ProAmp TM Master Mix has the best effect. In this comparative example, a reference buffer is selected as a control to prove that the buffer selected by the present invention has a better effect.
[0162] The detection method, reaction system, primers and result interpretation in this comparative example are the same as those in Example 1 and Example 2.
[0163] The detection results are shown in Table 9. When detecting the copy numbers of the OPN1LW gene and the OPN1MW gene in 4 samples, the copy numbers (the ratio of the fluorescence concentration of the OPN1LW gene or the OPN1MW gene to the fluorescence concentration of the internal reference gene) detected by TaqPath TM ProAmp TM Master Mix selected by the present invention are closer to the reference values (MLPA detection), while the copy numbers detected by the reference buffer Hieff Universal TaqMan Multiplex qPCR Master Mix (UDG plus) are on the high side.
[0164] Table 9
[0165]
[0166] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than limiting the protection scope of the present invention. Any simple modification or equivalent replacement made by those of ordinary skill in the art to the technical solution of the present invention shall not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A primer-probe combination for diagnosing red-green color abnormality, characterized in that: The primer-probe combination consists of a first primer-probe group, a second primer-probe group, an internal reference primer pair and an internal reference probe; (1) A first primer probe set, wherein the first primer probe set is for specific amplification OPN1LW Genes and OPN1MW a first primer pair, a first probe, and a second probe for gene p.T285A; (2) A second primer probe set, wherein the second primer probe set is for specific amplification OPN1MW a second primer pair, a third probe, and a fourth probe for gene c.-112; The 5' ends of the first probe, the second probe, the third probe and the fourth probe are modified with a fluorescent group, the 3' ends are modified with a quenching group, and the fluorescent groups are different from each other; The first primer pair is a primer having a nucleotide sequence as shown in SEQ ID NO: 1-2; The nucleotide sequence of the first probe is shown in SEQ ID NO: 3; The nucleotide sequence of the second probe is shown in SEQ ID NO: 4; The second primer pair is a primer having a nucleotide sequence as shown in SEQ ID NO: 5-6; The nucleotide sequence of the three probes is shown in SEQ ID NO: 7; The nucleotide sequence of the fourth probe is shown in SEQ ID NO: 8; The internal reference primer pair and the internal reference probe specifically amplify ACTB gene; the internal reference primer pair includes primers whose nucleotide sequences are shown in SEQ ID NOs: 9-10; and the internal reference probe has a nucleotide sequence shown in SEQ ID NO:
11.
2. The primer-probe combination according to claim 1, characterized in that: The fluorescent group includes FAM, HEX, Cy3, VIC, ROX, NED, Cy5 or A425; and / or The quenching group includes BHQ1, BHQ2, BHQ3, BHQ650TAMRA, DABCYL or MGB.
3. The primer-probe combination according to claim 1, characterized in that: The fluorescent group of the first probe is FAM, and the quenching group is MGB; The fluorescent group of the second probe is ROX, and the quenching group is MGB; The fluorescent group of the third probe is CY5, and the quenching group is MGB; The fluorescent group of the fourth probe is A425, and the quenching group is MGB; The fluorescent group of the fifth probe is VIC, and the quenching group is MGB.
4. A kit, characterized in that: The kit comprises the primer-probe combination according to any one of claims 1 to 3.
5. The kit according to claim 4, characterized in that The kit further comprises at least one of the following: a buffer, a DNA polymerase, a UNG enzyme, dNTPs, a magnesium salt, a positive quality control product and / or a negative quality control product.
6. The kit according to claim 5, characterized in that The negative accusation sample is nuclease-free water; the positive accusation sample contains internal reference genes, OPN1LW and OPN1MW The recombinant plasmid of genes p.285 and c.-112; the buffer is TaqPath™ ProAmp™ Master Mix.
7. Use of the primer-probe combination according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 6 in the preparation of a product for diagnosing red-green color vision abnormalities.
8. The use according to claim 7, characterized in that: The product includes a diagnostic reagent, a diagnostic device or a diagnostic system.
9. A system for diagnosing red-green color abnormality, characterized in that: The system comprises: a detection device, a calculation device and an output device; The detection device comprises an injector and a detector, wherein the injector is used to collect a sample from a subject, and the detector detects the sample using the primer-probe combination described in any one of claims 1 to 3 or the kit described in any one of claims 4 to 6. OPN1LW Genes and OPN1MW Gene p.285 and OPN1MW Copy number of gene c.-112.
10. The system according to claim 9, characterized in that The sources of the sample include oral swab, throat swab, tissue or blood.
11. The system according to claim 9, characterized in that The computing device includes a memory and a processor, wherein the memory stores a computer program, and the processor is configured to execute the computer program stored in the memory to achieve the following determination: 1) If OPN1LW The copy number of gene p.285T (L) = 0, OPN1MW If the copy number (M) of gene p.285A = 0, the subject suffers from protanopia and deuteranopia; 2) If OPN1LW The copy number of gene p.285T (L) = 0, OPN1MW If the copy number (M) of gene p.285A = 1, the subject suffers from red color blindness; 3) If OPN1LW The copy number of gene p.285T (L) = 0, OPN1MW The copy number (M) of gene p.285A is ≥2; the subject suffers from red color blindness or red color weakness; 4) If OPN1LW The copy number of gene p.285T (L) = 1, OPN1MW If the copy number (M) of gene p.285A = 0, the subject suffers from deuteranopia; 5) If OPN1LW The copy number of gene p.285T (L) = 1, OPN1MW If the copy number (M) of gene p.285A is ≥1, OPN1LW After the c.-112 A>C homozygous mutation detection, the following judgment is made: If it is a c.-112 A>C homozygous mutation, the subject suffers from green blindness or green weakness; If it is not a c.-112 A>C homozygous mutation, the subject is normal or needs to be further identified by LR-PCR; 6) If OPN1LW The copy number of gene p.285T (L) ≥ 2, OPN1MW If the copy number (M) of gene p.285A = 0, the subject suffers from deuteranopia or deuteranomaly; 7) If OPN1LW The copy number of gene p.285T (L) ≥ 2, OPN1MW The copy number (M) of gene p.285A is ≥1, and the subject is normal or needs to be further identified by LR-PCR.
12. The system according to claim 9, characterized in that The output device is used to output the detection result of the detection device and / or the determination result of the calculation device.
Citation Information
Patent Citations
Genetic screening method, system and product for abnormal red and green vision
CN117248008A