Molecular marker method for rice panicle neck small vascular bundle number gene LOC_os07g49460 and application thereof
Through genome-wide association analysis and KASP molecular marker SNP27810, a functional molecular marker for the rice panicle neck small vascular bundle number gene LOC_Os07g49460 was developed, which solved the problem of insufficient genetic diversity in rice breeding, achieved efficient screening of excellent rice materials, and increased rice yield.
Patent Information
- Application Number
- CN202410328704.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-21
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-03-21
AI Technical Summary
In the existing technology, genes related to the rice panicle neck vascular bundle have not been used in molecular breeding, resulting in incomplete rice filling and low fruit set rate, which limits the realization of yield potential. In addition, the identification efficiency of parental genetic populations is low and genetic diversity is insufficient.
A functional molecular marker method for the rice panicle neck small vascular bundle number gene LOC_Os07g49460 was developed. Through genome-wide association analysis and KASP molecular marker SNP27810, the genomic DNA of breeding materials was detected to screen out rice materials with superior or inferior genotypes.
It has achieved efficient screening of rice materials with excellent panicle neck and small vascular bundle number, improved rice "flow" traits, increased rice yield potential, and shortened the breeding process.
Smart Images

Figure CN118109630B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of rice molecular breeding, more particularly, it relates to a functional molecular marker method of a rice panicle neck small vascular bundle number gene LOC_Os07g49460 and application thereof. BACKGROUND
[0002] Rice (Oryza sativa L.) is one of the most important food crops, and is the main food crop for more than half of the world's population. China is the world's largest producer and consumer of rice. Improving the yield and stability of rice is of great strategic significance to food security and social stability in China.
[0003] The formation of rice yield is the result of the joint action of source, sink and flow, and is indispensable. Only by balancing the relationship among source, sink and flow, and achieving "sufficient source", "large sink" and "smooth flow", can the yield potential be fully played, and the rice yield be greatly improved. The current super rice has the characteristics of "sufficient source" and "large sink", but there are still problems of incomplete filling and low seed setting rate, which are mainly due to the restriction of "flow" on the play of yield potential. Panicle neck vascular bundle, as a "flow" trait, controls the channel of nutrient substances to the grain, and is significantly or extremely significantly correlated with the traits of the panicle, which is the morphological and anatomical basis of high yield of rice. Cloning rice panicle neck vascular bundle related genes and applying them to breeding to cultivate "smooth flow" high yield rice varieties is of great significance to food security in China.
[0004] Molecular genetic studies have shown that rice panicle neck vascular bundle is a quantitative trait controlled by multiple genes. With the development of molecular marker technology, some panicle neck vascular bundle related quantitative trait loci (QTL) and genes have been identified using AFLP, RFLP, SSR and other marker technologies and genetic mapping populations, which has to some extent promoted the understanding of the genetic mechanism of rice "flow" traits. However, due to the use of parental genetic populations in previous studies to identify target trait QTL / gene, the genetic background is simple, and the gene diversity is low, resulting in low efficiency of beneficial gene mining. The phenotypes of different genotypes of rice are very different, and germplasm resources are natural population materials cultivated and preserved by people in long-term production practice, which carry a variety of beneficial variation genes and are a treasure trove for genetic improvement. With the development of biological technology, high-density SNP markers obtained by next-generation sequencing technology can effectively promote the efficient mining of target trait candidate genes through whole genome association analysis. A large number of studies have shown that whole genome association analysis is an effective method for mining quantitative trait loci significantly associated with target traits from germplasm resources, and has been widely used in genetic analysis of important agronomic traits.
[0005] At present, the genes related to the panicle neck vascular bundle of rice are still in the basic research stage, and are not applied to molecular breeding. It is an important work content to cultivate high-yield varieties to mine more panicle neck vascular bundle genes and develop molecular markers and apply them to molecular marker-assisted selection breeding. SUMMARY
[0006] The purpose of the present application is to solve the above problems, and provide a functional molecular marker method of the panicle neck small vascular bundle number gene LOC_Os07g49460 of rice and its application.
[0007] The above technical purpose of the present application is realized by the following technical scheme: a functional molecular marker method of the panicle neck small vascular bundle number gene LOC_Os07g49460 of rice, the functional molecular marker is named SNP27810, the marker is located at the physical position of the 7th chromosome of rice 29627810 (rs7_29627810), and the specific nucleotide sequence is:
[0008] AGATCGCTAATGGCACCATCAACAAAAGTG[A / G]ACCTGGAGGTGGCAATGGAAGTGGAAGCGG,
[0009] Wherein the physical position of rs7_29627810 has A / G polymorphism; specifically:
[0010] When the site is AA, it is an excellent genotype of the number of panicle neck small vascular bundles, the nucleotide sequence is named SEQ ID NO. 1, and SEQ ID NO. 1 is specifically:
[0011] AGATCGCTAATGGCACCATCAACAAAAGTGAACCTGGAGGTGGCAATGGAAGTGGAAGCGG;
[0012] When the site is GG, it is a poor genotype of the number of panicle neck small vascular bundles, the nucleotide sequence is named SEQ ID NO. 2, and SEQ ID NO. 2 is specifically:
[0013] AGATCGCTAATGGCACCATCAACAAAAGTGGACCTGGAGGTGGCAATGGAAGTGGAAGCGG.
[0014] The present application further provides that the primer sequences of the marker SNP27810 are named SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5 respectively; specifically:
[0015] SEQ ID No. 3:
[0016] GAAGGTGACCAAGTTCATGCTCTAATGGCACCATCAACAAAAGTGA
[0017] SEQ ID No. 4:
[0018] GAAGGTCGGAGTCAACGGATTCTAATGGCACCATCAACAAAAGTGG
[0019] SEQ ID No. 5: CACTGCCGCTTCCACTTCCATTG
[0020] The application further discloses a method for detecting whether rice contains the panicle neck small vascular bundle number gene LOC_Os07g49460.
[0021] If the base of the rs7_29627810 physical position is AA, the breeding material carries the panicle neck small vascular bundle number gene LOC_Os07g49460, and the nucleotide sequence is shown in SEQ ID NO. 1.
[0022] If the base of the rs7_29627810 physical position is GG, the breeding material does not carry the panicle neck small vascular bundle number gene LOC_Os07g49460, and the nucleotide sequence is shown in SEQ ID NO. 2.
[0023] The application further discloses an application of a functional molecular marker method of the rice panicle neck small vascular bundle number gene LOC_Os07g49460 in rice molecular marker assisted selection breeding.
[0024] The application further discloses an application of a method for detecting the rice panicle neck small vascular bundle number gene LOC_Os07g49460 in rice molecular marker assisted selection breeding.
[0025] The present application takes 423 materials from 3K germplasm resources as test materials, and detects a major QTL (qSVN7) for controlling the number of small vascular bundles of panicle neck joint in the physical range of Chr7:29436-29672Kb (236Kb) of chromosome 7 by using whole genome association analysis, and predicts LOC_Os07g49460 as the most possible candidate gene of the QTL through significant SNP site analysis, gene haplotype analysis, gene differential expression analysis and function annotation, and preliminarily verifies the function of the gene on the number of small vascular bundles of panicle neck joint by constructing overexpression and CRISPR / Cas9 transgenic lines. The variation site rs7_29627810 significantly associated with the phenotype on the candidate gene is identified by association analysis, and the KASP molecular marker SNP27810 is developed based on the site, so as to provide effective molecular markers for further molecular marker assisted selection breeding.
[0026] In summary, the present application has the following beneficial effects:
[0027] 1. The gene LOC_Os07g49460 is a new gene detected by phenotypic and SNP association analysis of the number of small vascular bundles of panicle neck joint by using more than 400 germplasm resources from different countries around the world with wide genetic differences. The gene can regulate the number of small vascular bundles of panicle neck joint to improve the "flow" trait of rice.
[0028] 2. The determination of the variation site of the new gene LOC_Os07g49460 significantly associated with the phenotype and the development of the KASP marker provide effective information for rice molecular marker assisted selection, and the rice material with more "flow" of the number of small vascular bundles of panicle neck joint can be obtained. The molecular marker of the present application can be used for screening the number of small vascular bundles of panicle neck joint of the rice breeding population, effectively identifying individuals with the gene, and accelerating the breeding process. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 is the distribution of the number of small vascular bundles of panicle neck joint in the embodiment of the present application;
[0030] Figure 2 is the whole genome association analysis for locating the QTL of the number of small vascular bundles of panicle neck joint in the embodiment of the present application;
[0031] Figure 3 is the distribution of the SNP site in the LD interval of 236Kb in the embodiment of the present application;
[0032] Figure 4 is the candidate gene screening of the qSVN7 interval in the embodiment of the present application;
[0033] Figure 5 is the effect of the knock-out transgenic line on the number of small vascular bundles of panicle neck joint (comparison of strain growth) in the embodiment of the present application;
[0034] Figure 6 is the effect of the knock-out transgenic line on the number of spike neck small vascular bundles in the embodiment of the present application (direct comparison of the number of small vascular bundles of the line);
[0035] Figure 7 is the effect of the knock-out transgenic line on the number of spike neck small vascular bundles in the embodiment of the present application (statistical comparison of the number of small vascular bundles of the line);
[0036] Figure 8 is the variation site associated with the phenotype of LOC_Os07g49460 in the embodiment of the present application (comparison of the difference SNP site);
[0037] Figure 9 is the variation site associated with the phenotype of LOC_Os07g49460 in the embodiment of the present application (correlation analysis of the difference SNP and the phenotype);
[0038] Figure 10 is the typing result of the F2 separation population in the embodiment of the present application. DETAILED DESCRIPTION
[0039] In order for those skilled in the art to better understand the present application, the technical solutions of the present application will be further described in detail below in combination with the embodiments of the present application and the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor should be within the scope of protection of the present application.
[0040] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below in combination with the embodiments.
[0041] Embodiment:
[0042] The rice spike neck small vascular bundle number gene LOC_Os07g49460 is located at the physical position of 29616705-29629223 on the 7th chromosome of rice, and the gene can improve the "flow" trait by regulating the number of spike neck small vascular bundles.
[0043] The molecular marker method of the rice spike neck small vascular bundle number gene LOC_Os07g49460: the variation site associated with the phenotype of the gene is located at the physical position of rs7_29627810, and the KASP molecular marker SNP27810 is developed according to the polymorphic SNP site (A / G).
[0044] When the site is AA, it is an excellent genotype of the number of spike neck small vascular bundles, the nucleotide sequence is named SEQ ID NO. 1, and SEQ ID NO. 1 is specifically as follows:
[0045] AGATCGCTAATGGCACCATCAACAAAAGTGAACCTGGAGGTGGCAATGGAAGTGGAAGCGG;
[0046] When the site is GG, it is a poor genotype of the number of spike neck small vascular bundles, and the nucleotide sequence is named SEQ ID NO. 2, and SEQ ID NO. 2 is specifically as follows:
[0047] AGATCGCTAATGGCACCATCAACAAAAGTGGACCTGGAGGTGGCAATGGAAGTGGAAGCGG;
[0048] Method for detecting whether rice contains the number of spike neck small vascular bundles gene LOC_Os07g49460 of rice: the variation site significantly associated with the phenotype of the gene is located at the physical position of rs7_29627810, and a KASP molecular marker SNP27810 is developed according to the polymorphic SNP site (A / G).
[0049] When the site is AA, the breeding material carries the number of spike neck small vascular bundles gene LOC_Os07g49460, and the nucleotide sequence is as shown in SEQ ID NO. 1;
[0050] When the site is GG, the breeding material does not carry the number of spike neck small vascular bundles gene LOC_Os07g49460, and the nucleotide sequence is as shown in SEQ ID NO. 2.
[0051] I. Mining and verification of a new gene of the number of spike neck small vascular bundles of rice
[0052] 1. Test materials
[0053] The materials used in the test are 423 germplasm resources from different countries with similar heading dates, which are screened from the resequencing 3K germplasm resources, taking into account the genetic diversity of the germplasm resources, including 301 indica rice, 79 japonica rice, 17 intermediate type, 10 Basmati and 16 Aus.
[0054] 2. Phenotypic identification of the number of spike neck small vascular bundles of the experimental materials
[0055] In this experiment, 423 rice materials were phenotyped for the number of spikelet-scale vascular bundles. The specific operation method: 423 rice materials were planted in the rice field normally, and the phenotype was investigated at the heading stage. The main stems of 5 plants with consistent growth vigor were taken from each material, and the upper 2 cm of the panicle neck node was cut by hand and then stored in the FAA fixing solution (acetic acid (5%) + formaldehyde (5%) + 70% ethanol (90%)) prepared in advance. Vacuum was applied to ensure that the fixing solution quickly entered the tissue interior to maximize the preservation of the original tissue. ZEISS microscope made in Germany was used for observation and measurement of the number of spikelet-scale vascular bundles. Excel 2019 and R language statistical analysis software were used for statistical analysis of the measured phenotypes. The phenotype data distribution is shown in Figure 1 .
[0056] 3. Whole genome association analysis to mine candidate genes
[0057] The 4.8 Mb genotype data of 423 test materials were retrieved from the RiceSNP-Seek Database (http: / / snp-seek.irri.org / ) constructed by the 3K rice resequencing project, and PLINK1.9 was used for quality control of the selected genotypes (MAF>5%, GENO<20%). Finally, 3,188,500 high-quality SNPs were retained for subsequent whole genome association analysis.
[0058] Principal component analysis (PCA) and kinship matrix analysis (Kinship) were performed using PLINK1.9. Using a mixed linear model, the principal component analysis (PCA) and the kinship matrix (Kinship) were used as covariates, and the 4.8 Mb high-density SNP markers were subjected to whole genome association analysis (GWAS) with the phenotype value of the number of spikelet-scale vascular bundles of 423 rice germplasm resources. A total of 95 SNP sites significantly associated with the phenotype were detected on chromosome 7 (see Figure 2 ), which all fell within a 236 Kb LD interval (see Figure 3 ). No gene related to the number of spikelet-scale vascular bundles has been cloned in this interval. This major QTL for the number of spikelet-scale vascular bundles is named qSVN7.
[0059] Further analysis of the 95 significantly associated SNP sites showed that 38 SNPs fell between genes, and the remaining 57 SNPs fell on 23 genes. The number of SNPs falling in the promoter region, intron, exon missense mutation, exon synonymous mutation, and 3'-UTR of the genes was 14, 19, 11, 10, and 3, respectively (see Table 1). It was preliminarily speculated that the 7 genes containing the 11 missense mutation SNPs were candidate genes.
[0060] Table 1 Analysis of significantly associated SNP sites in the qSVN7 interval
[0061]
[0062]
[0063] 4. Screening candidate genes in the QTL qSVN7 interval
[0064] Haplotype analysis of the 7 candidate genes showed that only 3 genes (LOC_Os07g49220, LOC_Os07g49460, LOC_Os07g49530) had significant differences between different haplotypes. Through gene expression analysis and gene annotation analysis, it was speculated that LOC_Os07g49460 was the most likely candidate gene in qSVN7 (see Figure 4 ).
[0065] 5. Transgenic verification of gene function
[0066] To further verify the function of the gene, japonica G707 carrying the dominant haplotype Hap3 was selected as the receptor material to construct 2 homozygous knockout transgenic lines (see Figure 5 ). Phenotypic identification results showed that the number of small vascular bundles of the knockout lines was significantly reduced compared with the wild type ( Figure 6 ; Figure 7 ). This indicates that the gene can regulate the number of small vascular bundles of the spike neck.
[0067] 6. Development of functional molecular markers
[0068] Among the 5 haplotypes of LOC_Os07g49460, the phenotypic value of Hap3 was significantly higher than that of the other 4 haplotypes. Analysis of the variation sites found that the two SNP sites "rs7_29617476" and "rs7_29627810" on the gene were inconsistent with the other 4 haplotypes (see Figure 8 ), and these two SNP sites were significantly associated with the phenotype (see Figure 9 ). LD BLOCK analysis of the 11 missense mutation SNPs used for haplotype analysis showed that the two significant missense mutation SNPs were highly linked (see Figure 9 ), and were not linked to other sites, indicating that these two sites were the variation sites of LOC_Os07g49460 that were significantly associated with the phenotype. There is 1 SNP polymorphism on the variation site rs7_29627810, which changes from G to A to increase the number of small vascular bundles of the spike neck. According to this site, KASP molecular marker SNP27810 was developed, and the primer sequences were named SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5, respectively; specifically:
[0069] SEQ ID No. 3:
[0070] GAAGGTGACCAAGTTCATGCTCTAATGGCACCATCAACAAAAGTGA
[0071] SEQ ID No. 4:
[0072] GAAGGTCGGAGTCAACGGATTCTAATGGCACCATCAACAAAAGTGG
[0073] SEQ ID No. 5: CACTGCCGCTTCCACTTCCATTG
[0074] Effective molecular markers can be further provided for molecular marker-assisted selection breeding. The panicle neck microvascular bundle number gene LOC_Os07g49460 and its functional molecular marker SNP27810 are expected to be applied to rice marker-assisted selection breeding.
[0075] II. Marker verification analysis of the panicle neck microvascular bundle number gene LOC_Os07g49460 in the F2 separation population
[0076] 1. Field planting of test materials
[0077] A F2 separation population was constructed by using the panicle neck microvascular bundle number less variety C1040 carrying the disadvantageous haplotype of the LOC_Os07g49460 gene and the panicle neck microvascular bundle number more variety G707 carrying the advantageous haplotype of the LOC_Os07g49460 gene. The population of 192 plants was normally planted in a paddy field, and the panicle neck microvascular bundle number was investigated after heading.
[0078] 2. DNA extraction and genotyping
[0079] Genomic DNA was extracted from each single plant by using the CTAB method. The single plants of the population were genotyped by using the KASP molecular marker SNP27810, and based on the marker information, a total of three types were obtained, namely AA, GG and AG (see Table 1). Figure 10
[0080] 3. Marker-assisted selection effect analysis and t-test analysis
[0081] According to the genotyping results of SNP27810 molecular marker of the single progeny, the corresponding conditions of the ear neck small vascular bundle number phenotype and genotype of the F2 population are shown in Table 2. The ear neck small vascular bundle number of the individual with the homozygous genotype of the dominant parent G707 (P1) is more, the ear neck small vascular bundle number of the individual with the homozygous genotype of the inferior parent C1040 (P2) is generally less, and the ear neck small vascular bundle number of the individual with the heterozygous genotype is in the middle, which indicates that SNP27810 has a relatively ideal auxiliary selection effect on the ear neck small vascular bundle number gene LOC_Os07g49460. The individuals in the F2 population are divided into two groups, one group is the individuals with the AA homozygous genotype of SNP27810 site (referred to as the dominant group), a total of 44 individuals; the other group is the individuals with the GG homozygous genotype of SNP27810 site (referred to as the inferior group), a total of 45 individuals. The average ear neck small vascular bundle number of the two groups of individuals is analyzed by ANOVA (see Table 3), and the results show that the ear neck small vascular bundle number of the two groups of individuals reaches a very significant difference level, indicating that SNP27810 marker is an effective functional molecular marker for identifying the main effect gene LOC_Os07g49460 of ear neck small vascular bundle number.
[0082] Table 2: Corresponding conditions of SNP27810 marker site genotype and phenotype of F2 population
[0083]
[0084]
[0085] Table 3: Ear neck small vascular bundle number of AA and GG homozygous genotype individuals of SNP27810 marker site in F2 population
[0086]
[0087] The specific embodiments are only an explanation of the present application, and are not a limitation of the present application. Those skilled in the art can make modifications to the embodiments without creative contribution after reading the specification, and the modifications are protected by the patent law as long as they are within the scope of the claims of the present application.
Claims
1. Use of a reagent for detecting the functional molecular marker of the rice panicle neck small vascular bundle number gene LOC_Os07g49460 in rice molecular marker-assisted selection breeding, characterized by: The functional molecular marker is named SNP27810, the marker is located at the physical position rs7_29627810 of the 7th chromosome of rice, and the specific nucleotide sequence is: AGATCGCTAATGGCACCATCAACAAAAGTGAACCTGGAGGTGGCAATGGAAGTGGAAGCGG, wherein the physical position of rs7_29627810 has A / G polymorphism; specifically: When the site is AA, it is an excellent genotype of the number of spike neck phloem bundles, and the nucleotide sequence is named SEQ ID NO. 1, and SEQ ID NO. 1 is specifically: AGATCGCTAATGGCACCATCAACAAAAGTGAACCTGGAGGTGGCAATGGAAGTGGAAGCGG; When the site is GG, it is a poor genotype of the number of spike neck phloem bundles, and the nucleotide sequence is named SEQ ID NO. 2, and SEQ ID NO. 2 is specifically: AGATCGCTAATGGCACCATCAACAAAAGTGGACCTGGAGGTGGCAATGGAAGTGGAAGCGG; The KASP technology is used to detect the functional molecular marker SNP27810, and the primer sequences are named SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5; specifically: SEQ ID No. 3: GAAGGTGACCAAGTTCATGCTCTAATGGCACCATCAACAAAAGTGA SEQ ID No. 4: GAAGGTCGGAGTCAACGGATTCTAATGGCACCATCAACAAAAGTGG SEQ ID No. 5: CACTGCCGCTTCCACTTCCATTG.
2. A method for detecting the panicle neck tiny vascular bundle number gene LOC_Os07g49460, characterized in that: The KASP technology is used to detect the functional molecular marker SNP27810, and the marker SNP27810 is used to detect the genomic DNA of rice breeding materials, and the marker is located at the physical position rs7_29627810 of the 7th chromosome of rice; wherein the physical position of rs7_29627810 has A / G polymorphism, and the specific nucleotide sequence is: SEQ ID NO. 1: AGATCGCTAATGGCACCATCAACAAAAGTGAACCTGGAGGTGGCAATGGAAGTGGAAGCGG; SEQ ID NO. 2: AGATCGCTAATGGCACCATCAACAAAAGTGGACCTGGAGGTGGCAATGGAAGTGGAAGCGG; The specific primer sequence is: SEQ ID No. 3: GAAGGTGACCAAGTTCATGCTCTAATGGCACCATCAACAAAAGTGA SEQ ID No. 4: GAGGAGAAGAAAGTTCACCGGAAACCGAAAAGAAAGAAACCGAAAGA AGAAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAAC CGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAG AAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAA CGGAAACCGAAAAGAAAGAAACCGAAAGAAGAAGAAGAAACCGAAAA GAAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAAC CGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAG AAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAA CGGAAACCGAAAAGAAAGAAACCGAAAGAAGAAGAAGAAACCGAAAA GAAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAAC CGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAG AAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAA CGGAAACCGAAAAGAAAGAAACCGAAAGAAGAAGAAGAAACCGAAAA GAAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAAC CGAAAGAAGAAGAAGAAACCGAAAGAAGAAGAAGAAACCGAAAGAAG AAGAAGAAACCGAAAGAAGAAGAAGAAACCGAA
Citation Information
Patent Citations
Paddy rice yield genotyping primer set based on KASP technology and use thereof
CN106939349A
Molecular marker method for identifying rice heading date gene qHD7.4
CN107022634A