Development and application of SNPs molecular markers related to chlorophyll content in barley seedlings
By developing a combination of SNP molecular markers related to the chlorophyll content in barley seedlings and using whole-genome association analysis and PCR amplification technology, we screened out barley germplasm resources with high chlorophyll content, solving the problem of difficulty in screening barley varieties with high chlorophyll content in existing technologies and achieving an increase in biomass and grain yield.
Patent Information
- Application Number
- CN202410205137.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-23
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-02-23
AI Technical Summary
Existing technologies make it difficult to efficiently screen and cultivate barley varieties with high chlorophyll content in the seedling stage, which affects the increase in biomass and grain yield.
A combination of SNP molecular markers related to chlorophyll content in barley seedlings was developed, including 9 SNP markers. They were identified through genome-wide association analysis and primer sets were designed for PCR amplification and sequencing to screen barley germplasm resources with high chlorophyll content.
It has achieved efficient detection and screening of chlorophyll content in barley seedlings, improved the efficiency of barley variety identification, and promoted the increase of biomass and grain yield.
Smart Images

Figure CN118086554B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular breeding, and in particular relates to the development and application of SNPs molecular markers related to chlorophyll content in barley seedlings. Background Art
[0002] Imported barley is primarily used for industrial purposes, with brewing accounting for over 85% of barley consumption. Barley is also used for feed, both as silage and as grain. Therefore, increasing aboveground biomass, including grain yield, is a key criterion in barley variety selection.
[0003] Chlorophyll is the building block of photosynthesis in green plants and the primary photosynthetic pigment in plant leaves. Plant light intensity and biomass yield are positively correlated with chlorophyll content. Previous studies have found that the locus on chromosome 2B that influences both dry matter yield and chlorophyll content in wheat seedlings under normal nitrogen supply is the same. Under low nitrogen stress, loci also correlate with both dry matter yield and chlorophyll content, revealing the importance of chlorophyll content in dry matter yield. Previous studies have also investigated the correlation between grain yield and chlorophyll content in various environments, identifying 11 additive QTLs associated with grain yield and chlorophyll content. Chromosome loci controlling both grain yield and chlorophyll content (Xcfd53, Xwmc718, and Xwmc215) are closely linked or have pleiotropic effects. In cereals such as maize, photosynthetic capacity and yield are closely related. Therefore, increasing chlorophyll content in crops may be an effective approach to increasing biomass and grain yield.
[0004] The SPAD-502 chlorophyll meter is currently the mainstream method for measuring chlorophyll content. Studies have shown a positive correlation between SPAD values and chlorophyll content. Genome-wide association studies (GWAS) have been widely used in gene mining and marker development in plants and animals. Using GWAS technology to correlate SPAD values with genome-wide SNP information in barley has revealed significant SNPs associated with chlorophyll content, providing an effective molecular tool for precision breeding of barley varieties and holding important implications for the development of high-light-efficiency crop varieties. Summary of the Invention
[0005] The purpose of the present invention is to provide the development and application of SNPs molecular markers related to the chlorophyll content of barley in the seedling stage. The SNPs molecular markers can be used to screen barley with high chlorophyll content in the seedling stage and can be used to cultivate new barley varieties with higher chlorophyll content in the seedling stage.
[0006] The present invention provides a SNP molecular marker combination related to the chlorophyll content of barley seedlings, including 9 SNPs, wherein two SNP molecular markers are developed for 29990466 and 650609585 of barley chromosome 2, respectively, and the polymorphisms are C / T and C / T, respectively;
[0007] Among them, seven SNP molecular markers were developed for 29155488, 28874187, 29720460, 28512754, 29534224, 29398399 and 28445460 on barley chromosome 4, and the polymorphisms were G / T, G / T, A / T, A / G, C / T, A / G and G / T, respectively.
[0008] Preferably, the sequences of the 9 SNP molecular markers are shown as SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12, SEQ ID No.15, SEQ ID No.18, SEQ ID No.21, SEQ ID No.24 and SEQ ID No.27.
[0009] Preferably, the chlorophyll content of barley at the seedling stage includes the relative content of chlorophyll at the seedling stage.
[0010] The present invention also provides a primer set for amplifying the above-mentioned SNP molecular marker combination, comprising the nucleotide sequence shown below:
[0011]
[0012] The present invention also provides the use of the primer set in SNPs polymerized molecular marker-assisted breeding related to chlorophyll content in barley seedlings.
[0013] The present invention also provides the use of the primer set in screening barley germplasm resources with high chlorophyll content at the seedling stage.
[0014] The present invention also provides a method for screening barley germplasm resources with high chlorophyll content in the seedling stage, comprising the following steps: using the genomic DNA of the target barley germplasm as a template, preparing a PCR amplification system with each pair of primers in the above primer set, performing a PCR amplification reaction, sequencing each amplification product, and obtaining genotyping and haplotype analysis of the target barley germplasm.
[0015] Preferably, the PCR amplification system, based on 50 μL, includes: 25 μL of 2×Phanta Max Master Mix, 2 μL each of 10 μmol / L upstream and downstream primers, 5 μL of template, and the balance of sterile water.
[0016] Preferably, the PCR amplification reaction procedure includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 15 s, 35 cycles; extension at 72°C for 5 min, and storage at 12°C.
[0017] Preferably, the dominant genotypes of the SNP molecular markers are: 4:29155488 (M1) T, 4:28874187 (M2) T, 4:29720460 (M3) A, 4:28512754 (M4) G, 4:29534224 (M5) C, 4:29398399 (M6) A, 4:28445460 (M7) T, 2:29990466 (M8) C and 2:650609585 (M9) T.
[0018] Beneficial effects: The present invention conducts genome-wide association analysis on the chlorophyll content of barley seedlings and identifies SNPs sites that have an increasing effect on the chlorophyll content in the seedling stage. For the first time, a set of SNPs aggregate molecular markers that are significantly associated with the chlorophyll content in the barley seedling stage are disclosed. This set of molecular markers is accurate and efficient in detection, convenient and stable in amplification, and the nine SNPs have an additive effect on the chlorophyll content. They can be used for molecular marker-assisted selection to improve the identification efficiency of different barley varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 To detect the aggregation effect of markers M1-M9 in 14 barley germplasm materials;
[0020] Figure 2 2. Box plot of SPAD values of chlorophyll content at seedling stage and GWAS haplotype analysis of 282 barley materials in Example 1;
[0021] Figure 3 This is the linear regression diagram of the optimal allele number and the chlorophyll content index SPAD value. DETAILED DESCRIPTION
[0022] The present invention provides a SNP molecular marker combination related to the chlorophyll content of barley seedlings, including 9 SNPs, wherein two SNP molecular markers are developed for 29990466 and 650609585 of barley chromosome 2, respectively, and the polymorphisms are C / T and C / T, respectively;
[0023] Among them, seven SNP molecular markers were developed for 29155488, 28874187, 29720460, 28512754, 29534224, 29398399 and 28445460 on barley chromosome 4, and the polymorphisms were G / T, G / T, A / T, A / G, C / T, A / G and G / T, respectively.
[0024] The barley genome referred to in the present invention is the Morex V3 version. The site information and base difference information of the SNPs molecular markers described in the present invention are shown in Table 1. Among the base differences in Table 1, the dominant genotypes with underlines are:
[0025] Table 1 SNPs molecular marker information
[0026] Tag Name chromosome physical location Base differences 4:29155488(M1) chr4H 29155488 G / T 4:28874187(M2) chr4H 28874187 G / T 4:29720460(M3) chr4H 29720460 A / T 4:28512754(M4) chr4H 28512754 A / G 4:29534224(M5) chr4H 29534224 C / T 4:29398399(M6) chr4H 29398399 A / G 4:28445460(M7) chr4H 28445460 G / T 2:29990466(M8) chr2H 29990466 C / T 2:650609585(M9) chr2H 650609585 C / T
[0027] In the present invention, the sequence of 4:29155488 (M1) is preferably as shown in SEQ ID No.3: CAT TCCACAAAGCCAGATTGTACTGGGCCAAAAACCAATCCTCAGTTCGAGGGTGTGGCGTGACCTCGTCCGGGGGTGCGATGGGGTCCTCCTCGTCACTGCACTACGCCCTCTCCTCTCCAGGTGGCGCCTCCTCCTCTGTTTGTGCACAGACCGGCCGTGCCATGACAGAGTTTTGTGCGAGGGGTGGGGGAGAGAGACGAGAGAGTGCAKGTGGGATTACATCTCGATAGGCAGCATTTATAGCCGGCTGGAATCTTGACCGACGCCAACAAAGTCCAAGGGGGCAGGCTGCAATGGACGCGCCGGTTGCTGGAATTCAGTGGTCTCGATTGCACACGATTGCTGAGTCAATAGCCTGTGTGACTTAACATCACCGACAATTCCCAATGCATGACCGCCTGGGATTAATAGCCCGCAAAATTTGTCTTCGAAAACTTGAAACACGAAAGAGAGAGCAAATCATGTGGGACCTGGTTGTCT; the sequence of 4:28874187 (M2) is preferably as shown in SEQ ID No.6:GGGTTGTCAATCCCTTCAAGATTGTTTGCAAAGTGAKA TCTCAAGGCAGAAAGTGCAACGAAGTAAAAAGTATAAGGCTGAAAATATGGTGTGGAGTAGGCCCGGGGGCCATAGTGTTCACTAGAGGATTCTCTCAAAATAGCAAATATCACGGTGGGTGAACAAATTACTGTCGAGCAATTGATAGAACCGCGCAAAGTCATGACGATATCTAAGGCAATGATCATACATATAGGCATCACGTCCGAGACAAGTAGACCGATACTTTCTGCATCTACTACTATTACTCCACACATGGACCGCTATCTAGCATGCATCTAGTGTATTGAGTTCATGACGAACAGAGTAACGCCA; the sequence of 4:2972046 (M3) is preferably as shown in SEQ ID No.As shown in Figure 9: TGGCA GGCTCCACGAAAGTGTCGAGGTCGATCCCGTCTGCAATGCGAGTGGCGCTCTCAAGGAAGGTCTCCAWGAAATCTTCGAATCGAAGGTTCTTGGTGTTGGCGACCTGCAACGCCTTCAGCTTCTCTTCGCGAGCCTCCTTGCAGTGCACTCGGACCAGCGACAACGCCACGTCCGCACCACAGCGAGCAGCAGA; The sequence of 4:28512754 (M4) is preferably as shown in SEQ ID No. 12: GGATCAACCGTTTCTTGGG GACTATATTTCTATTTGTAAGTTACATTAGTTCATTGTACTGAACTGCTGAATCGTTGTAGTGTTAGTGTTCAGTGCTTTATCTATTACTGAACTATACCAAAGTAAGCTGCTCATTTCAGGATTTAATTTCACTTGTTTATTATTCCTATATAAGGATCCTATGCTACAGTTTACTGATTGGATGCTACTTACAAGGGTGCTGGCATTTTGGCTAATGTTACCAACGTCTGTTTTGACAGTTATAACAGAGCTAAACAAAGATACTTGCAGGAGAAGGATGTTCAGCTCCGTCCATTCGATCATCTTGCCTCAGCTGCAGAAGCAGGTGCTTTGGTTCGTACAGTAAATCCTGATCTCRTATCTTTTTCTGATTTTGTGAGATTGGATGAGTTTAATGAAATTGGATTAAACAGTAACTAGGCCTTTGATAGAAAGCCTAACCTGACA; The sequence of 4:29534224 (M5) is preferably as shown in SEQ ID No.As shown in Figure 15: CGGAGGAATGCCTTTAGTGTATCTAACATCA CAACGTAACTGGGTGACTATAAAGATGCTCTACAGGTATCTCCGAAGGTGCCCGTTGAGTTAGTATGAATCAAGACTGGGATTTGTCACTCCGTGTGACGGAGAGGTATCTCGGGGCCCACTCGGTAATACAACATCACACACAAGCCTTGCAAGGAATGTGACTTACTGTAAGTCACGGGATCTTGTATTACGGAACGAGTAAAGAGACTTGCCGGTAAACGAGATTGAAATAGGTATGCGGATACTGACGATCGAAYCTCGGGCGAGTAACATACCGAAGGACAAAGGGAATGAC; The sequence of 4:29398399 (M6) is preferably as shown in SEQ ID No. 18: CTGATGAAGACTCGGGACAC ATCTGCCCAGCTGTAGATGCTTGACGGAGCCAACTGGTTCAGCCAAGCTCGCGCCGAGCCGTCTAGCATCAGGGGGAGATGTTTCATGGCGACCTGGTCATCTCCGCCACCGATCTGGACCACCACTCTGTAGTTGTCCAACCATGTTTCTGGCTTGGACTGTCCTGTGAACTTGCTGATTCCCRTCGCCAATCGGAAGTTGGGAGGGATGTCAGCTGAACGGATGGCCCGACTGAAGCACTCGGGGCCAGAGACAACGGTCCTGCTTCCA; The sequence of 4:28445460 (M7) is preferably as shown in SEQ ID No. 21: AGGGTCACCAAGGTAGCAAGAATTCGCGAAGGATAAAGCACTAG AKCAAAAACTAATTGGACCAATGGAGGAGTCACTTACCAATGAGTAATTTCCCCAAAATGGTTCGGAGAATGGTTCTTTGAGCAAGGAGATCAAAAATCACAGCCAAATGAGCAAGAACACAGGTTTGAGCTGCGAAACAATTTTTTCTGGAGGTGGAAGAAGAGGC; The sequence of 2:29990466 (M8) is preferably as shown in SEQ ID No.24 is shown: TCTGTTTCTAAGCCCTCTTATAGCTGATGTTGAAATTGGGGGCGTTCTC CTCTTTGATGACTAGCAAGTTGAACCTCAGTTTTGGAAGAGCTTGGAGCATTGCTCATCAAATTGCACGATAGCATCATAGTCGACTTCTCAGTGAAACGTCCTGTTGCAATTCATTCTTCTTCAAGTATCCATTGCATCTGTTCAGTTGTTCGACATGTTCTTCTCTGTTGCATTGTTTGGGA TCATCTCTACTCAGGTTTCAGATGGTGTTCTTGATATGYGTGGCAGTACACGCAATTGTAAAAGTAAGCTGAAAAATTCATTCTGATCATTTGGTACTGCACGTACTATGTTCCATTGCAGGGTAATTGCTCGGCTGCCCACATCACTTGTAGGCTAC; the sequence of 2:650609585 (M9) is preferably as SEQ ID No.27 shows: CACCATCCCTGCCAAAGTCACAACTAAGGTTA ACCAAGCAGAGTTAACCCTTTCTAACTTCATTTGTTATTTTGCATGTATTTAATGATTTATTTGAACTAAATGACCTTGAAATTGAAAAGCACTATAATGAACTCTAAAAACGTTGAAACTTAACATGGTATCATCATTTCAACCACATAGCTTGTGCTAAAAAGTTGAGAGGGTTACGGCAAAAACTGGATGCACTTCGTGTACAAACTGGACCATCTCTTTCGAAGTATCAAGGTTTCACAYGAAACCCATCTACTACAAAGGCATTTTTTAAAATTATTTCAACTCCAGACTTATTGTGCATTTAATATGCACCATACTACAAGAT. In the sequence described in the present invention, the degenerate sequence K represents G / T, W represents A / T, R represents A / G, and Y represents C / T.
[0028] The chlorophyll content of barley at the seedling stage of the present invention preferably includes the relative content of chlorophyll at the seedling stage, which is expressed as a SPAD value.
[0029] The present invention also provides a primer set for amplifying the above-mentioned SNP molecular marker combination. The primer set is designed according to the above-mentioned SNPs sites. The primer pair sequence, sequence number, amplification product length and position information of the SNPs in the amplified fragment used to amplify the SNPs molecular marker are shown in Table 2.
[0030] Table 2 Sequences and numbers of the primer sets of the present invention
[0031]
[0032]
[0033] The present invention also provides the use of the primer set in SNPs polymerized molecular marker-assisted breeding related to chlorophyll content in barley seedlings.
[0034] Using the above primer pairs to perform PCR amplification and sequencing analysis on different barley genotypes can effectively screen barley germplasm resources with different chlorophyll contents in seedlings. Specifically, in combination with the base difference column in Table 1, the chlorophyll content of the materials containing the underlined base types in the seedling stage was significantly higher than that of the other types.
[0035] The present invention also provides the use of the primer set in screening barley germplasm resources with high chlorophyll content at the seedling stage.
[0036] The application of the present invention is preferably the same as described above and will not be described again here.
[0037] The present invention also provides a method for screening barley germplasm resources with high chlorophyll content in the seedling stage, comprising the following steps: using the genomic DNA of the target barley germplasm as a template, preparing a PCR amplification system with each pair of primers in the above primer set, performing a PCR amplification reaction, sequencing each amplification product, and obtaining genotyping and haplotype analysis of the target barley germplasm.
[0038] The PCR amplification system of the present invention preferably includes, based on 50 μL, 25 μL of 2×Phanta Max MasterMix, 2 μL each of 10 μmol / L upstream and downstream primers, 5 μL of template, and the remainder of sterile water. The PCR amplification reaction procedure preferably includes: pre-denaturation at 95°C for 3 minutes; 35 cycles of denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 15 seconds; extension at 72°C for 5 minutes, and storage at 12°C. In the present invention, the amplified product after PCR amplification is sequenced. If the base at the SNP site is underlined, the barley variety to be tested has a high chlorophyll content in the seedling stage; otherwise, it has a low chlorophyll content in the seedling stage.
[0039] To further illustrate the present invention, the development and application of SNPs molecular markers related to chlorophyll content in barley seedlings provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.
[0040] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
[0041] The barley material used in the present invention can be obtained from the Institute of Crop Science, Zhejiang University. The biochemical reagents used in the present invention are all commercially available.
[0042] The information of 282 barley germplasms used in the examples of the present invention is shown in Table 3.
[0043] Table 3282 Barley germplasm information
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050] Example 1
[0051] Example 1
[0052] (1) Test materials
[0053] 282 global barley germplasm resources were used as materials.
[0054] (2) Characteristic determination
[0055] Measure a certain amount of nutrient soil (Danish Pinner peat soil 0-10mm), add a certain amount of tap water and stir evenly, and put the certain amount (fill the holes with soil) into a 32-hole seedling tray for later use. Select barley seeds in good seed condition, sow 4 holes for each material, sow three seeds in each hole, place them in a growth room at 22°C, with a relative air humidity of 60% and a photoperiod of 18h / 6h light / dark. Thin out the seedlings when they grow to 5cm, and retain 4 single plants with consistent growth for each material. After 21 days of indoor growth, the whole material enters the three-leaf stage. Use the chlorophyll meter SPAD-502PLUS to measure the upper, middle and lower parts of the leaves. The average of the three parts is used as the SPAD value of the leaf, and the average of the three leaves is used as the SPAD value of the plant. 3 plants are measured for each material. The experiment was repeated 3 times under the same conditions of water, fertilizer and growth environment to ensure the reliability of the data.
[0056] (3) GWAS analysis and SNP molecular marker determination
[0057] Combining the SPAD values of barley seedlings measured above and the genome-wide SNP marker information of the population, GWAS analysis was performed using EMMAX software. The results showed that a total of 9 SNPs markers located on chromosomes 2 and 4 were significantly associated with the chlorophyll content of barley seedlings. The information of the 9 SNPs is detailed in Table 1.
[0058] (4) Haplotype analysis
[0059] Haplotype analysis was performed by combining SNP markers with the SPAD values of chlorophyll content in the seedling stage of 282 test materials. The results are as follows Figure 2 Among them, SNP typing is divided into two categories. Specifically, in combination with the base difference column in Table 1, the chlorophyll content of the materials containing the underlined base types at the seedling stage is significantly higher than that of the other types.
[0060] Example 2
[0061] (1) Test materials
[0062] Fourteen global barley mini-core germplasm resources were used to detect the aggregate effect of nine SNPs markers on the SPAD value, a characteristic value of chlorophyll content in barley seedlings.
[0063] Table 4 Detection of aggregation effect of markers M1-M9 in 14 barley germplasm materials
[0064]
[0065]
[0066] (2) Acquisition of SNP markers
[0067] According to the SNP site information in Table 1 and combined with the whole genome sequence information of barley, SNP marker primers were developed. The details of the amplification primers for the nine SNPs molecular markers are shown in Table 2, and the variations on the corresponding chromosomes of barley were detected.
[0068] (3) DNA extraction
[0069] Fresh leaves at the seedling stage were used as materials to extract DNA using the CTAB method. The detailed steps are as follows:
[0070] a) Place approximately 5 g of young barley leaves in a 2 ml centrifuge tube, add two steel balls cleaned with 75% alcohol, and grind in an automatic grinding machine at 55 Hz for 1 minute.
[0071] b) Add 400 μL of CTAB extraction buffer and place in a 65°C water bath for 1 hour, shaking every 10 minutes. After the water bath, cool to room temperature.
[0072] c) Add an equal volume of chloroform:isoamyl alcohol (24:1) solution, shake thoroughly, centrifuge at 12,000 rpm for 10 min, and transfer the supernatant to a new 1.5 ml centrifuge tube;
[0073] d) Add 2 / 3 of the supernatant volume of pre-chilled isopropanol, shake gently up and down for 30 seconds to thoroughly mix the isopropanol and aqueous layer, and let stand at -20°C for 20 minutes to precipitate the DNA;
[0074] e) Centrifuge at 12000 rpm for 10 min, discard the supernatant, and add 500 μL of 70% alcohol to wash the DNA;
[0075] f) Centrifuge at 12000 rpm for 3 min to discard the alcohol, wash twice, and air-dry in a clean bench;
[0076] g) Add 50 μL ddH2O to dissolve the DNA and store at -20°C until use.
[0077] (4)PCR
[0078] The PCR amplification reaction system was as follows: 25 μL of 2×PhantaMax MasterMix (Vazyme), 2 μL of each of 10 μmol / L PrimerF / R, 5 μL of 100 ng / μl template DNA, and 16 μL of sterile water, with a total reaction system volume of 50 μL.
[0079] The PCR reaction was performed on a PCR instrument with the following program: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 15 s; extension at 72°C for 5 min, and storage at 12°C.
[0080] (5) After the reaction, the reaction products were sequenced for genotyping identification, and then the number of dominant genotypes in each sample was counted as shown in Table 4 to evaluate the aggregation effect of the nine SNPs ( Figure 1 ), and draw a linear regression diagram of the optimal allele number and the chlorophyll content index SPAD value as shown in Figure 3 As shown, combined Figure 1 、 Figure 2 and Figure 3 It can be seen that a single dominant SNP can significantly increase the SPAD value, and as the number of dominant SNPs increases, the individual SPAD value shows an upward trend.
[0081] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A SNP molecular marker combination associated with chlorophyll content in barley seedlings, characterized in that: The sequences of the SNP molecular marker combination are shown as SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12, SEQ ID No.15, SEQ ID No.18, SEQ ID No.21, SEQ ID No.24 and SEQ ID No.27; The SNP molecular markers in SEQ ID No. 24 and SEQ ID No. 27 were developed for positions 29990466 and 650609585 of barley chromosome 2, respectively, and the polymorphisms were C / T and C / T, respectively; Among them, the SNP molecular markers in SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12, SEQ ID No.15, SEQ ID No.18 and SEQ ID No.21 were developed for positions 29155488, 28874187, 29720460, 28512754, 29534224, 29398399 and 28445460 of barley chromosome 4, respectively, and the polymorphisms are G / T, G / T, A / T, A / G, C / T, A / G and G / T, in that order; The barley genome is the Morex V3 version.
2. The SNP molecular marker combination according to claim 1, characterized in that: The chlorophyll content of barley at the seedling stage includes the relative content of chlorophyll at the seedling stage.
3. A primer set for amplifying the SNP molecular marker combination according to claim 1 or 2, characterized in that: Includes the nucleotide sequence shown below: 。 4. Use of the primer set according to claim 3 in SNP polymerase chain reaction (SNP) marker-assisted breeding related to chlorophyll content in barley seedlings.
5. Use of the primer set according to claim 3 in screening barley germplasm resources with high chlorophyll content at the seedling stage.
6. A method for screening barley germplasm resources with high chlorophyll content at the seedling stage, characterized in that: The following steps are involved: Using the genomic DNA of the target barley germplasm as a template, preparing a PCR amplification system with each pair of primers in the primer set of claim 3, performing a PCR amplification reaction, sequencing each amplification product, and obtaining genotyping and haplotype analysis of the target barley germplasm; Among them, the dominant genotype at position 29155488 of barley chromosome 4 is T, the dominant genotype at position 28874187 is T, the dominant genotype at position 29720460 is A, the dominant genotype at position 28512754 is G, the dominant genotype at position 29534224 is C, the dominant genotype at position 29398399 is A, and the dominant genotype at position 28445460 is T; The dominant genotype at position 29990466 of barley chromosome 2 is C, and the dominant genotype at position 650609585 is T.
7. The method according to claim 6, characterized in that The PCR amplification system, based on 50 μL, includes: 25 μL of 2×PhantaMax Master Mix, 2 μL of each of 10 μmol / L upstream and downstream primers, 5 μL of template, and the balance of sterile water.
8. The method according to claim 6 or 7, characterized in that: The PCR amplification reaction procedure includes: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 58° C. for 15 s, and extension at 72° C. for 15 s, for 35 cycles; extension at 72° C. for 5 min, and storage at 12° C.
Citation Information
Patent Citations
Markers for salinity tolerance in wheat plants and the use thereof in breeding programs
WO2005120214A1