A perylene imide derivative PDIC-NS and its applications

By designing the perylene imide derivative PDIC-NS, the cGAS-STING pathway is activated by targeting mitochondria, thus solving the problem of immunosuppression in lung cancer treatment and achieving highly efficient inhibition of lung cancer cells and immunotherapy effects.

CN118108720BActive Publication Date: 2026-03-10HENAN UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing lung cancer treatments suffer from low immunogenicity due to the immunosuppressive tumor microenvironment. Traditional treatments also have issues such as drug resistance, toxic side effects, and tumor recurrence and metastasis. Furthermore, STING agonists have poor pharmacokinetics and low utilization rates, making it difficult to trigger intratumoral drug action through intravenous injection.

Method used

A perylene imide derivative, PDIC-NS, was developed. By targeting mitochondria, it generates ROS to activate the cGAS-STING immune signaling pathway. Combined with adaptive immunity, it achieves targeted therapy of a single organ and activates innate immunity, reduces the activity of cGAMP hydrolase ENPP1, increases cGAMP upregulation, and activates the cGAS-STING pathway.

Benefits of technology

It significantly inhibits the proliferation of lung cancer cells, targets the lungs, and produces potent dual immunotherapy and chemotherapy effects, activating innate and adaptive immunity to effectively suppress primary tumors and metastases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118108720B_ABST
    Figure CN118108720B_ABST
Patent Text Reader

Abstract

This invention provides a perylene imide derivative PDIC-NS and its applications, belonging to the field of biomedicine. The structure of the perylene imide derivative PDIC-NS is as follows, wherein R = F, Cl, Br or I. PDIC-NS can target mitochondria, generate ROS, damage mitochondria, and promote Ca2+ metabolism. 2+ Overload causes endoplasmic reticulum stress, inducing ICD effects and activating adaptive immune responses. PDIC-NS acts on the ROS produced by LLC cells, causing DNA damage. The leaked double-stranded DNA in the cytoplasm is recognized by cGAS, catalyzing the synthesis of cGAMP, activating the cGAS-STING pathway, producing type I interferon, and initiating an innate immune response. On the other hand, the introduction of methanesulfonate inhibits the activity of the cGAMP hydrolase ENPP1, reducing its degradation of cGAMP, increasing cGAMP upregulation, and better activating the cGAS-STING pathway. PDIC-NS thus achieves lung cancer immunotherapy induced by chemotherapy and dual immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a perylene imide derivative PDIC-NS and its applications. Background Technology

[0002] Lung cancer is a malignant tumor originating from the primary bronchial mucosa or glands of the lungs. It is currently one of the malignant tumors with high incidence and mortality rates. Therefore, developing effective treatment strategies for lung cancer is imperative. As traditional treatments become increasingly inadequate, highly effective tumor immunotherapy has been widely used in lung cancer treatment. Compared with traditional treatments, immunotherapy is a method that activates the host's own immune system to attack cancer cells. Because it can activate the body's immune system, reverse the tumor microenvironment, and effectively inhibit primary tumors and metastases, immunotherapy has shown unprecedented application prospects in clinical cancer treatment.

[0003] While immunotherapy has achieved significant success, it still faces many challenges in clinical practice, such as low patient response rates, an immunosuppressive tumor microenvironment, and low immunogenicity of tumor cells. In contrast, traditional cancer treatments can effectively suppress tumors, but suffer from severe drug resistance, toxic side effects on normal tissues, and tumor recurrence and metastasis. Fortunately, combining traditional treatments with immunotherapy can effectively leverage their synergistic effects, better addressing these issues by activating the body's immune system, reshaping the tumor microenvironment, and improving treatment efficacy while simultaneously exerting the tumor-killing effects of chemotherapy. Therefore, combination therapy strategies related to immunotherapy not only enhance the advantages of each individual therapy but also compensate for the shortcomings of single-modality treatments, providing a novel treatment strategy for tumor metastasis and recurrence.

[0004] Despite significant progress in combination therapy, low immunogenicity caused by the immunosuppressive tumor microenvironment remains a pressing issue in immunotherapy. Therefore, activating the body's immune system, remodeling the tumor microenvironment, and enhancing tumor immunogenicity are key factors in improving cancer treatment efficacy. The STING (Spiritual Interferon Gene Stimulating Factor) signaling pathway is a promising target for cancer immunotherapy. Activation of intracellular STING protein triggers the secretion of various immunomodulatory cytokines. Under appropriate conditions, these cytokines can drive dendritic cell (DC) maturation, promote the initiation and activation of effector T lymphocytes, remodel the tumor microenvironment, and induce cancer cell death, thereby leading to immune-mediated tumor elimination. Ongoing preclinical and clinical studies aim to further understand the role of the STING pathway in cancer immunotherapy, thus developing modulators of this pathway as a strategy to stimulate anti-tumor immune responses. However, STING agonists face challenges such as poor pharmacokinetics, low drug utilization, short circulation time, severe organ accumulation, and intratumoral injection. Therefore, it is of great significance to develop a comprehensive drug that can trigger intratumoral drug action through intravenous injection, target a single organ, activate innate and adaptive immunity, and extend the therapeutic effect to the whole body. Summary of the Invention

[0005] To address the above problems, this invention provides a perylene imide derivative PDIC-NS and its applications.

[0006] Based on the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A perylene imide derivative, PDIC-NS, has the following structure:

[0008]

[0009] Where R = F, Cl, Br or I.

[0010] The synthetic route for preparing the above perylene imide derivative PDIC-NS is as follows:

[0011]

[0012] Where R = F, Cl, Br or I,

[0013] The synthesis process is as follows:

[0014] (1) Take compound 1, glacial acetic acid and N,N-dimethylethylenediamine, add them to NMP in sequence, pass argon gas, and after the reaction is complete at 120±10℃, transfer the reactants to a beaker and cool to room temperature, add anhydrous ethanol, stir thoroughly with a glass rod, let stand, filter, dry under vacuum, recrystallize multiple times to obtain PDIC-NN.

[0015] (2) Dissolve PDIC-NN in acetone, add ultrapure water, pass argon gas through, add methanesulfonic acid, and react completely at 50-60℃. Cool the mixture after reaction to room temperature, adjust the temperature to 0-10℃, keep warm and stir for 1-1.5h, filter, wash the filter cake with acetone and dry to obtain PDIC-NS.

[0016] Further, in step (1), the molar ratio of compound 1 to N,N-dimethylethylenediamine is 1:10, and 15 mL of glacial acetic acid and 10 mL of NMP are added for every 1 mmol of compound 1; in step (2), the molar ratio of PDIC-NN to methanesulfonic acid is 1:2.5.

[0017] The above-mentioned perylene imide derivative PDIC-NS is used in the preparation of fluorescent probes for the lungs and mitochondria.

[0018] The application of the above-mentioned perylene imide derivative PDIC-NS in the preparation of anti-lung cancer drugs.

[0019] The anti-lung cancer drug is one that can generate reactive oxygen species in lung cancer cells, thereby activating the cGAS-STING immune signaling pathway.

[0020] Furthermore, the lung cancer cells are A549 and / or LLC cells.

[0021] This application designs and synthesizes a perylene imide derivative, PDIC-NS, through... 1 H-NMR, 13 C-NMR and mass spectrometry verified the correct structure. UV and fluorescence spectroscopy revealed good water solubility and fluorescence properties. In vivo tissue imaging in small animals using fluorescence properties confirmed that PDIC-NS could achieve dominant localization in the lungs. The results indicate that PDIC-NS can target mitochondria, disrupting their structure and promoting the generation of ROS and related free radicals. The generated hydroxyl radicals (·OH) can damage DNA, causing leakage of mitochondrial DNA (mtDNA) and nuclear DNA into the cytoplasm. After being recognized by cGAS, mtDNA is synthesized, thereby activating the cGAS-STING pathway, producing I-IFN, and initiating innate immunity. The introduction of methanesulfonate inhibits the activity of the cGAMP hydrolase ENPP1, reducing its degradation of cGAMP, increasing cGAMP upregulation, and better activating the cGAS-STING pathway. On the other hand, high levels of ROS cause endoplasmic reticulum stress, promoting intracellular calcium... 2+Increased concentrations induce ICD effects, activating the body's adaptive immunity. The activated innate and adaptive immunity effectively suppresses primary and metastatic tumors. In summary, this study provides a novel approach to lung cancer treatment. PDIC-NS, through lung-dominant targeting, generates ROS that activates the STING pathway and induces ICD effects, ultimately enabling a potent combination of dual immunotherapy and chemotherapy for lung cancer treatment. Attached Figure Description

[0022] Figure 1 The 1H NMR spectrum of PDIC-NS;

[0023] Figure 2 The carbon NMR spectrum of PDIC-NS;

[0024] Figure 3 High-resolution mass spectrometry for PDIC-NS;

[0025] Figure 4 The UV and fluorescence spectra of PDIC-NS;

[0026] Figure 5 Representative mitochondrial colocalization images and coefficients (R) of LLC cells stained with Mito-tracker probe (green fluorescence) and PDIC-NS (red fluorescence); scale bar, 10 μm;

[0027] Figure 6 LLC cells were incubated with 2.5 μM OXA and PDIC-NS for 6 h each. The total ROS, H2O2, and O2 levels were then measured. ·- Inverted fluorescence images and fluorescence quantification results of ·OH, ns indicates no statistical difference, *P<0.05, ***P<0.001;

[0028] Figure 7 mtDNA copy number in LLC cells after 12 h of PDIC-NS treatment, *P<0.05, **P<0.01;

[0029] Figure 8 Nucleus damage (top) and representative images of Picogreen fluorescence after LLC cells were incubated with 2.5 μM PDIC-NS and OXA labeled with γ-H2AX for 8 h.

[0030] Figure 9 In the study: (A) concentration-dependent inhibitory activity of PDIC-NS on ENPP1 and (B) release of ATP and 2',3'-cGAMP in LLC cells after 6 hours of incubation with PDIC-NS and OXA (2.5 μM), *P<0.05, **P<0.01;

[0031] Figure 10 Western blot analysis of the cGAS-STING pathway was performed on LLC cells after incubation with 2.5 μM PDIC-NS and OXA for 6 h each.

[0032] Figure 11 In vitro fluorescence images of major organs over time, collected from LLC tumor mice after intravenous injection of 2 mg / kg PDIC-NS;

[0033] Figure 12 (A) Timeline of LLC-lung metastasis establishment and in vivo chemotherapy and immunotherapy; (B, C) Photographs of lung tissue enlargement in WT mice and STING KO mice, respectively; (D, E) Data statistics of metastatic nodules and weight of resected lung tissue in WT mice and STING KO mice after different treatments on day 24; *P<0.05,**P<0.01,***P<0.001. Detailed Implementation

[0034] The technical solution of the present invention will be further described below with reference to examples, but the scope of protection of the present invention is not limited thereto.

[0035] In the following experiments, 2.5, 5, 10 μMP DIC-NS or OXA all refer to their aqueous solutions.

[0036] Example 1:

[0037] I. Synthesis and Characterization of PDIC-NS

[0038] The synthetic route for N,N'-bis(2-(trimethylammonium)methylsulfonate)-1,2,7,8-tetrachloro-3,4,9,10-peryleneimide (PDIC-NS) is as follows:

[0039]

[0040] The specific synthesis process is as follows:

[0041] 1,6,7,12-Tetrachloro-3,4,9,10-perylenetetracarboxylic acid dianhydride (265.05 mg, 1.0 mmol), glacial acetic acid (15 mL), and 1 mL (10.00 mmol) of N,N-dimethylethylenediamine were added sequentially to a three-necked flask containing N-methylpyrrolidone (NMP) (10 mL). A large volume of argon gas (Ar) was introduced, and the mixture was reacted at 120 °C for 24 h. The reactants were transferred to a 500 mL beaker, cooled to room temperature, and 200 mL of anhydrous ethanol was added. After thorough stirring with a glass rod, the mixture was allowed to stand, filtered, and dried under vacuum. Recrystallization was performed multiple times using methanol and diethyl ether (V / V, 1:3) to obtain the red solid PDIC-NN.

[0042] N,N'-1,2,7,8-tetrachloro-bis(2-(trimethylammonium)ethylene)-3,4,9,10-peryleneimide PDIC-NN (50 mg, 0.149 mmol) was dissolved in acetone (10 mL), and 10 μL of ultrapure water was added. After purging with a large amount of argon (Ar) for 10 min, 20 μL (0.370 mmol) of methanesulfonic acid was added, and the mixture was reacted at 55 °C for 1 h. The reaction mixture was cooled to room temperature, adjusted to 5 °C, and stirred for 1 h. The mixture was then filtered, the filter cake was washed several times with acetone, and dried in a drying oven to obtain an orange-red solid PDIC-NS. 1 H NMR, 13 For detailed C NMR spectra, please refer to Figure 1 , Figure 2 For details on high-resolution mass spectrometry, please refer to [link / reference]. Figure 3 .

[0043] Depend on Figures 1 to 3 It can be seen that PDIC-NS (73.78 mg, 73.78%) 1 H NMR (400MHz, DMSO-d6) δ9.19 (s, 2H), 8.64 (s, 4H), 4.46 (d, J = 4.6Hz, 4H), 3.49 (d, J = 5.6Hz, 4H), 2.96-2.92 (m, 13H), 2.27 (s, 6H); 13 C NMR(126MHz,DMSO-d6)δ162.80,134.78,132.13,131.32,128.33,124.24,123.65,55.14,43.46,43.18,40.06,35.90.ESI-MS,m / z calcd for C 32 H 26 Cl4N4O4 2+ :670.0697;found:335.0349[M 2+ / 2].

[0044] II. UV and Fluorescence Detection of PDIC-NS

[0045] Weigh out PDIC-NS and dissolve it in 4 mL of ultrapure water, then sonicate to prepare a final concentration of 5 × 10⁻⁶. -6 A mol / L solution was prepared. Subsequently, ultrapure water was used as a control group, and the ultraviolet and fluorescence spectra of the PDIC-NS aqueous solution were measured using appropriate spectroscopic instruments.

[0046] Depend on Figure 4It can be seen that PDIC-NS exhibits good water solubility and excellent fluorescence properties. PDIC-NS has a strongest absorption peak at 525 nm; in the 500-700 nm range, the compound has good fluorescence stability, and the fluorescence absorption intensity reaches its maximum at 575 nm, indicating that the compound PDIC-NS has stable fluorescence properties.

[0047] III. Cell proliferation experiment of PDIC-NS

[0048] Human non-small cell lung cancer cells (A549), mouse Lewis lung cancer cells (LLC), normal mouse lung epithelial cells (MLE-12), and human cervical cancer cells (HeLa) were used. Cells were inoculated with 10% fetal bovine serum (FBS) at a concentration of 0.1 mg / mL. -1 Streptomycin and 100 U mL -1 Mouse melanoma cells (B16) were cultured in high-glucose DMEM medium containing penicillin (double antibiotic). All cells required for the experiment were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. LLC tumor cells were cultured at 7.0 × 10⁻⁶. 3 Seeds were inoculated per well in 96-well plates and incubated at 37°C for 12 h, followed by culture medium replacement. Different concentrations of PDIC-NS and oxaliplatin (OXA) were added to the experimental groups, and the plates were incubated for 24 h. After washing three times with PBS, MTT working solution was added and incubated at 37°C for 4 h. The MTT working solution was discarded, and DMSO was added. The plates were then gently shaken on a shaker for 8 min to fully dissolve the formazan. The absorbance (OD) at 492 nm was measured using a microplate reader. The data were processed, and the half-inhibitory concentration (IC50) was calculated. 50 Values. See Table 1 for detailed results.

[0049] Table 1 ICs for different processing groups 50 (μg mL -1 )value

[0050]

[0051] Table 1 shows the effects of PDIC-NS on the proliferation of cancer cells with high incidence rates worldwide, including human non-small cell lung cancer (A549), mouse Lewis lung cancer cells (LLC), human cervical cancer cells (HeLa), and mouse melanoma cells (B16). With increasing PDIC-NS concentration, the viability of all four cell lines significantly decreased. Compared to B16 and HeLa cells, PDIC-NS exhibited the best in vitro inhibitory activity against human lung cancer cells (A549) and mouse lung cancer cells (LLC). Simultaneously, the clinical drug oxaliplatin (OXA) was selected for comparison. Table 1 shows the relevant IC50 values ​​for oxaliplatin's inhibitory effect on cancer cell proliferation. 50The values ​​show the IC50 values ​​of compounds PDIC-NS and OXA on A549 cells. 50 Value (IC) 50PDIC-NS =1.18±0.11μg mL -1 IC 50OXA =24.75±1.21μg mL -1 ), for LLC cells (IC 50PDIC-NS =0.87±0.17μg mL -1 IC 50OXA =10.79±1.01μgmL -1 ), from IC 50 The results showed that PDIC-NS had a significantly better inhibitory effect on lung cancer cells than the clinical chemotherapy drug OXA, and an even better inhibitory effect on LLC cells. Therefore, LLC lung cancer cells were selected for subsequent experimental studies in this application. Subsequently, the effect of PDIC-NS on the proliferation of normal mouse lung epithelial cells MLE-12 was investigated. As shown in Table 1, after 24 hours of treatment with PDIC-NS, the proliferation rate of MLE-12 cells was significantly higher than that of mice with normal lung epithelial cells (IC50-12). 50PDIC-NS =2.57±0.15μg mL -1 ), far exceeding that of A549 cells (IC). 50PDIC-NS =1.18±0.11μgmL -1 ) and LLC cells (IC 50PDIC-NS =0.87±0.17μg mL -1 This indicates that the compound PDIC-NS has high selectivity for lung cancer cells, while exhibiting relatively low cytotoxicity to normal lung cells.

[0052] IV. PDIC-NS is located in mitochondria within the cell.

[0053] Considering the abundance of phosphate anions in the mitochondrial double membrane structure, and the presence of positively charged tertiary ammonium groups in PDIC-NS, it is hypothesized that PDIC-NS can be specifically distributed on mitochondrial subcellular organelles through cation-anion electrostatic interactions. This application investigated the mitochondrial localization of PDIC-NS using a mitochondrial fluorescent probe. The procedure was as follows: LLC tumor cells were seeded in 20 mm confocal dishes and cultured at 37°C for 12 h. The culture medium was changed, and 2.5 μM PDIC-NS was added to the experimental group and incubated for 4 h. After washing three times with PBS, 500 μL of the mitochondrial green fluorescent probe working solution (Mito-tracker: serum-free medium = 1:1000) was added to each confocal dish and incubated at 37°C for 30 min. After washing three times with PBS, serum-free medium was added, and the compound localization was observed using a confocal laser microscope. The results are detailed below. Figure 5 .

[0054] like Figure 5 As shown, the red fluorescence of PDIC-NS almost completely overlaps with the green fluorescence of Mito-tracker, with a colocalization coefficient as high as R. LLC =0.85, which indicates that the compound PDIC-NS has excellent mitochondrial targeting ability, laying the foundation for PDIC-NS to target mitochondria that produce ROS and cause mitochondrial damage.

[0055] 5. PDIC-NS can generate reactive oxygen species.

[0056] The specific steps for detecting ROS using an inverted fluorescence microscope are as follows: LLC tumor cells were seeded in 6-well plates and cultured at 37°C for 12 hours. The culture medium was then changed, and PDIC-NS and OXA were added to the experimental group at a final concentration of 2.5 μM and incubated for 6 hours each. After washing once with PBS, the prepared DCFH-DA working solution (for detecting total ROS, DCFH-DA: serum-free medium = 1:1000) and DHE working solution (for detecting O2) were added. ·- DHE:PBS = 1:1000, H2O2 probe working solution (for detecting H2O2, H2O2:PBS = 1:1000), and HPF working solution (for detecting ·OH, HPF:PBS = 1:500) were added to the wells and incubated at 37°C in the dark for 30 min. The working solutions were discarded, and the samples were washed three times with PBS. The results were then observed under an inverted fluorescence microscope. For detailed results, please refer to [link to relevant documentation]. Figure 6 As clearly seen from the inverted fluorescence images, both compounds PDIC-NS and OXA generate ROS. Quantification of their fluorescence intensity revealed that the total ROS fluorescence intensity of PDIC-NS and OXA was 3.9 times and 2.3 times that of the PBS group, respectively. This indicates that PDIC-NS generates a higher level of ROS compared to the clinical chemotherapy drug OXA. Since perylene radical anions are unstable within tumor cells and easily oxidized or reduced, they may transfer electrons to O2, thus favoring O2. ·- O2 is generated. ·- The generation of these free radicals can trigger a cascade reaction, promoting the formation of cytotoxic free radicals such as ·OH and H2O2. Therefore, it is hypothesized that these free radicals may be generated. To verify this hypothesis, this application detected O2 after OXA and PDIC-NS acted on LLC cells. ·- The expression levels of H2O2 and ·OH were measured. Inverted fluorescence images and quantification results showed that PDIC-NS significantly increased the levels of these three free radicals compared to OXA.

[0057] VI. PDIC-NS damages mitochondria and the cell nucleus through the generation of reactive oxygen species, releasing mitochondrial DNA and nuclear DNA.

[0058] (1) PDIC-NS causes mitochondrial damage, leading to the release of mitochondrial DNA into the cytoplasm.

[0059] This application uses quantitative polymerase chain reaction (qPCR) to reveal the release of mtDNA into the cell membrane. The procedure is as follows: LLC cells were cultured overnight in cell culture dishes, then incubated at 37°C for 12 h. The culture medium was changed, and 2.5 μM PDIC-NS and OXA were added to the experimental groups for incubation for 12 h. LLC cells were washed with PBS and centrifuged. Mitochondrial DNA (mtDNA) was removed from the cytoplasm using a cell mitochondrial isolation kit (C3601), and then DNA was extracted using the TIANamp Genomic DNA Kit (DP304) according to the manufacturer's instructions. qPCR was performed using mtDNA D-Loop primers (D-loop F: CACCAATGCCCCTCTTCTCG, D-loop R: CCTTTCATGCCTTGACGGCT) and TransStart Top Green qPCR SuperMix. Cytoplasmic mtDNA was normalized to β-actin (β-actin F: GGAGATTACTGCCCTTGGCTCCTA, β-actin R: GACTCATCGTACTCCTGCTTGCTG), and the [2^(-ΔΔCT)] was calculated using the threshold variation method. See details for the results. Figure 7 .

[0060] Depend on Figure 7 qPCR analysis confirmed that, compared with the PBS group, PDIC-NS treatment increased cytoplasmic mtDNA by 2.2 times. Figure 7 This indicates that the large amount of reactive oxygen species generated after PDIC-NS acts on LLC cells leads to mitochondrial damage, causing mtDNA to be released into the cytoplasm.

[0061] (2) PDIC-NS causes damage to tumor cell nuclear DNA

[0062] 3 × 103 LLC tumor cells per dish 3 / 4×10 3Cells were seeded in confocal microscopy dishes and incubated at 37°C for 12 h. The culture medium was changed, and 2.5 μM PDIC-NS and OXA were added to the experimental groups for 8 h. The cells were then fixed with 4% paraformaldehyde for 10 min, washed three times with PBS, treated with 0.2% Triton-X-100 for 5 min, washed three times with PBS, and incubated with γ-H2AX primary antibody (γ-H2AX: 1% BSA = 1:300) at 4°C for 12 h. The cells were washed three times with PBS, and rabbit secondary antibody (rabbit secondary antibody: 1% BSA = 1:250) was added. The cells were incubated at room temperature for 2 h, washed three times with PBS, and the nuclei were stained with DAPI for 5 min. The cells were then washed three times with PBS and observed under a confocal laser scanning microscope.

[0063] (3) PDIC-NS promotes the leakage of damaged DNA from tumor cells into the cytoplasm.

[0064] 3 × 103 LLC tumor cells per dish 3 / 4×10 3 Inoculate into confocal dishes and incubate at 37°C for 12 h. Replace with fresh medium. Add 2.5 μM PDIC-NS and OXA to each experimental group and incubate for 8 h. Wash three times with PBS. Add 500 μL of Picogreen probe working solution (Picogreen:PBS = 1:100) to each well of a 6-well plate and incubate at 37°C for 20 min. Wash three times with PBS and observe under a confocal laser scanning microscope.

[0065] Figure 8 This indicates that nuclear DNA leaks into the cytoplasm after the cell nucleus breaks down (indicated by the red arrow).

[0066] 7. PDIC-NS can inhibit the activity of ENPP1 enzyme on the cell membrane, thereby reducing the degradation of ATP and cGAMP and increasing the accumulation of cGAMP.

[0067] The inhibitory activity of PDIC-NS was determined using sodium p-nitrophenyl ester of thymidine-5'-monophosphate (pNP-TMP) as a substrate. Different concentrations of PDIC-NS or OXA (2.5, 5, and 10 μM) were added to PBS (pH 6.5) as the reaction solvent, with PBS serving as a control. Recombinant human ENPP1 protein (40 ng) was added to the reaction mixture and pre-cultured at 37°C for 15 min. The reaction was initiated with 400 mM pNP-TMP, and after incubation for 35 min, NaOH solution was added. The amount of p-nitrophenol produced was measured at 405 nm. Results are detailed below. Figure 9 .

[0068] Depend on Figure 9It is known that double-stranded DNA in the cytoplasm is recognized by cGAS, thereby catalyzing the synthesis of cGAMP. The increase in cGAMP content indicates that within this concentration range, the inhibitory activity of PDIC-NS on ENPP1 increases with increasing concentration. This lays the foundation for reducing the degradation of cGAMP by ENPP1, increasing the enrichment of cGAMP, and better activating the STING pathway.

[0069] 8. PDIC-NS can activate the cGAS-STING pathway in tumor cells.

[0070] LLC cells in the proliferative phase were seeded into 6-well plates and cultured at 37°C for 12 h. The medium was then replaced with fresh medium. The experimental groups were incubated with 2.5 μM PDIC-NS and OXA for 6 h each. Cells were washed three times with PBS, added to RIPA lysis buffer in 6-well plates, scraped off, and lysed on ice for 30 min. The supernatant was collected by centrifugation (12000×g, 15 min). Protein quantification was performed using the BCA protein quantification method. Loading buffer was balanced, and protein samples were boiled in 100°C water for 15 min to complete protein sample preparation. Western blotting was used to analyze the expression of cGAS-STING pathway proteins in LLC tumor cells. Results are detailed below. Figure 10 .

[0071] Depend on Figure 10 It was found that, compared with the PBS group, the expression of phosphorylated interferon gene stimulating factor (p-STING) in the PDIC-NS treatment group was upregulated by 3.1-fold, phosphorylated interferon regulatory factor (p-IRF3) by 2.4-fold, and p-TBK1 by 1.9-fold. Their protein expression levels were stronger than those in the OXA group, indicating that PDIC-NS can effectively activate the cGAS-STING pathway. IX. PDIC-NS can accumulate in the lungs.

[0072] C57BL / 6 mice were injected with LLC cell suspension (100 μl, approximately 5 × 10⁶ cells) via the tail vein beforehand. 5 (cells), at the inoculation site, wait until the tumor grows to approximately 400 mm. 3 At different time points, mice were injected intravenously with the compound PDIC-NS (2 mg / kg) at specific times. -1 Afterwards, the heart, liver, spleen, lungs, and kidneys were harvested, and the tumor was placed in centrifuge tubes containing PBS. The fluid on the tissues was blotted dry with filter paper, and the tissues from each group were arranged sequentially on black cardboard. Images were taken using the Perkinelmer small animal in vivo optical imaging system. Results are detailed below. Figure 11 .

[0073] To investigate whether the compound PDIC-NS achieves lung-dominant enrichment, this application utilizes the excellent fluorescence properties of PDIC-NS and employs small animal tissue fluorescence imaging to track the distribution of PDIC-NS in major organs of mice, such as... Figure 11 The results showed that, compared with the PBS group (0h), mice injected with the tail vein showed a stronger fluorescence signal in the lungs at 2h, exhibiting a dominant enrichment in the lungs. Furthermore, the fluorescence signal was maintained until after 12h, indicating that the compound has a long blood circulation time in vivo and is relatively stable in vivo, thus laying a solid foundation for the effective treatment of lung tumors.

[0074] 10. PDIC-NS can activate the cGAS-STING pathway in wild-type metastatic tumor models, resulting in good immuno-chemotherapy effects, and this was further validated in STING gene knockout mice.

[0075] All animals and their housing conditions required for the experiment were strictly implemented in accordance with the protocol of the Animal Management and Ethics Committee of Henan University (Ethics No.: HUSOM-2021-001). The experimental animals were 5-week-old SPF-grade female C57BL / 6 mice purchased from Beijing Vital River Company. The animal housing used standardized equipment. The mice's feed and drinking water were sterilized using an autoclave, and the bedding was changed every two days, while the feed and drinking water were changed every five days. During the experiment, the experimental animals were in good condition.

[0076] Construction of LLC metastatic tumor model and experiment on its anti-lung metastasis effect: Proliferating LLC tumor cells were collected, washed with PBS, digested with trypsin, centrifuged, washed once with PBS, resuspended in PBS, and the tails of mice were disinfected with 75% alcohol swabs. 100 μL of cell suspension (approximately 4.5 × 10⁻⁶ cells) was injected into the tail vein of each mouse. 5 (Number of cells). Fourteen days after tail vein injection of LLC tumor cells, mice were randomly divided into three groups of five mice each: PBS group, Oxaliplatin (OXA) group, and PDIC-NS group. The experimental treatment groups received PBS, PDIC-NS, or OXA. Administration was once every two days for a total of five treatments. After PDIC-NS treatment, mice in each group were euthanized, and lung metastasis tissue was collected for lung weight and the number of metastatic nodules. Results are as follows: Figure 12 As shown, by Figure 12 As indicated by A in the text, the complete treatment regimen for the LLC lung metastasis model involved tail vein injection of LLC cells for 14 days, followed by randomization of the LLC metastasis mice into three groups. Each group received a tail vein injection of PBS, OXA, and PDIC-NS every two days at a dose of 2 mg / kg. -1Ten days after treatment, the mice were euthanized and their lung tissue was separated. Figure 12 As shown in B and C, these are gross lung specimens and magnified images of specific areas (white circles indicate lung metastatic nodules) from different treatment groups. The number of metastatic lung nodules on the lung surface was then counted in each group, and the lungs were weighed to assess treatment efficacy. Figure 12 As shown in Figures D and E, compared to PBS, it can be seen that in the anti-tumor experiment in wild-type mice, the number of metastases was significantly reduced after treatment with PDIC-NS and OXA, especially in the PDIC-NS group. Furthermore, based on the lung weight data of the mice, it was found that the lung weight of the PDIC-NS treatment group was smaller than that of the other two groups, indicating that the proliferation of lung metastases in the PDIC-NS treatment group was lower. However, in the anti-tumor experiment of STING knockout mice, the therapeutic effect of PDIC-NS was not as good as that of OXA, indicating that the SING signaling pathway is an important component of PDIC-NS immunotherapy.

[0077] The above description is only a partial embodiment of the present invention. For those skilled in the art, several improvements and substitutions can be made without departing from the principle of the present invention, and these improvements and substitutions should also be considered within the scope of protection of the present invention.

Claims

1. A perylene diimide derivative PDIC-NS for use in the preparation of a STING agonist in lung cancer cells, characterized in that, The structure of the perylene imide derivative PDIC-NS is as follows: wherein R = Cl.

2. Use according to claim 1, characterized in that, The synthesis route of PDIC-NS is as follows: wherein R = Cl, The synthesis process is as follows: (1) Compound 1, glacial acetic acid and N,N-dimethyl ethylenediamine are sequentially added into NMP, argon is introduced, and after the reaction is completed at 120±10 ℃, the reaction is transferred into a beaker and cooled to room temperature, anhydrous ethanol is added, a glass rod is fully stirred, and then left to stand, filtered, vacuum dried, and recrystallized multiple times to obtain PDIC-NN; (2) PDIC-NN is dissolved in acetone, and ultrapure water is added, argon is introduced, and then methyl sulfonic acid is added, the reaction is completed at 50-60 ℃, the mixture after the reaction is cooled to room temperature, the temperature is adjusted to 0-10 ℃, and incubated and stirred for 1-1.5 h, filtered, the filter cake is rinsed with acetone, and then dried to obtain PDIC-NS.

3. Use according to claim 2, characterized in that, In step (1), the molar ratio of compound 1 and N,N-dimethyl ethylenediamine is 1:10, 15 mL of glacial acetic acid and 10 mL of NMP are needed for each 1 mmol of compound 1; in step (2), the molar ratio of PDIC-NN and methyl sulfonic acid is 1:2.

5.

4. Use according to claim 1, characterized in that, The lung cancer cells are A549 and / or LLC cells.

Citation Information

Patent Citations

  • Application of PDINCl in preparing antitumor drugs

    CN110237076A

  • Perylene bisimide derivative and application thereof

    CN112521388A

  • Perylene bisimide derivative and application

    CN115181065A