A method for constructing a zebrafish strain of maternal mutant and application thereof

Abstract

The application belongs to the technical field of genetic breeding, and particularly relates to a construction method of a zebrafish strain for producing a maternal mutant and application thereof. rbm24a 3rd intron In the strain, the zpc promoter is connected with the cas9 and is knocked into the third intron of rbm24a, so that the Cas9 protein is efficiently and stably expressed in the oocyte, but the function of the rbm24a gene is not affected. The gene knock-in site can be used as a genome safe harbor site to realize maternal overexpression of the gene, and the zpc:cas9KI rbm24a 3rd intron strain constructed by the method can be used for stable and efficient oocyte conditional gene knockout, and maternal gene large-scale function screening is realized, and therefore the method has good practical application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic breeding technology, and particularly relates to a method for constructing a zebrafish strain for producing maternal mutant and application thereof. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing the understanding of the general background of the application and does not necessarily constitute an admission or a recognition that the information forms part of the prior art that is already known in any country in the world.

[0003] The development of early embryonic development of vertebrates depends on the RNA and protein stored in the egg, i.e. maternal factors. Since most maternal products are produced in the diplotene stage of the first meiosis, in order to study the function of these maternal products of genes, homozygous mutant female individuals are needed, and the maternal products in the oocytes and embryos produced by the female individuals can be eliminated. If the gene is homozygous mutant lethal, it is almost impossible to obtain homozygous mutant female individuals, which brings great difficulty to the study of the maternal product function of these homozygous mutant lethal genes. In order to bypass this technical obstacle, people have developed techniques such as germ cell replacement surgery 1 mosaic 2 and in ovo injection of oocytes 3 , but these techniques often have long experimental periods, high technical difficulties or high experimental costs.

[0004] In order to break through the technical bottleneck of the research on the function of maternal factors, we optimized the strategy for conditional knockout by using the CRISPR / Cas9 system, established a technology for rapid conditional knockout in oocytes, and can realize the acquisition of maternal mutants in one generation. The system mainly includes two components, one is Tg(zpc:zcas9) transgenic zebrafish, which specifically expresses Cas9 protein in oocytes; the other is a transgenic plasmid system with 3-4 sgRNA expression frames, which can be introduced into the genome by means of I-Sce I transgenic system to realize stable expression. We successfully obtained maternal mutants with conditional knockout in oocytes by means of this system 4,5 . However, the gene editing efficiency of the previously reported Tg(zpc:zcas9) transgenic strain showed a downward trend with the passage, resulting in extremely low editing efficiency of the existing Tg(zpc:zcas9) transgenic strain. At the same time, the transgenic strain is established by using the Tol2 transposon system, in order not to interfere with the state of zpc:zcas9 on the genome, it is necessary to use I-Sce I mediated transgenic introduction of sgRNA expression sequence, which has lower efficiency than Tol2, and is prone to transgenerational silencing. Therefore, the editing efficiency of the previous technical solution is unstable, and it cannot be compatible with the introduction mode of high-efficiency sgRNA expression vector, which brings great trouble to the actual application.

[0005] References:

[0006] 1. B. Ciruna et al., Production of maternal-zygotic mutant zebrafish by germ-line replacement. Proc Natl Acad Sci U S A 99, 14919-14924 (2002).

[0007] 2. Y. Y. Xing et al., Mutational analysis of dishevelled genes in zebrafish reveals distinct functions in embryonic patterning and gastrulation cell movements. PLoS Genet 14, e1007551 (2018).

[0008] 3. X. Wu, W. Shen, B. Zhang, A. Meng, The genetic program of oocytes can be modified in vivo in the zebrafish ovary. J Mol Cell Biol 10, 479-493 (2018).

[0009] 4. C. Zhang et al., Rapid generation of maternal mutants via oocyte transgenic expression of CRISPR / Cas9 and sgRNAs in zebrafish. Sci Adv 7, eabb1237 (2021).

[0010] 5. C. Zhang et al., A Time-Saving Strategy to Generate Double Maternal Mutants by an Oocyte-Specific Conditional Knockout System in Zebrafish. Biology 10, 777 (2021). SUMMARY

[0011] To solve the problems in the prior art, the application provides a construction method of a zebrafish strain for generating maternal mutants and application thereof. Specifically, the application successfully constructs a zpc:cas9 gene knock-in strain in the last intron (i.e., the third intron) of rbm24a, and the gene knock-in cas9 is stably expressed and has a high gene editing efficiency. The homozygous gene knock-in fish is not affected in survival and reproduction, and thus the knock-in site of the last intron of rbm24a can actually be used as a safe harbor site for maternal gene expression. The sgRNA expression plasmid is more efficiently transgenated into zebrafish through a Tol2 transposon system. The strain containing the zpc:cas9 knock-in and sgRNA expression vector transgene can be continuously passed on, and a certain proportion of maternal mutant embryos are generated in each generation, achieving the effect of once construction and continuous generation of maternal mutants. The zpc:cas9 KI rbm24a 3rd intron The zebrafish strain verified can efficiently generate maternal mutants, and shows the potential of the strain in large-scale functional screening of maternal genes. Based on the above research results, the application is completed.

[0012] To achieve the above technical purposes, the application adopts the technical solutions as follows.

[0013] In a first aspect of the application, a construction method of a zebrafish strain for generating maternal mutants is provided, and the construction method comprises the following steps: selecting a gene knock-in site in the third intron of the rbm24a gene, and obtaining a zebrafish strain in which Cas9 is efficiently and specifically expressed in oocytes through gene knock-in.

[0014] In a second aspect of the application, the application of the above construction method and / or the zebrafish strain obtained by the above construction method in large-scale functional screening and / or research of maternal genes is provided.

[0015] The above one or more technical solutions have the following beneficial technical effects:

[0016] The above technical solutions successfully construct a zebrafish strain zpc:cas9 KI rbm24a 3rd intron In the strain, the zpc promoter is connected with cas9 and then knocked into the third intron of rbm24a, so that the Cas9 protein is efficiently and stably expressed in oocytes, but does not affect the function of the rbm24a gene. The gene knock-in site can be used as a genome safe harbor site to realize maternal overexpression of a gene, and the zpc:cas9 KI rbm24a 3rd intronIt can be used for stable and efficient oocyte conditional gene knockout, realizing large-scale functional screening of maternal genes, and thus has good practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0017] The accompanying drawings, which form a part of this specification, are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification. The embodiments of these drawings are set to explain the application, and do not constitute an improper limitation to the application.

[0018] Figure 1 The three efficient sgRNA target points in the third intron of rbm24a in the embodiment of the application.

[0019] Figure 2 The zpc:cas9 KI in the embodiment of the application rbm24a 3rd intron Construction process and gene editing effect detection; gene knock-in site and zpc:cas9 KI rbm24a 3rd intron Construction of the strain.b.zpc:cas9 KI rbm24a 3rd intron Zebrafish embryos of the strain show tissue-specific Rbm24a-RFP expression.c and d. sgRNAs injected into zpc:cas9 KI rbm24a 3rd intron Injection of sgRNAs of bmp2b into the embryos can induce the appearance of the dorsaiization phenotype.e.zpc:cas9 KI rbm24a 3rd intron There is no decrease in editing efficiency after three generations of continuous transmission.

[0020] Figure 3 The zpc:cas9 KI of the application has higher gene editing efficiency compared with the previous Tg(zpc:zcas9) strain. rbm24a 3rd intron The strain has higher gene editing efficiency; after injection of equal amounts of bmp2b sgRNAs, the zpc:cas9 KI rbm24a 3rd intron The embryos show more severe dorsaiization defects.b. Statistics of the proportion of dorsaiization defects.c. Gene editing efficiency statistics, showing significant differences.d. Sequencing peak chart shows in the zpc:cas9 KI rbm24a 3rd intron The strain has higher editing efficiency.

[0021] Figure 4For the zpc:cas9 KI rbm24a 3rd intron Generation of maternal mutant of nanog gene using Tol2 transgenic system. a. Phenotype of Mnanog; b. Proportion of Mnanog in GFP signal positive embryos. DETAILED DESCRIPTION

[0022] It should be noted that the following detailed description is illustrative only, and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0023] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof. It will be understood that the scope of the present application is not limited to the specific specific embodiments described below; it is also understood that the terms used in the present application are intended to describe particular embodiments and not to limit the scope of the present application.

[0024] In one exemplary embodiment of the present application, a method for constructing a zebrafish strain for generating maternal mutants is provided, which comprises: selecting a gene knock-in site in the third intron of the rbm24a gene, and obtaining a zebrafish strain that efficiently and specifically expresses Cas9 in oocytes by gene knock-in.

[0025] Specifically, the method comprises:

[0026] S1, selecting a partial sequence position of the third intron of the rbm24a gene as a gene knock-in site;

[0027] S2, constructing a gene knock-in vector plasmid, wherein the gene knock-in vector plasmid at least comprises the gene knock-in site sequence of step S1, a sequence of the fourth exon of the rbm24a gene fused with a reporter gene, and a sequence for driving expression of the Cas9 protein by zpc;

[0028] S3, transferring the above gene knock-in vector plasmid, sgRNA and Cas9 protein into zebrafish embryos, and obtaining embryos with early knock-in events based on the reporter gene screening, and obtaining the homozygous zpc:cas9 KI strain after mating. rbm24a 3rd intron Gene knock-in strain.

[0029] In the step S1, the gene knock-in site is an sgRNA target point, and the sequence of the sgRNA target point is preferably 5'-GGCTGCTGTCATGTTGGGT-3'(SEQ ID NO. 1); the target point has high mutation efficiency and does not contain repetitive sequences around the target point.

[0030] In the step S2, the reporter gene can be a fluorescent protein gene, and in a specific embodiment of the present application, the fluorescent protein gene is a red fluorescent protein gene.

[0031] In the step S3, the sgRNA sequence is shown in SEQ ID NO. 2;

[0032] The sequence of the vector plasmid is shown in SEQ ID NO. 6.

[0033] In another specific embodiment of the present application, the application provides the use of the above-mentioned construction method and / or the zebrafish strain obtained by the above-mentioned construction method in the large-scale functional screening and / or research of maternal genes.

[0034] The maternal gene can be a bmp2b gene or a nanog gene, which is not specifically limited herein.

[0035] The present application is further explained and described by the following examples, which do not constitute a limitation of the present application. It should be understood that the examples are only used to illustrate the present application and do not limit the scope of the present application. In the following examples, the materials, reagents, vectors, strains, etc. are obtained from commercial channels unless otherwise specified.

[0036] Example

[0037] We first need to find an efficient sgRNA target point in the last intron of the rbm24a gene. The sequence of the last intron of the rbm24a gene is input into CRISPRscan for sgRNA design and scoring, and is named sgRNA-65, sgRNA-66, sgRNA-79 according to the scores. We found two efficient sgRNA target points sgRNA-65 and sgRNA-79 by analyzing the efficiency of sgRNA. Figure 1 Considering the high mutation efficiency of the sgRNA-65 target point and the fact that the target point does not contain repetitive sequences around the target point, we finally selected this target point as the gene knock-in site.

[0038] Then we construct a gene knock-in vector plasmid (SEQ ID NO. 6) containing the sgRNA-65 target point of rbm24a, the fourth exon sequence of rbm24a fused with RFP, and the sequence for expressing cas9 protein driven by zpc Figure 2a). The RNase-free plasmid, sgRNA-65 and Cas9 protein were mixed and injected into the blastoderm of zebrafish 1-cell stage embryos, 20 pg knock-in plasmid, 200 pg sgRNA and 600 ng Cas9 were injected into each embryo. We injected 500 embryos, and picked out the red fluorescent embryos under stereomicroscope at 30 hpf. The embryos with red fluorescence widely distributed in the lens, hair cells, cardiac muscle and skeletal muscle were early knock-in events Figure 2 b). The early knock-in embryos were raised and mated to obtain homozygous zpc:cas9 KI rbm24a 3rd intron Gene knock-in line, which can grow and reproduce normally. Bmp2b is a key ligand of BMP signaling pathway, which controls the formation of abdominal structure, and bmp2b mutation will cause severe dorsalization phenotype in zebrafish embryos. The homozygous zpc:cas9 KI rbm24a3rd intron Gene knock-in line was self-crossed and injected with sgRNA of bmp2b into the just fertilized eggs, and it was found that almost all the embryos showed the phenotype of elongated body axis, i.e. the dorsalization phenotype of the embryo, while the embryos without gene knock-in showed normal round shape at 10 hpf Figure 2 c and d). This shows that the zpc:cas9 gene knock-in line we obtained by targeting the rbm24a sgRNA-65 site can express Cas9 normally and still has a very high editing efficiency as it is passed on Figure 2 e).

[0039] We also injected bmp2b sgRNA into rbm24a-RFP KI zpc:cas9 Gene knock-in line and our previous Tg(zpc:cas9) transgenic line in our laboratory, and compared the editing efficiency of the two. As Figure 3 shown, from the results, we can see that the existing Tg(zpc:cas9) gene editing efficiency almost drops to 0 as it is passed on, while the editing efficiency of zpc:cas9 gene knock-in line is higher and more stable.

[0040] To validate the feasibility of the technology, we chose nanog as the target gene. Nanog is a transcription factor essential for regulating zebrafish embryonic patterning and cell movement during gastrulation. In zebrafish, nanog heterozygous mutants have no obvious phenotype, but its maternal mutants show obvious delayed enveloping. Therefore, nanog is a target gene that can be used to validate the oocyte-specific conditional knockout technology. Using the CRISPRscan website, we predicted the sgRNA target sequence of nanog, and then we verified and selected the sgRNA sequence with high score, screened three high-efficiency sgRNAs, and then constructed the maternal knockout plasmid according to the method described in this paper, and made transgenic fish and screened the transgenic fish F0 that can produce fluorescent embryos. We screened 10 zpc:cas9 KI rbm24a 3rd intron From the F0 generation of the background, we screened 3 female fish that can produce GFP-expressing embryos. By observation and statistics, we found that among the F1 embryos expressing GFP, an average of 37% of the embryos showed the typical phenotype of nanog maternal mutant (Mnanog) delayed enveloping ( Figure 4 ).

[0041] Nucleotide sequence information used in the examples

[0042] 1. sgRNA sequence for gene knock-in in the third intron of rbm24a gene: taatacgactcactataGGGCTGCTGTCATGTTGGGTtttagagctagaa (SEQ ID NO. 1)

[0043] 2. bmp2b gene knockout sgRNA sequence: taatacgactcactataGGGAGGCTGAGAGCAACCGGgttttagagctagaa (SEQ ID NO. 2)

[0044] 3. nanog gene knockout sgRNA sequence:

[0045] nanog_Target_1

[0046] TAATACGACTCACTATAGGAGCCCGCTGTGACCCCGCGTTTTAGAGCTAGAA (SEQ ID NO. 3)

[0047] nanog_Target_2

[0048] TAATACGACTCACTATAGGGTCCCGGGTACTGGCTGTGTTTTAGAGCTAGAA (SEQ ID NO. 4)

[0049] nanog_Target_3

[0050] TAATACGACTCACTATAGGCAGGGTCGGAGGCCGGACGTTTTAGAGCTAGAA (SEQ ID NO. 5)

[0051] 4. zpc:cas9 KI rbm24a 3rd intron Gene knock-in plasmid sequence information:

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062] wherein the orange underlined region is the rbm24a intron sequence, which contains the sgRNA target region (ACCCAACATGACAGCAGCC), the blue region is the last exon sequence of rbm24a, the red region is the RFP sequence, the green region is the 3' untranslated region of rbm24a, the gold underlined region is the Zpc promoter, the Kozak sequence, the blue italic region is the 3x FLAG sequence, the green underlined region is the NLS nuclear localization motif, the gray region is the Cas9 sequence, the black underlined part is the bipartite nuclear localization signal sequence of nucleoplasmin NLS, and the black italic part is the SV40 poly(A) signal sequence.

[0063] It should be noted that the above examples are only used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application is explained in detail with reference to the examples, the technical solutions of the present application can be modified or equivalently replaced by those skilled in the art according to the technical solutions of the present application without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. A method for the construction of a zebrafish line for the production of maternal-effect mutants, characterized in that, The construction method comprises the following steps: rbm24a a gene knock-in site in the third intron of the gene, and obtaining a zebrafish strain in which Cas9 is efficiently and specifically expressed in oocytes by gene knock-in. Specifically, the construction method comprises the following steps: S1, select rbm24a a portion of the third intron of the gene as a gene knock-in site; S2, constructing a gene knock-in carrier plasmid, wherein the gene knock-in carrier plasmid at least comprises the gene knock-in site sequence of step S1, and is fused with a rbm24a a fourth exon sequence, and zpc driving cas9 a sequence for protein expression; S3, the gene knock-in vector plasmid, sgRNA and Cas9 protein are transferred into zebrafish embryos, and embryos with early knock-in events are screened based on the reporter gene, and the homozygous strain is obtained after cross breeding zpc:cas9 KI rbm24a 3rd intron Gene knock-in strain.

2. The construction method of claim 1, wherein, In the step S1, the gene knock-in site, i.e. sgRNA target point, has a sequence of SEQ ID NO. 1, i.e. 5'-GGCTGCTGTCATGTTGGGT-3'.

3. The construction method of claim 1, wherein, In the step S2, the reporter gene is a fluorescent protein gene.

4. The construction method of claim 3, wherein, The fluorescent protein gene is a red fluorescent protein gene.

5. The construction method of claim 1 wherein, In the step S3, the sgRNA sequence is shown in SEQ ID NO.

2.

6. The construction method of claim 1 wherein, In the step S3, the sequence of the vector plasmid is shown in SEQ ID NO.

6.

7. Application of the construction method of any one of claims 1-6 and / or the zebrafish strain obtained by the construction method of any one of claims 1-6 in large-scale function screening and / or research of maternal genes.

8. The use according to claim 7, characterized in that, The maternal genes are bmp2b Genes.

9. The use according to claim 7, wherein the compound is ###0005### or a pharmaceutically acceptable salt thereof. The maternal gene is nanog gene.

Images