A method for efficiently delivering gene editing plasmids in aquatic animals

Abstract

The present invention belongs to the field of genetic engineering technology, and relates to a method for efficiently delivering gene editing plasmids in aquatic animals such as fish, shrimp, and shellfish. First, sgRNA is obtained based on the gene design of aquatic animals, and the sgRNA is inserted into the Cas9 plasmid vector to obtain CRISPR / Cas9 plasmid; at the same time, the fertilized eggs of aquatic animals treated with the exosome agonist monensin are collected, and the supernatant III containing the fertilized egg cytoplasmic matrix and the solution IV containing the fertilized egg cell membrane are separated; the supernatant III and the solution IV are mixed, and the ATP regeneration system, the incubation buffer, and the CRISPR / Cas9 plasmid are added in sequence to mix evenly to obtain a reaction solution, the reaction solution is placed in a metal bath for reaction, the precipitate is collected by centrifugation and resuspended with PBS, and then the engineered exosomes loaded with CRISPR / Cas9 plasmid are obtained after enrichment and purification; the engineered exosomes loaded with CRISPR / Cas9 plasmid are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae. The present invention is non-invasive or non-invasive to fertilized eggs, and can achieve high-throughput and high-efficiency gene editing effects.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a method for efficiently delivering gene editing plasmids in aquatic animals. Background Art

[0002] Gene editing technology is a technology that can precisely modify and transform the genome of an organism. Gene editing technology can be seen as a gene delivery process that uses nucleases, such as Cas9, to cut DNA double strands to achieve the knockout, insertion or replacement of specific genes. The core of CRISPR-Cas9 technology is sgRNA (guide RNA), which can specifically bind to the target DNA sequence and guide the Cas9 nuclease to cut the DNA double strand at a specific location. The cut DNA fragments can be reconnected or replaced to achieve gene knockout, insertion or repair. CRISPR-Cas9 technology can be used to accurately knock out genes that cause genetic diseases, thereby achieving the purpose of gene therapy. In addition, by editing the genomes of animals and plants, new varieties with stronger disease resistance, insect resistance, drought resistance and other properties can be cultivated. In biological science research, CRISPR-Cas9 technology is also widely used in gene function research, genomics and epigenetics.

[0003] In gene editing technology for fish and shrimp, microinjection is currently mostly used for delivery. For example, researchers used microinjection to use CRISPR technology to edit the genes of Hawaiian shrimp. Parhyale hawaiensis The site-directed knockout of Hox genes was successfully achieved in the study. Among them, Hawaiian shrimp are brooding eggs, and their early embryos can tolerate microinjection operations, which is conducive to the successful implementation of CRISPR-Cas9 gene editing technology. However, for white shrimp, white shrimp do not brood eggs after spawning. Their fertilized eggs are all yellow eggs, which are very easy to break after acupuncture, resulting in a very low hatching rate of embryos after microinjection. In addition, due to the fast cleavage rate of shrimp fertilized eggs, the first cleavage is completed in 40 to 55 minutes, which limits the number of injectable embryos, resulting in low gene editing efficiency in shrimp. It can be seen that the microinjection method has problems such as low flux (the fertilized egg development time window is very short) and low delivery efficiency (microinjection can cause damage to fertilized eggs). Recently, some scholars have used PEI-coated SWNTs nanoparticles to study the delivery efficiency in white shrimp. The delivery efficiency is 36%, and the editing efficiency is only 20%. Therefore, it is urgent to develop other mild delivery methods to solve the current problem of low efficiency and difficulty in widespread shrimp gene editing. Summary of the invention

[0004] In view of the above shortcomings, the present invention discloses a method for efficiently delivering gene-editing plasmids in aquatic animals. Based on the CRISPR-Cas9 gene editing technology, sgRNA suitable for aquatic species is designed and a gene-editing plasmid (CRISPR / Cas9 plasmid) is prepared. The CRISPR / Cas9 plasmid is then encapsulated by engineered exosomes and co-incubated with fertilized eggs to achieve efficient delivery of the gene-editing plasmid.

[0005] The present invention is achieved by adopting the following technical solutions:

[0006] A method for efficiently delivering gene editing plasmids in aquatic animals, comprising the following steps:

[0007] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA is obtained based on the gene design of aquatic animals, and then the sgRNA is inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid;

[0008] (2) Separation of the cell membrane and cytoplasmic matrix of fertilized eggs: collect fertilized eggs of aquatic animals and treat them with the exosome agonist monensin for 30 minutes, then resuspend the fertilized eggs with a homogenate, and then ultrasonically shake them on ice to break the fertilized eggs to obtain a broken fertilized egg solution; centrifuge the broken fertilized egg solution and collect supernatant I; centrifuge the supernatant I and collect supernatant II and precipitate A; centrifuge the supernatant II and collect supernatant III containing the fertilized egg cytoplasmic matrix; resuspend the precipitate A with a homogenate and a LiCl solution, centrifuge it, and then resuspend it with a homogenate to obtain a solution IV containing the fertilized egg cell membrane;

[0009] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: The supernatant III and solution IV obtained in step (2) are mixed, and then the ATP regeneration system and incubation buffer are added and mixed, and then the CRISPR / Cas9 plasmid obtained in step (1) is added and mixed evenly to obtain a reaction solution, the reaction solution is placed in a metal bath at a temperature of 30°C for 20 minutes, and then centrifuged at 20,000×g, the precipitate B is collected and resuspended with PBS, and then enriched and purified with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and the engineered exosomes loaded with CRISPR / Cas9 plasmid are stored at -80°C for future use;

[0010] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmid obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae, wherein the incubation temperature is 24 to 30° C., and the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmid to the number of fertilized eggs is 1:10.

[0011] Furthermore, the aquatic animal includes any one of zebrafish, whiteleg shrimp, and Chlamys farreri.

[0012] Furthermore, the sgRNA includes any one of the following:

[0013] The sgRNA targeting the pIgR gene of Penaeus vannamei has a sequence of TCTGTCAGTACTGAACAACA as shown in sequence 1 in the sequence list;

[0014] The sequence of the sgRNA targeting the integrin gene of Penaeus vannamei is TGGAATTCGAGAGATCCATG as shown in sequence 2 in the sequence list;

[0015] The sequence of the sgRNA targeting the laminin gene of Penaeus vannamei is GTTGCTGGATCCGAGATGAG as shown in sequence 3 in the sequence list;

[0016] The sequence of the sgRNA targeting the Tyosimas gene of zebrafish is GGACTGGAGGACTTCTGGGG as shown in sequence 4 in the sequence list;

[0017] The sequence of the sgRNA targeting the Slc45a2 gene of zebrafish is GGGGAAGGTTGATTATGCAC as shown in sequence 5 in the sequence list;

[0018] The sequence of the sgRNA targeting the Myostatin gene of Chlamys farreri is GGCTGACTCAAGGTAGGGGA as shown in sequence 6 in the sequence table.

[0019] The sequence of the sgRNA targeting the SRB-like-3 gene of Chlamys farreri is GGAGCTTTGTAGGTCAATGA as shown in sequence 7 in the sequence table.

[0020] Furthermore, the homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0021] Furthermore, in step (2), the volume ratio of the homogenate solution to the fertilized egg is 10:1; the volume ratio of the homogenate solution to the precipitate A is 2:1; and the volume ratio of the LiCl solution to the precipitate A is 1:1.

[0022] Furthermore, in step (2), the fertilized eggs of aquatic animals treated with the exosome agonist monensin are collected, and then the fertilized eggs are resuspended in a homogenate solution, and then ultrasonically shaken on ice for 5 minutes to break the fertilized eggs to obtain a broken fertilized egg solution; the broken fertilized egg solution is centrifuged at a low speed of 1500×g for 10 minutes, and supernatant I is collected; the supernatant I is centrifuged at a high speed of 20000×g for 30 minutes, and supernatant II and precipitate A are collected; the supernatant II is centrifuged at 60000×g for 30 minutes, and supernatant III containing fertilized egg cytoplasmic matrix is ​​collected; the precipitate A is resuspended in a homogenate solution and a LiCl solution, and then centrifuged at 20000×g, and then resuspended with 5 times the volume of the homogenate to obtain a solution IV containing fertilized egg cell membranes.

[0023] Furthermore, in step (3), the volume ratio of the supernatant III, solution IV, ATP regeneration system and incubation buffer is 17:10:4:8, and the ratio of the volume of the supernatant III to the mass of the CRISPR / Cas9 plasmid is 17uL:200ng.

[0024] Compared with the prior art, this technical solution has the following beneficial effects:

[0025] 1. The present invention uses engineered exosomes to transport the constructed CRISPR-Cas9 vector (CRISPR / Cas9 plasmid) for site-specific editing of aquatic animal genes into fertilized eggs of aquatic animals, and transforms the endogenous genes of aquatic organisms to achieve inactivation of specific gene functions of aquatic animals, thereby achieving the purpose of improving the disease resistance of aquatic animal varieties. At the same time, the delivery method is non-microinjection, does not require any external force, can enable the CRISPR-Cas9 vector to effectively enter the cell, is simple and practical, is non-invasive or non-invasive to the fertilized eggs, and can achieve high-throughput and high-efficiency gene editing effects, solving the difficulties of low delivery efficiency and low throughput in the existing technology for molecular breeding of aquatic animals, and is conducive to promoting the rapid development of research on aquatic animals in ecology, genetics, development and evolution.

[0026] 2. The method of the present invention can simply and efficiently produce engineered exosomes carrying the gene editing system (sgRNA); the engineered exosomes can be easily taken up by the fertilized egg, ensuring that the gene editing system it carries can efficiently enter the fertilized egg, thereby improving the efficiency of the gene editing system in the fertilized egg. Moreover, the engineered exosomes themselves have no significant immune rejection reaction and will not cause damage to the recipient cells, and are safe and efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is a flow chart of the method of the present invention.

[0028] Figure 2 This is a particle size analysis diagram of the engineered exosomes loaded with CRISPR / Cas9 plasmid described in Example 1 before and after purification and enrichment using CD9 antibodies.

[0029] Figure 3 This is a graph showing the results of agarose gel electrophoresis detection of engineered exosomes loaded with CRISPR / Cas9 plasmids described in Examples 1 to 3.

[0030] Figure 4 It is a schematic diagram of the fluorescence microscopy observation results of the fertilized eggs, nauplii and mysid larvae of Penaeus vannamei co-incubated with the engineered exosomes loaded with CRISPR / Cas9 plasmids described in Examples 1 to 3 and incubated without the action of engineered exosomes.

[0031] Figure 5 The results are the results of PCR detection of pIgR, integrin and laminin at the gene level and transcriptome level in mysid shrimp larvae hatched from fertilized eggs of white shrimp Penaeus vannamei incubated without the action of engineered exosomes and co-incubated with engineered exosomes loaded with CRISPR / Cas9 plasmids.

[0032] Figure 6It is the Sanger sequencing result of the pIgR gene fragment of the white shrimp in Example 1 before and after the mutation. After being processed by the present invention, part of the gene fragment is missing.

[0033] Figure 7 It is the Sanger sequencing result of the integrin gene fragment of the white shrimp in Example 2 before and after the mutation. After being processed by the present invention, part of the gene fragment is missing.

[0034] Figure 8 This is the Sanger sequencing result of the laminin gene fragment of the white shrimp in Example 3 before and after the mutation. After being processed by the present invention, part of the gene fragment is missing. DETAILED DESCRIPTION

[0035] The present invention is further described by the following examples, but is not intended to be limiting of the present invention. Specific experimental conditions and methods not specified in the following examples are conventional methods commonly known to those skilled in the art.

[0036] Example 1: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0037] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the pIgR gene of white shrimp, and its sequence was TCTGTCAGTACTGAACAACA as shown in sequence 1 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain a CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0038] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: After the white shrimp ovulates, the fertilized eggs are collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 min. The fertilized eggs are then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 min to break the fertilized eggs (ultrasound is turned on for 3 s and off for 2 s) to obtain a broken fertilized egg solution; the broken fertilized egg solution is centrifuged at 1500 × g for 10 min, and the supernatant I is collected; the supernatant I is centrifuged at 20,000 × g for 30 min. min, and collect to obtain supernatant II and precipitate A; centrifuge the supernatant II at 60,000×g for 30 min, and collect to obtain supernatant III containing fertilized egg cytoplasmic matrix; resuspend the precipitate A with homogenate and LiCl solution, centrifuge at 20,000×g, and then resuspend with 5 times the volume of homogenate to obtain solution IV containing fertilized egg cell membrane; the volume ratio of the homogenate to the fertilized egg is 10:1; the volume ratio of the homogenate to the precipitate A is 2:1; the volume ratio of the LiCl solution to the precipitate A is 1:1;

[0039] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, and then 4ul of ATP regeneration system and 8uL of incubation buffer were added to mix, and then 200ng of CRISPR / Cas9 plasmid obtained in step (1) was added and mixed evenly by pipetting to obtain a reaction solution, and the reaction solution was placed in a metal bath at a temperature of 30°C for 20min, and then centrifuged at 20000×g, and the precipitate B was collected and resuspended with 50uL of PBS, and then enriched and purified with exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and the engineered exosomes loaded with CRISPR / Cas9 plasmid were stored at -80°C for future use, and detected by agarose gel electrophoresis (see Figure 3 ),like Figure 2 As shown, the engineered exosomes can encapsulate the loaded CRISPR / Cas9 plasmid;

[0040] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmid obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae (see Figure 4 and Figure 5), the incubation temperature is 26° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmid to the fertilized egg is 1:10, and the mixed solution of the engineered exosomes and the fertilized egg is gently stirred without harming the fertilized egg to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmid and the fertilized egg;

[0041] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0042] like Figure 6 As shown, the pIgR gene of the white shrimp treated by the method described in Example 1 was detected, and the gene detection results were compared with those before the treatment. It was found that after the treatment by the method described in Example 1, part of the pIgR gene fragment was missing.

[0043] Example 2: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0044] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the integrin gene of white shrimp, and its sequence was TGGAATTCGAGAGATCCATG as shown in sequence 2 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0045] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: After the white shrimp ovulates, the fertilized eggs are collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 minutes. The fertilized eggs are then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 minutes to break the fertilized eggs (ultrasound is turned on for 3 seconds and off for 2 seconds) to obtain a broken fertilized egg solution; the broken fertilized egg solution is centrifuged at 1500×g for 10 minutes, and the supernatant I is collected; the supernatant I is centrifuged at 20,000×g for 30 minutes. The supernatant II was centrifuged at 60000×g for 30 min, and a supernatant III containing the cytoplasmic matrix of the fertilized egg was collected; the precipitate A was resuspended with a homogenizing solution and a LiCl solution, and then centrifuged at 20000×g, and then resuspended with 5 times the volume of the homogenizing solution to obtain a solution IV containing the cell membrane of the fertilized egg; the volume ratio of the homogenizing solution to the precipitate A was 2:1; the volume ratio of the LiCl solution to the precipitate A was 1:1;

[0046] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, followed by adding 4uL of ATP regeneration system and 8uL of incubation buffer to mix, and then adding 200ng of CRISPR / Cas9 plasmid obtained in step (1), and mixing evenly by pipetting to obtain a reaction solution, placing the reaction solution in a metal bath at 30°C for 20min, and then centrifuging at 20000×g to collect the precipitate B and resuspend it in 5 volumes of PBS, and then enriching and purifying it with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and storing the engineered exosomes loaded with CRISPR / Cas9 plasmid at -80°C for future use, and detecting it by agarose gel electrophoresis (see Figure 3 );

[0047] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmid obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae (see Figure 4 and Figure 5 ), the incubation temperature is 28° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmid to the number of fertilized eggs is 1:10, and the mixed solution of engineered exosomes and fertilized eggs is gently stirred without harming the fertilized eggs to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmid and the fertilized eggs;

[0048] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0049] like Figure 7 As shown, the white shrimp treated by the method described in Example 2 was subjected to an integer gene test, and the gene test results were compared with those before the treatment. It was found that after the treatment by the method described in Example 2, part of the integer gene fragment was missing.

[0050] Example 3: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0051] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the integrin gene of white shrimp, and its sequence was GTTGCTGGATCCGAGATGAG as shown in sequence 3 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0052] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: After the white shrimp ovulates, the fertilized eggs are collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 minutes. The fertilized eggs are then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 minutes to break the fertilized eggs (ultrasound is turned on for 3 seconds and off for 2 seconds) to obtain a broken fertilized egg solution; the broken fertilized egg solution is centrifuged at 1500×g for 10 minutes, and the supernatant I is collected; the supernatant I is centrifuged at 20,000×g for 30 minutes. The supernatant II was centrifuged at 60000×g for 30 min, and a supernatant III containing the cytoplasmic matrix of the fertilized egg was collected; the precipitate A was resuspended with a homogenizing solution and a LiCl solution, and then centrifuged at 20000×g, and then resuspended with 5 times the volume of the homogenizing solution to obtain a solution IV containing the cell membrane of the fertilized egg; the volume ratio of the homogenizing solution to the precipitate A was 2:1; the volume ratio of the LiCl solution to the precipitate A was 1:1;

[0053] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, followed by adding 4uL of ATP regeneration system and 8uL of incubation buffer to mix, and then adding 200ng of CRISPR / Cas9 plasmid obtained in step (1), and mixing evenly by pipetting to obtain a reaction solution, placing the reaction solution in a metal bath at 30°C for 20min, and then centrifuging at 20000×g to collect the precipitate B and resuspend it in 5 volumes of PBS, and then enriching and purifying it with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and storing the engineered exosomes loaded with CRISPR / Cas9 plasmid at -80°C for future use, and detecting it by agarose gel electrophoresis (see Figure 3 );

[0054] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmid obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae (see Figure 4 and Figure 5 ), the incubation temperature is 27° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmid to the fertilized egg is 1:10, and the mixed solution of the engineered exosomes and the fertilized egg is gently stirred without harming the fertilized egg to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmid and the fertilized egg;

[0055] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0056] like Figure 8 As shown, the laminin gene was detected for the white shrimp treated by the method described in Example 3, and the gene detection results were compared with those before treatment. It was found that after treatment by the method described in Example 3, part of the laminin gene was missing.

[0057] Example 4: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0058] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the Tyosimas gene of zebrafish, and its sequence was GGACTGGAGGACTTCTGGGG as shown in sequence 4 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0059] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: zebrafish fertilized eggs were collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 min. The fertilized eggs were then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 min to break the fertilized eggs (ultrasound was turned on for 3 s and off for 2 s) to obtain a broken fertilized egg solution; the broken fertilized egg solution was low-speed centrifuged at 1500 × g for 10 min, and the supernatant I was collected; the supernatant I was centrifuged at 20,000 × g for 30 min. Centrifuge at high speed for 30 minutes, and collect supernatant II and precipitate A; centrifuge the supernatant II at 60,000×g for 30 minutes, and collect supernatant III containing fertilized egg cytoplasmic matrix; resuspend the precipitate A with homogenate and LiCl solution, centrifuge at 20,000×g, and then resuspend with 5 times the volume of homogenate to obtain solution IV containing fertilized egg cell membrane; the volume ratio of the homogenate to precipitate A is 2:1; the volume ratio of the LiCl solution to precipitate A is 1:1;

[0060] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, followed by adding 4uL of ATP regeneration system and 8uL of incubation buffer to mix, and then adding 200ng of CRISPR / Cas9 plasmid obtained in step (1), and mixing evenly by pipetting to obtain a reaction solution, placing the reaction solution in a metal bath at 30°C for 20min, and then centrifuging at 20000×g, collecting the precipitate B and resuspending it with 5 volumes of PBS, and then enriching and purifying it with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and storing the engineered exosomes loaded with CRISPR / Cas9 plasmid at -80°C for future use;

[0061] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmids obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae, wherein the incubation temperature is 30° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmids to fertilized eggs is 1:10, and the mixed solution of engineered exosomes and fertilized eggs is gently stirred without harming the fertilized eggs to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmids and the fertilized eggs;

[0062] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0063] The zebrafish treated by the method described in Example 4 were tested for the Tyosimas gene, and the results were compared with those before the treatment. It was found that after the treatment by the method described in Example 4, part of the Tyosimas gene was missing.

[0064] Example 5: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0065] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the Slc45a2 gene of zebrafish, and its sequence was GGGGAAGGTTGATTATGCAC as shown in sequence 5 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0066] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: zebrafish fertilized eggs were collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 min. The fertilized eggs were then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 min to break the fertilized eggs (ultrasound was turned on for 3 s and off for 2 s) to obtain a broken fertilized egg solution; the broken fertilized egg solution was low-speed centrifuged at 1500 × g for 10 min, and the supernatant I was collected; the supernatant I was centrifuged at 20,000 × g for 30 min. Centrifuge at high speed for 30 minutes, and collect supernatant II and precipitate A; centrifuge the supernatant II at 60,000×g for 30 minutes, and collect supernatant III containing fertilized egg cytoplasmic matrix; resuspend the precipitate A with homogenate and LiCl solution, centrifuge at 20,000×g, and then resuspend with 5 times the volume of homogenate to obtain solution IV containing fertilized egg cell membrane; the volume ratio of the homogenate to precipitate A is 2:1; the volume ratio of the LiCl solution to precipitate A is 1:1;

[0067] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, followed by adding 4uL of ATP regeneration system and 8uL of incubation buffer to mix, and then adding 200ng of CRISPR / Cas9 plasmid obtained in step (1), and mixing evenly by pipetting to obtain a reaction solution, placing the reaction solution in a metal bath at 30°C for 20min, and then centrifuging at 20000×g, collecting the precipitate B and resuspending it with 5 volumes of PBS, and then enriching and purifying it with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and storing the engineered exosomes loaded with CRISPR / Cas9 plasmid at -80°C for future use;

[0068] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmids obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae, wherein the incubation temperature is 29° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmids to fertilized eggs is 1:10, and the mixed solution of engineered exosomes and fertilized eggs is gently stirred without harming the fertilized eggs to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmids and the fertilized eggs;

[0069] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0070] The zebrafish treated by the method described in Example 5 were tested for Slc45a2 gene, and the results were compared with those before treatment. It was found that after treatment by the method described in Example 5, part of the Slc45a2 gene was missing.

[0071] Example 6: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0072] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the Myostatin gene of Chlamys farreri, and its sequence was GGCTGACTCAAGGTAGGGGA as shown in sequence 6 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0073] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: The fertilized eggs of Chlamys farreri were collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 min. The fertilized eggs were then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 min to break the fertilized eggs (ultrasound was turned on for 3 s and off for 2 s) to obtain a broken fertilized egg solution. The broken fertilized egg solution was centrifuged at 1500 × g for 10 min and the supernatant I was collected. The supernatant I was centrifuged at 20,000 × g for 30 min. The supernatant II and the precipitate A were collected after high-speed centrifugation for 30 minutes; the supernatant II was centrifuged at 60,000×g for 30 minutes, and the supernatant III containing the fertilized egg cytoplasmic matrix was collected; the precipitate A was resuspended with a homogenizing solution and a LiCl solution, and then centrifuged at 20,000×g, and then resuspended with 5 times the volume of the homogenizing solution to obtain a solution IV containing the fertilized egg cell membrane; the volume ratio of the homogenizing solution to the precipitate A was 2:1; the volume ratio of the LiCl solution to the precipitate A was 1:1;

[0074] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, followed by adding 4uL of ATP regeneration system and 8uL of incubation buffer to mix, and then adding 200ng of CRISPR / Cas9 plasmid obtained in step (1), and mixing evenly by pipetting to obtain a reaction solution, placing the reaction solution in a metal bath at 30°C for 20min, and then centrifuging at 20000×g, collecting the precipitate B and resuspending it with 5 volumes of PBS, and then enriching and purifying it with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and storing the engineered exosomes loaded with CRISPR / Cas9 plasmid at -80°C for future use;

[0075] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmids obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae, wherein the incubation temperature is 25° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmids to fertilized eggs is 1:10, and the mixed solution of engineered exosomes and fertilized eggs is gently stirred without harming the fertilized eggs to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmids and the fertilized eggs;

[0076] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0077] Myostatin gene detection was performed on the Chlamys farreri treated by the method described in Example 6, and the gene detection results were compared with those before treatment. It was found that after treatment by the method described in Example 6, part of the Myostatin gene fragment was missing.

[0078] Example 7: A method for efficiently delivering a gene editing plasmid in an aquatic animal, comprising the following steps:

[0079] (1) Preparation of CRISPR / Cas9 plasmid: sgRNA was designed based on the SRB-like-3 gene of Chlamys farreri, and its sequence was GGAGCTTTGTAGGTCAATGA as shown in sequence 7 in the sequence list; then, the sgRNA was inserted into the Cas9 plasmid vector to obtain a CRISPR / Cas9 plasmid, and the Cas9 plasmid vector was the SpCas9-2A-Puro V2.0 plasmid;

[0080] (2) Separation of cell membrane and cytoplasmic matrix of fertilized eggs: The fertilized eggs of Chlamys farreri were collected and enriched with a 300-mesh net and treated with the exosome agonist monensin for 30 min. The fertilized eggs were then resuspended in 10 times the volume of homogenate and then ultrasonically shaken on ice for 5 min to break the fertilized eggs (ultrasound was turned on for 3 s and off for 2 s) to obtain a broken fertilized egg solution. The broken fertilized egg solution was centrifuged at 1500 × g for 10 min and the supernatant I was collected. The supernatant I was centrifuged at 20,000 × g for 30 min. The supernatant II and the precipitate A were collected after high-speed centrifugation for 30 minutes; the supernatant II was centrifuged at 60,000×g for 30 minutes, and the supernatant III containing the fertilized egg cytoplasmic matrix was collected; the precipitate A was resuspended with a homogenizing solution and a LiCl solution, and then centrifuged at 20,000×g, and then resuspended with 5 times the volume of the homogenizing solution to obtain a solution IV containing the fertilized egg cell membrane; the volume ratio of the homogenizing solution to the precipitate A was 2:1; the volume ratio of the LiCl solution to the precipitate A was 1:1;

[0081] (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: 17uL of supernatant III obtained in step (2) and 10uL of solution IV were mixed, followed by adding 4uL of ATP regeneration system and 8uL of incubation buffer to mix, and then adding 200ng of CRISPR / Cas9 plasmid obtained in step (1), and mixing evenly by pipetting to obtain a reaction solution, placing the reaction solution in a metal bath at 30°C for 20min, and then centrifuging at 20000×g, collecting the precipitate B and resuspending it with 5 volumes of PBS, and then enriching and purifying it with an exosome marker protein CD9 antibody to obtain engineered exosomes loaded with CRISPR / Cas9 plasmid, and storing the engineered exosomes loaded with CRISPR / Cas9 plasmid at -80°C for future use;

[0082] (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmids obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae, wherein the incubation temperature is 24° C., the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmids to fertilized eggs is 1:10, and the mixed solution of engineered exosomes and fertilized eggs is gently stirred without harming the fertilized eggs to maximize the contact between the engineered exosomes loaded with CRISPR / Cas9 plasmids and the fertilized eggs;

[0083] The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

[0084] The SRB-like-3 gene was detected on the Chlamys farreri treated by the method described in Example 7, and the results were compared with those before treatment. It was found that after treatment by the method described in Example 7, some fragments of the SRB-like-3 gene were missing.

[0085] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A method for efficiently delivering gene editing plasmids in aquatic animals, characterized in that: The following steps are involved: (1) Preparation of CRISPR / Cas9 plasmid: sgRNA is obtained based on the gene design of aquatic animals, and then the sgRNA is inserted into the Cas9 plasmid vector to obtain the CRISPR / Cas9 plasmid; The aquatic animal is any one of zebrafish, whiteleg shrimp, and Chlamys farreri; When the aquatic animal is Penaeus vannamei, the sgRNA is any one of the following sgRNAs for Penaeus vannamei: The sgRNA targeting the pIgR gene of Penaeus vannamei has a sequence of TCTGTCAGTACTGAACAACA as shown in sequence 1 in the sequence list; The sequence of the sgRNA targeting the integrin gene of Penaeus vannamei is TGGAATTCGAGAGATCCATG as shown in sequence 2 in the sequence list; The sequence of the sgRNA targeting the laminin gene of Penaeus vannamei is GTTGCTGGATCCGAGATGAG as shown in sequence 3 in the sequence list; When the aquatic animal is a zebrafish, the sgRNA is any one of the following sgRNAs for zebrafish: The sequence of the sgRNA targeting the Tyosimas gene of zebrafish is GGACTGGAGGACTTCTGGGG as shown in sequence 4 in the sequence list; The sequence of the sgRNA targeting the Slc45a2 gene of zebrafish is GGGGAAGGTTGATTATGCAC as shown in sequence 5 in the sequence list; When the aquatic animal is Chlamys farreri, the sgRNA is any one of the following sgRNAs for Chlamys farreri: The sgRNA targeting the Myostatin gene of Chlamys farreri has a sequence of GGCTGACTCAAGGTAGGGGA as shown in sequence 6 in the sequence list; The sgRNA targeting the SRB-like-3 gene of Chlamys farreri has a sequence of GGAGCTTTGTAGGTCAATGA as shown in sequence 7 in the sequence list; (2) Separating the cell membrane and cytoplasmic matrix of fertilized eggs: collecting fertilized eggs of aquatic animals and treating them with the exosome agonist monensin for 30 minutes, then resuspending the fertilized eggs with a homogenizing solution, and then ultrasonically shaking on ice to break the fertilized eggs to obtain a broken fertilized egg solution; centrifuging the broken fertilized egg solution and collecting supernatant I; centrifuging the supernatant I and collecting supernatant II and precipitate A; The supernatant II is centrifuged and collected to obtain a supernatant III containing the fertilized egg cytoplasm matrix; the precipitate A is resuspended with a homogenizing solution and a LiCl solution, centrifuged, and then resuspended with a homogenizing solution to obtain a solution IV containing the fertilized egg cell membrane; (3) Preparation of engineered exosomes loaded with CRISPR / Cas9 plasmid: The supernatant III and solution IV obtained in step (2) were mixed, and then the ATP regeneration system and incubation buffer were added and mixed, and then the CRISPR / Cas9 plasmid obtained in step (1) was added and mixed evenly to obtain a reaction solution, and the reaction solution was placed in a metal bath at a temperature of 30°C for 20 minutes, and then incubated at 20000× g The mixture was centrifuged under the conditions of , and the precipitate B was collected and resuspended with PBS. The engineered exosomes loaded with CRISPR / Cas9 plasmid were obtained after enrichment and purification with exosome marker protein CD9 antibody. The engineered exosomes loaded with CRISPR / Cas9 plasmid were stored at -80°C for future use; The volume ratio of the supernatant III, solution IV, ATP regeneration system and incubation buffer is 17:10:4:8, and the ratio of the volume of the supernatant III to the mass of the CRISPR / Cas9 plasmid is 17uL:200ng; (4) Incubation of engineered exosomes with fertilized eggs: The engineered exosomes loaded with CRISPR / Cas9 plasmid obtained in step (3) are mixed with fertilized eggs and incubated to obtain gene-edited aquatic animal larvae, wherein the incubation temperature is 24 to 30° C., and the ratio of the number of engineered exosomes loaded with CRISPR / Cas9 plasmid to the number of fertilized eggs is 1:

10.

2. The method for efficiently delivering gene editing plasmids in aquatic animals according to claim 1, characterized in that: The homogenized solution includes 250 mM sorbitol, 137 mM sodium chloride, 10 mM PMSF, and is dissolved with Tris-HCl-pH 7.4; the concentration of the LiCl solution is 1 M; the ATP regeneration system includes 50 mM ATP, 200 mM GDP-mannose, 400 mM creatine phosphate, 20 mM creatine phosphate enzyme, 20 mM HEPEs-pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, and 5 mM magnesium acetate; the incubation buffer includes 80 mM potassium chloride, 20 mM calcium chloride, 12.5 mM HEPES-NaOH- pH 7.4, 1.5 mM MgOAc, and 1 mM DTT.

3. The method for efficiently delivering gene editing plasmids in aquatic animals according to claim 1, characterized in that: In step (2), the volume ratio of the homogenate solution to the fertilized egg is 10:1; the volume ratio of the homogenate solution to the precipitate A is 2:1; and the volume ratio of the LiCl solution to the precipitate A is 1:

1.

4. The method for efficiently delivering gene editing plasmids in aquatic animals according to claim 1, characterized in that: In step (2), fertilized eggs of aquatic animals are collected and treated with the exosome agonist monensin for 30 minutes, and then the fertilized eggs are resuspended in a homogenizing solution, and then ultrasonically shaken on ice for 5 minutes to break the fertilized eggs to obtain a broken fertilized egg solution; The broken fertilized egg solution was heated at 1500 × g Centrifuge at low speed for 10 min under the condition of , and collect the supernatant Ⅰ; The supernatant I was heated at 20000× g The mixture was centrifuged at high speed for 30 min under the condition of , and the supernatant II and precipitate A were collected; The supernatant II was heated at 60000× g The mixture was centrifuged for 30 min under the conditions of 40 °C and 10 °C, and the supernatant III containing the fertilized egg cytoplasm matrix was collected; the precipitate A was resuspended with a homogenate and a LiCl solution and then centrifuged at 20000 × g The mixture was centrifuged under the conditions of , and then resuspended with 5 times the volume of homogenate to obtain solution IV containing the fertilized egg cell membrane.

Images