A mutant of botulinum toxin type A and its applications

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a mutant of botulinum neurotoxin serotype A (BoNT / A) and its application. Compared with the wild-type BoNT / A having the amino acid sequence shown in SEQ ID NO:1, the mutant has at least one amino acid difference. In view of the defects of the prior art, through the screening of various sequences, the present invention provides an optimized BoNT / A sequence. Through codon optimization of the sequence and partial sequence replacement, not only high-purity soluble expression is achieved, but also the recombinantly expressed BoNT / A can mimic the natural post-translational modification process. Therefore, the optimized BoNT / A sequence provided by the present invention has broad prospects in the industrial production of BoNT / A.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a mutant of botulinum neurotoxin type A and its application. Background Art

[0002] Botulinum neurotoxin type A (BoNT-A), onabotulinumtoxinA, was approved by the US Food and Drug Administration (FDA) in 2002 for improving glabellar lines in patients 65 years of age and younger. In addition, BoNT-A has also been widely used in the treatment of hyperhidrosis, improving body contour and other non-invasive facial cosmetic procedures, meeting the cosmetic needs of a large number of patients.

[0003] BoNT-A is produced by Clostridium botulinum, a Gram-positive (G+) rod-shaped anaerobic bacterium, with a molecular weight of approximately 150 kDa. It consists of a 100 kDa heavy chain (Hc) and a 50 kDa light chain (Lc), which are connected by a disulfide bond. BoNT-A can inhibit the exocytosis of acetylcholine (Ach)-containing vesicles at the presynaptic cholinergic nerve endings in the peripheral nervous system into the neuromuscular junction, thereby paralyzing skeletal muscles. Like most bacterial toxins, BoNT is internalized through receptor-mediated endocytosis. For BoNT-A, the C-terminus of its 100 kDa Hc binds BoNT-A to the presynaptic cholinergic receptor (the first step), resulting in the internalization of BoNT-A (the second step). After internalization, the disulfide bond connecting Hc and Lc is cleaved, and Lc enters the neuronal cytoplasm through the vesicle membrane via an ATP-dependent receptor-mediated endocytic pathway, a process known as translocation (the third step). Finally, the intracellular toxic component of Lc inhibits the extracellular secretion of Ach by blocking SNAP-25 (the fourth step).

[0004] Most of the currently marketed botulinum neurotoxin type A is prepared by artificially culturing Clostridium botulinum. The natural BoNT / A produced by Clostridium botulinum in nature has a correct higher-order structure, but at the cost of an extremely slow production process. During the artificial cultivation of Clostridium botulinum, the yield of BoNT / A has been greatly improved by optimizing the culture conditions and other methods, solving this problem. However, natural BoNT / A is wrapped by a variety of accessory proteins with different molecular weights, forming a complex protein complex. Although a protein complex with a relatively single molecular weight of BoNT / A-accessory protein can be obtained through diverse protein purification strategies, there is still controversy over whether the accessory proteins can protect BoNT / A molecules and improve their stability. Instead, the presence of accessory proteins may pose biosafety problems for natural BoNT / A.

[0005] With the maturity of technologies such as recombinant protein expression and purification, using the Escherichia coli prokaryotic expression system to rapidly express and isolate high-purity proteins has become an efficient method to replace the isolation of natural proteins. However, when the E. coli expression system expresses proteins with large molecular weights or disulfide bonds, it often shows non-expression or expression in the form of inclusion bodies; the codon preference of the E. coli system can also affect the expression of the final target protein. Therefore, when using E. coli to express the gene sequence of BoNT / A, it is necessary to fully optimize the codons, combined with appropriate tag selection and host strain screening, to obtain highly soluble / expressed BoNT / A proteins. In addition, natural BoNT / A undergoes a post-translational modification process, specifically proteolysis at positions G445 and between K448 - A449, ultimately forming mature two-chain BoNT / A, making its biological activity higher. Since E. coli does not have a similar post-translational modification process, it is necessary to design a scheme to simulate the natural post-translational modification process for recombinantly expressed BoNT / A. Summary of the Invention

[0006] To overcome the defects of the prior art, the present invention proposes a mutant of botulinum neurotoxin type A. Through codon optimization of the sequence, partial sequence replacement, tag screening, host strain screening, etc., combined with the optimization of fermentation strategies, highly soluble expression of this mutant is achieved. Further, through an optimized purification method, a high-purity botulinum neurotoxin type A protein is obtained.

[0007] The present invention hereby proposes the following technical solutions:

[0008] One object of the present invention is to provide a mutant of botulinum neurotoxin type A (BoNT / A), which has at least 1 amino acid difference compared with the wild-type botulinum neurotoxin type A with the amino acid sequence shown in SEQ ID NO:1.

[0009] SEQ ID NO:1:

[0010]

[0011] In some instances, the amino acid differences are achieved by means such as amino acid insertion, substitution, deletion, and / or modification.

[0012] In some instances, the amino acid differences are as follows:

[0013] Insert one amino acid between positions 442 and 443.

[0014] In some preferred instances, valine (V) is inserted between positions 442 and 443.

[0015] In some instances, the amino acid differences are as follows:

[0016] Delete the amino acid at position 446.

[0017] In some instances, the amino acid differences are as follows:

[0018] Amino acid substitutions at positions 443, 444, and 447.

[0019] In some preferred instances, the amino acid substitution at position 443 is D443P, that is, aspartic acid (D) at position 443 of wild-type botulinum neurotoxin type A is substituted with proline (P).

[0020] In some preferred instances, the amino acid substitution at position 444 is K444R, that is, lysine (K) at position 444 of wild-type botulinum neurotoxin type A is substituted with arginine (R).

[0021] In some preferred instances, the amino acid substitution at position 447 is N447S, that is, asparagine (N) at position 447 of wild-type botulinum neurotoxin type A is substituted with serine (S).

[0022] In some instances, the mutant has the amino acid sequence shown in SEQ ID NO:2.

[0023] SEQ ID NO:2:

[0024]

[0025] A second object of the present invention is to provide an isolated polynucleotide encoding any one of the aforementioned mutants.

[0026] In some examples, the polynucleotide has the nucleotide sequence shown in SEQ ID NO: 3.

[0027] SEQ ID NO: 3:

[0028]

[0029] A third object of the present invention is to provide a recombinant expression vector, which recombinant expression vector comprises any one of the aforementioned polynucleotides.

[0030] In some examples, the recombinant expression vector includes a eukaryotic expression vector or a prokaryotic expression vector.

[0031] In some examples, the promoter of the recombinant expression vector includes, but is not limited to: T7, lac, tac, trc or trp promoters.

[0032] In some examples, the recombinant expression vector includes, but is not limited to: pET-28a, pET-20b, pET-29a, pQE30, pQE60 or pRSF.

[0033] In some preferred examples, the recombinant expression vector is pET-28a.

[0034] A fourth object of the present invention is to provide a host cell, which host cell comprises any one of the aforementioned recombinant expression vectors, or the polynucleotide is integrated into its genome.

[0035] In some examples, the host cell includes, but is not limited to: E.coli BL21, E.coli BL21(DE3), E.coli BL21(DE3)plysS, OverExpress C43(DE3), BL21 Gold pLysS(DE3), E.coli BL21(DE3)Condon Plus, E.coli Rosetta(DE3), E.coli BL21 Origami B(DE3), E.coliOrigami 2(DE3), E.coli Origami 2(DE3), AD494(DE3), E.coli BL21 Origami B(DE3), BL21 trxB(DE3), Rosetta-gami(DE3)pLysS, Rosetta-gamiB(DE3), Rosetta-gami 2(DE3), Tuner(DE3), ArcticExpress(DE3)RP, T7 express, E.coli BL21 Star(DE3), etc.

[0036] In some preferred examples, the host cell is E.coli BL21(DE3), E.coli BL21 Star(DE3), T7express or Tuner(DE3).

[0037] In some examples, the host cell is a transformant.

[0038] A fifth object of the present invention is to provide the use of any one of the foregoing mutants, polynucleotides, recombinant expression vectors and / or host cells in the preparation of botulinum toxin type A and / or in increasing the yield or purity of botulinum toxin type A.

[0039] A sixth object of the present invention is to provide the use of any one of the foregoing mutants, polynucleotides, recombinant expression vectors and / or host cells in the preparation of botulinum toxin products.

[0040] In some examples, the botulinum toxin products include drugs and medical aesthetic products.

[0041] In some examples, the drug is used for preventing and / or treating strabismus, cervical dystonia, laryngeal dystonia, upper limb focal dystonia, essential hand tremor, sialorrhea, blepharospasm, hemifacial spasm, spasticity of the upper / lower limbs caused by stroke, spasticity of the upper / lower limbs caused by cerebral palsy, axillary hyperhidrosis, palmar hyperhidrosis, detrusor sphincter dyssynergia, chronic migraine and neurogenic or idiopathic overactive bladder.

[0042] A seventh object of the present invention is to provide a pharmaceutical composition, which includes any one of the foregoing mutants, polynucleotides, recombinant expression vectors and / or host cells, and at least one pharmaceutically acceptable carrier or excipient.

[0043] An eighth object of the present invention is to provide a medical aesthetic product (or supplies), which includes any one of the foregoing mutants, polynucleotides, recombinant expression vectors and / or host cells, and at least one physiologically acceptable carrier or excipient.

[0044] In some examples, the dosage form of the medical aesthetic product can be an injection or a freeze-dried powder preparation.

[0045] A ninth object of the present invention is to provide a method for increasing the yield or purity of botulinum toxin type A, the method comprising:

[0046] (1) increasing the content and / or activity of any one of the foregoing mutants in the host cell; or

[0047] (2) introducing any one of the foregoing polynucleotides or recombinant expression vectors into the host cell; or

[0048] (3) culturing any one of the foregoing host cells.

[0049] In view of the defects of the prior art, through the screening of multiple sequences, the present invention provides an optimized BoNT / A sequence. Through codon optimization of the sequence and partial sequence replacement, not only high-purity soluble expression is achieved, but also the recombinantly expressed BoNT / A can simulate the natural post-translational modification process. The optimized BoNT / A sequence contains a thrombin cleavage site, and the cleavage of the thrombin cleavage site fully simulates the post-translational modification phenomenon of botulinum toxin in nature. The BoNT / A after thrombin cleavage in the present invention shows correct disulfide bond connection, correct conformation, and the molecular weight of the recombinant BoNT / A protein is complete, and the amino acid sequence coverage rate is 100%. In addition, the present invention screens a host bacterium and an expression vector suitable for the expression or culture of the optimized BoNT / A sequence, and the use of a specific host bacterium and an expression vector significantly improves the expression level of recombinant BoNT / A. Therefore, the optimized BoNT / A sequence provided by the present invention has broad prospects in the industrial production of BoNT / A. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The SEC-HPLC detection results of the samples before and after cleavage are shown.

[0051] Figure 2 The capillary isoelectric focusing electrophoresis detection results of different batches of samples are shown.

[0052] Figure 3 The TIC spectrogram of the disulfide bond pairing analysis of the samples before and after cleavage is shown.

[0053] Figure 4 The N-terminal primary mass spectrometry identification diagram (M1-K6) is shown.

[0054] Figure 5 The N-terminal primary mass spectrometry identification diagram of the unmodified M Loss peptide segment is shown.

[0055] Figures 6 - 8 The N-terminal primary mass spectrometry identification diagram (Q7-K34) is shown.

[0056] Figure 9 The N-terminal secondary mass spectrometry identification diagram (M1-K6) is shown.

[0057] Figure 10 The N-terminal secondary mass spectrometry identification diagram of the unmodified peptide segment M Loss peptide segment is shown.

[0058] Figures 11 - 13 The N-terminal secondary mass spectrometry identification diagram (Q7-K34) is shown.

[0059] Figure 14 The three-channel peak intercept range of the sample before cleavage is shown.

[0060] Figure 15Shows a partially enlarged view of the three-channel peak of the sample before enzymatic digestion.

[0061] Figure 16 Shows the molecular weight distribution map of the three-channel peak of the sample before enzymatic digestion.

[0062] Figure 17 Shows the intercepted range of the three-channel peak of the sample after enzymatic digestion.

[0063] Figure 18 Shows a partially enlarged view of the three-channel peak of the sample after enzymatic digestion.

[0064] Figure 19 Shows the molecular weight distribution map of the three-channel peak of the sample after enzymatic digestion.

[0065] Figure 20 Shows the TUV / TIC enlarged map (complete molecular weight detection) of the purified botulinum toxin type A sample.

[0066] Figure 21 Shows the Mass spectra map (retention time 5.88 min) of the purified botulinum toxin type A sample.

[0067] Figure 22 Shows the Deconvoluted mass contour map and bar chart (retention time 5.88 min) of the purified botulinum toxin type A sample.

[0068] Figure 23 Shows the TUV / TIC enlarged map (reduced molecular weight detection) of the purified botulinum toxin type A sample.

[0069] Figure 24 Shows the Mass spectra map (retention time 5.28 min) of the purified botulinum toxin type A sample.

[0070] Figure 25 Shows the Mass spectra map (retention time 6.05 min) of the purified botulinum toxin type A sample.

[0071] Figure 26 Shows the Deconvoluted mass contour map and bar chart (retention time 5.28 min) of the purified botulinum toxin type A sample.

[0072] Figure 27 Shows the Deconvoluted mass contour map and bar chart (retention time 6.05 min) of the purified botulinum toxin type A sample.

[0073] Figure 28The TIC map after Trypsin digestion of the purified botulinum toxin type A sample is shown (peptides from the light chain are marked in red, and peptides from the heavy chain are marked in green).

[0074] Figure 29 The TIC map after Trypsin digestion of the purified botulinum toxin type A sample is shown.

[0075] Figure 30 The TIC map after Chymotrypsin digestion of the purified botulinum toxin type A sample is shown.

[0076] Figure 31 The TIC map after Glu-C digestion of the purified botulinum toxin type A sample is shown.

[0077] Figure 32 The expression of the protein after directly lysing and extracting the total protein is shown.

[0078] Figure 33 The expression of the protein after repeatedly freezing and thawing the lysate and extracting the supernatant is shown.

[0079] Figure 34 The expression of the protein after repeatedly freezing and thawing the lysate and extracting the precipitate is shown.

[0080] Figure 35 The SDS-PAGE results of the soluble expression of proteins with 10 different optimized sequences are shown.

[0081] Figure 36 The SDS-PAGE results of the purification of proteins with 10 different optimized sequences are shown.

[0082] Figure 37 The supernatant proteins expressed by sequences 1-3 were purified by ion exchange chromatography. The percentages (10%, 15%, and 100%) are the volume ratios of the SP buffer to the eluent.

[0083] Figure 38 The supernatant proteins expressed by sequences 4 and 6 were purified by ion exchange chromatography. The percentages (10%, 15%, and 100%) are the volume ratios of the SP buffer to the eluent.

[0084] Figure 39 The supernatant proteins expressed by sequence 5 were purified by ion exchange chromatography. The percentages (10%, 15%, and 100%) are the volume ratios of the SP buffer to the eluent.

[0085] Figure 40 The supernatant proteins expressed by sequences 7, 8, and 10 were purified by ion exchange chromatography. The percentages (10%, 15%, and 100%) are the volume ratios of the SP buffer to the eluent. Detailed implementation mode

[0086] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0087] Unless the context clearly indicates otherwise, the expressions "a" and "an" as used herein include plural referents. For example, reference to "a cell" includes a plurality of such cells and equivalents known to those skilled in the art, and so on.

[0088] The term "about" as used herein means a range of ±20% of the value that follows. In some embodiments, the term "about" means a range of ±10% of the value that follows. In some embodiments, the term "about" means a range of ±5% of the value that follows.

[0089] The numerical ranges used herein should be understood to have enumerated all the numbers within that range. For example, the range of 1 to 20 should be understood to include any number, combination of numbers, or sub-range from the following group: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0090] The term "comprises" or "comprising" as used herein means "including but not limited to". This term is intended to be open-ended, to specify the presence of any stated feature, element, integer, step, or component, but does not exclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. Thus, the term "comprising" includes the more restrictive terms "consisting of" and "consisting essentially of". In one embodiment, the term "comprising" used throughout the application, particularly in the claims, may be replaced by the term "consisting of".

[0091] The terms "optionally", "either", "any", or "any one" as used herein mean that the subsequently described event or circumstance may but need not occur, and this description includes the instances where the event or circumstance occurs or does not occur. As used in the present invention, "a" and "an" are used in the present invention to refer to one or more than one grammatical object.

[0092] The term "and / or" as used herein should be understood to mean any one of the alternatives or any combination of any two or more of the alternatives.

[0093] To make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below in conjunction with embodiments. For those conditions not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. All reagents or instruments not indicating the manufacturer can be obtained as conventional products through commercial purchase. To better illustrate the present invention, numerous specific details are given in the following specific implementation manners. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present invention. Such structures and technologies are also described in many publications, such as "Molecular Cloning: A Laboratory Manual (Fourth Edition)" (Cold Spring Harbor Laboratory Press), Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience.

[0094] Example 1 Construction of Recombinant Host Cells

[0095] 1) Insert the nucleotide sequence shown in SEQ ID NO: 3 into the pET-28a vector, and the restriction enzyme sites are: NcoI and EcoR I.

[0096] 2) Send the constructed recombinant expression vector (pET-28a-BoNT / A) for sequencing. After the sequencing results are correct, subsequent experiments are carried out.

[0097] 3) Transform pET-28a-BoNT / A into the competent cell BL21(DE3), coat the plate and culture overnight. Pick a single colony and culture it with shaking at 37 °C in LB medium for 16 - 18 h.

[0098] 4) Collect the cultured bacterial liquid, which can be frozen for subsequent experimental use.

[0099] Example 2 Fermentation Culture of Recombinant Host Cells

[0100] In this example, Escherichia coli BL21(DE3)-pET-28a-BoNT / A is selected in a 50 L fermenter to ferment the target protein: botulinum toxin type A.

[0101] The fermentation medium of this example:

[0102] Magnesium sulfate 2.5 g / L, sodium citrate 3.0 g / L, dipotassium hydrogen phosphate 5.0 g / L, yeast powder 10.0 g / L, trace elements 7.0 mL / L, glucose 10.0 g / L and antifoaming agent 0.5 mL / L, ferrous sulfate heptahydrate 16.8 g, zinc sulfate heptahydrate 4.2 g, magnesium sulfate heptahydrate 0.8 g, sodium molybdate dihydrate 1.3 g, copper sulfate pentahydrate 0.6 g, boric acid 1.8 g and phosphoric acid 48.0 mL.

[0103] Feed medium:

[0104] Glucose 600.0 g / L, dipotassium hydrogen phosphate 3.0 g / L and peptone 3.0 g / L.

[0105] Preparation of culture medium: Install the calibrated pH electrode. After calibrating the dissolved oxygen electrode at zero point, prepare the fermentation medium. After sterilization, cool it down to the required temperature and calibrate the dissolved oxygen electrode at 100%;

[0106] Preparation of seed culture: Inoculate glycerol bacteria into LB medium and culture at 37 °C and 200 rpm for 6 - 7 h, with OD600 of 2 - 3;

[0107] Fermentation: Inoculate the seed into the fermenter at an inoculation amount of 2% - 4%. The liquid filling amount in the fermenter is 50% - 60%. Keep the dissolved oxygen at 15% - 50%, the aeration rate is 50 L / min, the tank pressure is 0.05 MPa, the culture temperature is 37 ± 1 °C, the rotation speed is 150 - 700 rpm, pH is 6.9 ± 0.5. If the dissolved oxygen is limited, the temperature can be reduced by 5 - 8 °C in advance;

[0108] Feeding: When the dissolved oxygen during culture rebounds above 45%, start adding the feed medium. After the start of feeding, based on a feeding rate of 4.0 mL / min, increase the feeding rate by 0.5 mL / min every half hour. When OD600 reaches 55 - 65, start cooling. After starting to cool, stop increasing the feeding. After cooling to 18 - 25 °C, reduce the feeding rate by 1 mL / min. After maintaining for about 2 h, start increasing the feeding rate at (0.25 mL / min) / h, with a maximum of 8 mL / min;

[0109] When OD600 is cultured to 55 - 65 and the temperature is 18 - 25 °C, stop feeding; when the dissolved oxygen rises rapidly, add IPTG with a final concentration of 0.4 mM for induction. After 10 - 15 h of induction, end the fermentation and collect the bacteria by centrifugation.

[0110] Example 3 Purification of botulinum neurotoxin type A (BoNT / A)

[0111] 3.1 Bacterial cell dispersion and homogenization

[0112] Add lysis buffer (20 mM Tris-HCl, pH 8.0) to the collected bacterial sludge. The volume of the lysis buffer is about 10 times that of the bacterial sludge. Add EDTA-2Na and PMSF to 1 mmol / L, disperse with an emulsifier at 2500 r / min for 10 min, and homogenize with a high-pressure homogenizer at a pressure of 800 bar for two times.

[0113] Take samples of the original sample, the first homogenized sample, and the second homogenized sample, perform microscopic examination, and observe under a 100× objective lens. If the number of intact bacteria in 5 different fields of view does not exceed 50, it indicates complete fragmentation.

[0114] 3.2 Clarification process

[0115] Dissolve and dilute the PDADMAC solution with a mass-volume ratio of 40% in purified water at a ratio of 1:50, and add it to the homogenized lysate for flocculation.

[0116] Add a PDADMAC solution with a volume ratio of 0.1% to the lysate, stir, and let stand for 10 min.

[0117] 3.3 Centrifugation

[0118] Slowly stir the flocculated bacterial solution evenly, then centrifuge it with a tubular centrifuge at 13000 RPM at a feed rate of 1 L / min, and take the supernatant to obtain a clarified feed solution.

[0119] 3.4 Cation exchange chromatography

[0120] Rinse the SP column with 0.5 mol / L NaOH for 30 min, and rinse it with purified water until neutral. Add NaCl solution to the clarified feed solution until the NaCl concentration of the clarified feed solution is 0.08 mol / L, and adjust the pH of the feed solution to 8.0 with 2 mol / L hydrochloric acid and 6 mol / L NaOH.

[0121] Load the clarified feed solution onto the SP column (Biolinco), balance the SP column with SP buffer (20 mM Tris-HCl, pH 8.0) for 3 column volumes (CV), load the sample, and then balance for another 3 CV until the baseline is flat. The eluent is (20 mM Tris-HCl, 1 mol / L NaCl, pH 8.0), wash impurities with 10% (volume ratio of SP buffer and eluent), and elute with 15% (volume ratio of SP buffer and eluent) to obtain an anion chromatography solution. The flow rate throughout the process is 150 cm / h.

[0122] Regenerate the column with 2 mol / L NaCl.

[0123] 3.5 Enzyme digestion

[0124] Incubate thrombin and the target protein at a ratio of 6 U:1 mg overnight at room temperature for enzymatic digestion.

[0125] 3.6 Hydrophobic chromatography

[0126] Wash the SP column with 0.5 mol / L NaOH for 30 min and then wash it with purified water until neutral.

[0127] Add (NH4)2SO4 to the sample to 1 mol / L, and adjust the pH of the feed solution to 7.0 with 2 mol / L hydrochloric acid and 6 mol / L NaOH. Load the sample onto a hydrophobic column (Bio-link), equilibrate the hydrophobic column with the equilibration buffer (20 mM Tris-HCl, 1 mol (NH4)2SO4, pH 7.0) for 3 column volumes (CVs), load the sample, and then equilibrate for another 3 CVs until the baseline is flat. Elute with the elution buffer (20 mM Tris-HCl, pH 7.0), wash away impurities with 50% (volume ratio of equilibration buffer to elution buffer), and elute the target protein with 60% (volume ratio of equilibration buffer to elution buffer) to obtain the hydrophobic chromatography solution, and finally wash with water. The flow rate throughout the process is 100 cm / h.

[0128] 3.7 Ultrafiltration concentration

[0129] Wash the 30 kDa ultrafiltration membrane package with 0.5 mol / L NaOH for 30 min and then wash it with purified water until neutral.

[0130] Ultrafilter and concentrate the hydrophobic chromatography solution with a transmembrane pressure of 0.3 bar until the concentration of the target protein reaches 0.8 - 1.2 mg / mL.

[0131] 3.8 Size exclusion chromatography

[0132] Wash the HiLoad Superdex 200 pg (Cytiva, CAT#: 28989336) size exclusion column with 0.5 mol / L NaOH for 30 min and then wash it with purified water until neutral.

[0133] Load the ultrafiltered and concentrated solution onto the HiLoad Superdex 200 pg column, elute with the elution buffer (20 mM sodium lactate, 150 mM NaCl, pH 7.0), with a flow rate of 30 cm / h, and the sample loading amount each time is not less than 2% and not more than 4%.

[0134] Test example 1 SEC-HPLC purity detection

[0135] Perform SEC-HPLC purity detection on recombinant botulinum toxin type A before and after enzymatic digestion in Example 1.

[0136] According to the "Standard Operating Procedure for the Determination of Protein Product Purity (SEC-HPLC Method)" (SOP-RD-00085), an appropriate amount of the test sample was mixed evenly, centrifuged at 6000 rpm for 1 minute, and the supernatant was taken for detection; the instrument parameters are shown in Table 1.

[0137] Table 1

[0138]

[0139]

[0140] The SEC-HPLC results showed that the monomer purity of the sample before enzymatic digestion was 97.6%, and the monomer purity of the sample after enzymatic digestion was 98.7%, with a significant decrease in polymers and fragments ( Figure 1 ). The proportional changes of monomers, polymers and fragments are shown in Table 2.

[0141] Table 2

[0142]

[0143] Experimental Example 2 Detection of Isoelectric Point by Capillary Isoelectric Focusing Electrophoresis

[0144] A large number of modifications will occur during the production and storage of recombinant protein drugs, such as oxidation, deamidation, glycosylation, C-terminal lysine truncation, N-terminal pyroglutamic acid cyclization, etc. The charge properties on the protein surface may change due to various modifications, resulting in so-called charge isomers. Charge isomers have an important impact on the stability, solubility, immunogenicity, in vitro and in vivo biological activities and pharmacokinetic functions of recombinant protein drugs. Capillary isoelectric focusing electrophoresis technology (icIEF) is a new electrophoresis system that combines capillary isoelectric focusing electrophoresis with whole-column imaging technology. Due to its simple method development, high throughput, good reproducibility in isoelectric point (pI) determination and quantification, etc., it has been widely used in the bio-pharmaceutical field for the determination of charge heterogeneity.

[0145] According to the "Standard Operating Procedure for the Determination of Isoelectric Point of Protein Products (iCIEF Method)" (SOP-RD-00086), an appropriate amount of the test sample was mixed evenly, centrifuged at 12000 rpm for 5 minutes, 15 μL of the supernatant was taken and mixed with 85 μL of the matrix (35 μL of 1% MC + 4 μL of ampholyte + 2 μL of 500 mmol / L arginine + 43 μL of ultrapure water + 1 μL of Marker). The mixed sample was centrifuged at 10000 rpm for 10 minutes, 80 μL of the centrifuged sample was taken, and slowly and carefully added to a 96-well plate, and centrifuged at 3000 rpm for 10 minutes; the instrument parameters are shown in Table 3.

[0146] Table 3

[0147]

[0148]

[0149] The results showed that the theoretical value and the actual value of the isoelectric point of the recombinant type A protein were quite Figure 2 )

[0150] Test Example 3 Disulfide Bond Pairing Analysis

[0151] A disulfide bond is a chemical bond that connects the sulfhydryl groups of two different cysteine residues in different peptide chains or the same peptide chain. A disulfide bond is a relatively stable covalent bond and plays a role in stabilizing the spatial structure of peptide chains in protein molecules. The more disulfide bonds there are, the greater the stability of the protein molecule against the influence of external factors. In chemistry, a disulfide bond refers to a functional group with the structure R-S-S-R'. A disulfide bond is usually formed by the coupling of two thiol groups. In biology, the disulfide bond formed between the thiol groups of two cysteine residues is an important part of the secondary and tertiary structures of proteins. This bond plays a certain important role in the formation of the three-dimensional structure of protein molecules.

[0152] The three-dimensional structure of a protein is formed through non-covalent binding (electrostatic force, van der Waals force, hydrogen bond and hydrophobic interaction) and chemical bonds (disulfide bonds). Cysteine is the only amino acid that can form disulfide bonds. The free sulfhydryl group of cysteine forms a disulfide bond through oxidation and dehydration. Disulfide bonds are found in all proteins formed from simple single-celled prokaryotes to complex multi-celled eukaryotes. Disulfide bonds can reduce the conformational entropy of proteins in the unfolded state and maintain the thermodynamic effects between molecules and between molecules and the solution, thus effectively maintaining a stable three-dimensional structure of proteins. Therefore, disulfide bonds are not only a type of post-translational modification, but also the primary condition for ensuring the active conformation of proteins.

[0153] Samples before and after enzymatic digestion in Example 1 were collected for disulfide bond pairing analysis.

[0154] The sample before enzymatic digestion was prepared according to the "Standard Operating Procedure for Detection of Disulfide Bonds in Protein Products (Mass Spectrometry Method)" (SOP-RD-00082). Non-reduction: Take 20 μL of the sample, add 75 μL of 8 mol / L guanidine hydrochloride, 4 μL of Tris-HCl, 2 μL of H2O, and 2.5 μL of IAM, mix well, and incubate in a water bath at 37°C (protected from light) for 1 hour. Reduction: Take 20 μL of the sample, add 75 μL of 8 mol / L guanidine hydrochloride, 4 μL of Tris-HCl, 2 μL of DTT, and 2.5 μL of IAM, mix well, and incubate in a water bath at 37°C (protected from light) for 1 hour. Add 900 μL of enzymatic digestion buffer to the reduced / non-reduced denatured and alkylated sample, mix well, and then replace it with a 10KD ultrafiltration tube to make the final volume about 100 μL. Take 100 μL of the replaced sample, add 0.8 μL of mix, and digest overnight at 37°C.

[0155] The denaturation and alkylation process of the sample after enzymatic digestion was adjusted as follows: Take 100 μL of the sample, add 400 μL of denaturing solution (8 mol / L guanidine hydrochloride + 0.5 mol / L Tris + 0.65 mmol / L EDTA), incubate and denature in a water bath at 70°C for 45 minutes. After cooling, add 25 μL of 1 mol / L IAM and alkylate at room temperature protected from light for one hour. After alkylation, it was determined according to the "Standard Operating Procedure for Detection of Disulfide Bonds in Protein Products (Mass Spectrometry Method)" (SOP-RD-00082).

[0156] The data was analyzed using Thermo BioPharma Finder software. The results showed that two pairs of theoretical disulfide bonds, "1:C431 / 1:C455" and "1:C1236 / 1:C1281", could be detected in the samples before and after enzymatic digestion. This also indicated that the disulfide bonds of botulinum toxin type A protein were correctly formed ( Figure 3 ).

[0157] Each botulinum toxin molecule contains 9 cysteines. Among them, C430 of the light chain forms an interchain disulfide bond with C454 of the heavy chain to ensure the correct pairing of the light chain and the heavy chain; C1235 and C1280 of the heavy chain form an intrachain disulfide bond within the heavy chain. This disulfide bond may be related to the structural stability of the botulinum toxin molecule and the function of the ganglioside binding domain. Therefore, theoretically, each correctly configured botulinum toxin molecule contains 5 unpaired cysteines. The experimentally determined free sulfhydryl molar content of the botulinum toxin molecule after thrombin digestion was approximately 4.77 (mol / mol), which was close to the theoretical value, indicating that the botulinum toxin molecule after thrombin digestion showed correct disulfide bond connection and correct configuration.

[0158] Test Example 4 Mass Spectrometric Analysis of the N-Terminal Complete Sequence

[0159] The N-terminal sequence is closely related to the function and stability of proteins. Performing N-terminal sequencing analysis on proteins can determine the starting point of proteins, which is beneficial for analyzing the higher-order structure of proteins and revealing their biological functions.

[0160] The samples before and after enzymatic digestion in Example 1 were analyzed using mass spectrometry.

[0161] The Thermo BioPharma Finder software was used to analyze the data. A total of 24 amino acids in 3 N-terminal peptide segments, namely "MPFVNK", "QFNYK", and "DPVNGVDIAYIK", were found in the samples before and after enzymatic digestion, and were confirmed by the first-order mass spectrometry map and the second-order mass spectrometry map, which were consistent with the theoretical amino acid sequence ( Figures 4 - 13 ).

[0162] Test Example 5 SEC-MALS Molecular Weight Analysis

[0163] Polypeptide and protein molecules can aggregate into a multimeric state for various reasons, which affects the action of drugs. Therefore, it becomes very important to detect the multimeric state and proportion of polypeptide and protein molecules. Combining a multi-angle laser light scattering instrument (Multi-Angle Laser Light Scattering, MALS) with SEC can not only separate different fractions, but also measure the molecular weights and their distributions of different fractions.

[0164] The calculation of the SEC-MALS molecular weight is mainly based on the laser and differential signals, and at the same time provides signals from multiple detection channels of a multi-angle laser detector LS, an ultraviolet detector UV, and a differential refractive index detector dRI.

[0165] The samples before and after enzymatic digestion in Example 1 were subjected to SEC-MALS molecular weight analysis.

[0166] The three-channel peak intercept ranges, partial enlarged views, and their molecular weight distribution maps of the samples before and after enzymatic digestion are as Figures 14 - 19 shown.

[0167] Before digestion, 6 main chromatographic peaks (Peak1 - Peak6) were detected in the sample. The fitted molecular weights of each chromatographic peak by differential refractive index and MALS detection are shown in Table 4. Among them, Peak4 - Peak6 are fragment peaks, Peak2 and Peak3 are polymer peaks. Peak2 is mainly undecamer, and Peak3 is mainly thirty - tetramer. After digestion, 4 main chromatographic peaks (Peak1 - Peak4) were detected in the sample. The fitted molecular weights of each chromatographic peak by differential refractive index and MALS detection are shown in Table 4. Among them, Peak4 is a fragment peak, Peak2 and Peak3 are polymer peaks. Peak2 is mainly nonamer, and Peak3 is mainly fifty - nonamer. Here, the monomer refers to the monomer form of recombinant botulinum toxin type A; the polymer and dimer refer to the complex formed by the aggregation of recombinant botulinum toxin type A molecules; Fragment 1, Fragment 2, and Fragment 3 refer to the recombinant botulinum toxin light chain molecules, heavy chain molecules, etc. generated due to the possible cleavage of the disulfide bond between the light chain and heavy chain of recombinant botulinum toxin type A. The monomer is a complete recombinant botulinum toxin type A molecule with the correct configuration. The higher its proportion, the higher the purity and quality of the recombinant botulinum toxin type A obtained through purification.

[0168] Table 4

[0169]

[0170] Effect Example 1 Molecular Weight Analysis of Purified Recombinant Botulinum Toxin Type A

[0171] The primary structure of a protein is the basis for its higher - order structure, mechanism of action, and biological function. Therefore, it is necessary to detect and confirm the amino acid sequence of the protein to confirm that the molecular weight of the protein is consistent with the theory. Whether the molecular weight is correct often represents whether the structure of the measured organic compound and biological macromolecule is correct.

[0172] The molecular weight is divided into the complete molecular weight and the reduced molecular weight, which characterize the protein macromolecule as a whole to confirm whether there are fragment deletions or mismatches in the protein macromolecule.

[0173] The experimental related materials and equipment are as follows:

[0174] Acetonitrile (ACN) was purchased from Honeywell, product number: UN1648, batch number: 22040013;

[0175] Formic acid (FA) was purchased from Aladdin, product number: F301957, batch number: B2307725;

[0176] Dithiothreitol (DTT) was purchased from Macklin, product number: D806827 - 5g, batch number: C13890106;

[0177] Guanidine hydrochloride was purchased from Aladdin, product number: F1918055, batch number: C2130215;

[0178] The liquid chromatography quadrupole time-of-flight mass spectrometer ACQuity H-class Plus Xevo G2-XS Qtof was purchased from Waters;

[0179] The ultrapure water instrument Unique-R20 was purchased from Xiamen Reshijie;

[0180] The dry bath incubator DB1-100 was purchased from Titan;

[0181] Chromatography; ACQUITY UPLC Protein BEH C4 Column( 1.7μm, 2.1mm×50mm) was purchased from Waters.

[0182] 1.1 Complete molecular weight analysis

[0183] After diluting the test sample (purified recombinant botulinum toxin type A, the purification method is the same as in Example 2), it was separated by ultra-high performance liquid chromatography and detected and confirmed by an ultraviolet detector and a high-resolution mass spectrometer. Detection was carried out using the ACQuity H-class Plus Xevo G2-XS Qtof, and analysis was performed using UNIFI software to conduct a complete molecular weight analysis of the test sample.

[0184] (1) Sample preparation

[0185] Mobile phase A (0.1% FA aqueous solution): Take 0.5 mL of FA and add it to 500 mL of purified water, and mix well.

[0186] Mobile phase B (0.1% FA acetonitrile solution): Take 0.5 mL of FA and add it to 500 mL of acetonitrile, and mix well.

[0187] Take 100 μL of the purified botulinum toxin type A sample with a concentration of 0.3 mg / mL and transfer it into an inner cannula for on-machine detection, and the injection volume is 8 μL.

[0188] (2) Experimental parameters

[0189] Liquid phase parameters: The test sample was separated using an ultra-high performance liquid chromatography system. Mobile phase A was 0.1% FA aqueous solution, and mobile phase B was 0.1% FA acetonitrile solution. The chromatographic column was equilibrated with mobile phase A at the initial gradient. The test sample was loaded by an autoinjector and then gradient separated by the chromatographic column. The flow rate was 0.3 mL / min, the detection wavelength was 280 nm, and the column temperature was 80 °C. The relevant liquid phase gradient is shown in Table 5.

[0190] Table 5

[0191] Time (min) Mobile Phase A (%) Mobile Phase B (%) 0.00 90.0 10.0 1.00 90.0 10.0 8.00 10.0 90.0 11.00 10.0 90.0 11.10 90.0 10.0 15.00 90.0 10.0

[0192] Mass spectrometry parameters: The test sample was analyzed by an Xevo G2-XS QTof mass spectrometer, and the specific parameters are shown in Table 6 as follows:

[0193] Table 6

[0194]

[0195]

[0196] Processing parameters: Analyzed by UNIFI (1.9.4, Waters) software, the method processing type is Intact Protein (MS-RT Window Based), and the parameters are shown in Table 7.

[0197] Table 7

[0198] Matters Parameter Setting / Type Input mass 500-2000 Output mass 120000-160000；30000-50000 TOF Resolution 10000 Peak width model Tof

[0199] The TUV / TIC amplified map of the purified botulinum toxin type A sample is as shown in Figure 20 and the Mass spectra map is as shown in Figure 21 The deconvoluted Deconvoluted mass contour map and bar chart are as shown in Figure 22 .

[0200] The molecular weight of the small peak at the retention time of 5.08 min of the purified botulinum toxin type A sample is 45448 Da, and the detection results of the molecular weight of the main peak at 5.81 min are shown in Table 8.

[0201] Table 8

[0202]

[0203] Among them, the missing modification refers to the amino acid site / sequence missing in the recombinant botulinum toxin type A protein sample compared with the theoretical amino acid sequence; the proportion of modification types in the table refers to the proportion of recombinant botulinum toxin type A proteins with different missing modification types.

[0204] 1.2 Reducing molecular weight analysis

[0205] 1) Sample preparation

[0206] Mobile phase A (0.1% FA aqueous solution): Take 0.5 mL of FA and add it to 500 mL of purified water, and mix well.

[0207] Mobile phase B (0.1% FA acetonitrile solution): Take 0.5 mL of FA and add it to 500 mL of acetonitrile, and mix well.

[0208] 8 mol / L Guanidine Hydrochloride Solution: Weigh 9.90665 g of guanidine hydrochloride, add purified water to approximately 12.96 mL, and mix well.

[0209] 0.5 mol / L DTT Solution: Weigh 25.565 mg of DTT, add 331.5 μL of purified water, and mix well.

[0210] Take 100 μL of a sample with a concentration of 0.3 mg / mL (purified recombinant botulinum toxin type A, purified by the same method as in Example 2), add 360 μL of 8 mol / L guanidine hydrochloride, mix well, then add 20 μL of 0.5 mol / L DTT, react at 37 °C for 30 min. After the reaction, transfer it into an inner cannula for on-machine detection, and the injection volume is 30 μL.

[0211] Liquid Phase Parameters: The test sample is separated using an ultra-high performance liquid chromatography system. Mobile phase A is 0.1% FA aqueous solution, and mobile phase B is 0.1% FA acetonitrile solution. The chromatographic column is equilibrated with mobile phase A at the initial gradient. The test sample is loaded by an auto-sampler, then gradient separated by the chromatographic column, the flow rate is 0.3 mL / min, the detection wavelength is 280 nm, and the column temperature is 80 °C. The relevant liquid phase gradient is shown in Table 5.

[0212] Mass Spectrometry Parameters: The test sample is analyzed by a Xevo G2-XS QTof mass spectrometer, and the specific parameters are shown in Table 6.

[0213] Processing Parameters: Analyzed by UNIFI (1.9.4, Waters) software, the method processing type is Intact Protein (MS-RT Window Based). The parameters are shown in Table 9.

[0214] Table 9

[0215] Matters Parameter Setting / Type Input mass 800-2000 Output mass 90000-160000；40000-70000 TOF Resolution 10000 Peak width model Tof

[0216] The detection results of the reduced molecular weight of the purified recombinant botulinum toxin type A sample are shown in Table 10. The enlarged TIC / TUV chromatogram is shown in Figure 23 , and the Mass spectra chromatogram is shown in Figures 24 - 25 . The deconvoluted Deconvoluted mass contour diagram and bar chart are shown in Figures 26 - 27 .

[0217] Table 10

[0218]

[0219] In this example, a reduction method was used to detect the molecular weights of the light and heavy chains of the recombinant botulinum neurotoxin type A sample. Deletion modification refers to the amino acid sites / sequences deleted from the light and heavy chains of the recombinant botulinum neurotoxin type A protein sample compared with the theoretical amino acid sequence. The specific deletion sites / sequences are shown in Table 10. No deletion modification was detected in the heavy chain, which was labeled as N / A; the proportion of modification types in the table refers to the proportion of light and heavy chain molecules of different deletion modification types.

[0220] Combining the results of the reduced molecular weight and the complete molecular weight, there were cases where part of the C-terminal TKSLVPR of the light chain was lost, part of the N-terminal M of the light chain was missing, part of the C-terminal KSLVPR of the light chain was lost, and part of the C-terminal SLVPR of the light chain of the protein was lost.

[0221] The detected result of the heavy chain was 98423.9736 Da. The measured values of the light and heavy chains of the sample were consistent with the theoretical values.

[0222] In the recombinant botulinum neurotoxin type A protein used in the present invention, the amino acid sequence at positions 443 - 448 between the light and heavy chains was replaced with the thrombin cleavage site LVPRGS. Thrombin can recognize this sequence and cleave between R / G. According to the results of the reduced molecular weight and peptide mapping, it was speculated that the separation position of the light and heavy chains of the sample was between R446 / G447, which was consistent with the theoretical thrombin cleavage site. In addition, there were also cases where part of the C-terminal TKSLVPR of the light chain was lost, part of the N-terminal M of the light chain was missing, part of the C-terminal KSLVPR of the light chain was lost, and part of the C-terminal SLVPR of the light chain was lost. Among them, the deletion at the C-terminal of the light chain might be due to the instability of the exposed end after thrombin cleavage. In nature, the post-translational modification process of cleavage between the light and heavy chains also exists in the botulinum neurotoxin type A produced by Clostridium botulinum, and this process can improve the biological activity of botulinum toxin; and partial amino acid loss also occurs near the cleavage site in natural botulinum neurotoxin type A. Therefore, the thrombin cleavage site designed in the present invention fully mimics the post-translational modification phenomenon of botulinum toxin in nature.

[0223] Effect Example 2 Peptide Mapping Analysis of Purified Recombinant Botulinum Neurotoxin Type A Protein

[0224] Peptide mapping analysis is based on the molecular weight and amino acid composition characteristics of proteins and polypeptides. A highly specific proteolytic enzyme (usually an endopeptidase) is used to act on specific peptide chain sites to cleave polypeptides into small fragments, and a characteristic fingerprint map is formed through certain separation and detection means.

[0225] There has been no peptide mapping analysis of recombinant botulinum neurotoxin type A protein in the art, and this is the first publication of the quality peptide map of known recombinant botulinum neurotoxin type A.

[0226] The experimental related materials and equipment are as follows:

[0227] Acetonitrile (ACN) was purchased from Honeywell, product number: UN1648, batch number: 22040013;

[0228] Formic acid (FA) was purchased from Aladdin, product number: F301957, batch number: B2307725;

[0229] Guanidine hydrochloride was purchased from Aladdin, product number: F1918055, batch number: C2130215;

[0230] 1 mol / L Tris-Hydrochloride (Tris-HCl) was purchased from Adamas life, product number: E8029, batch number: P2317886;

[0231] 10 kD ultrafiltration centrifugal tubes were purchased from Millipore, product number: UFC5010BK, batch number: R0AB79806;

[0232] Calcium chloride was purchased from Shanghai Reagent, product number: 10005861, batch number: 20220218;

[0233] Trypsin was purchased from Promega, product number: V511A, batch number: V511A;

[0234] Dithiothreitol (DTT) was purchased from Sinopharm Group, product number: 63002632, batch number: 20200326;

[0235] Iodoacetamide (IAM) was purchased from Sigma, product number: I1149-5G, batch number: SLCL5599;

[0236] NAP-5 column was purchased from Citiva, product number: 17085302, batch number: 17582933;

[0237] Ultra high performance liquid chromatography-mass spectrometry instrument Thermo Vanquish-Q Exactive Plus was purchased from Thermo Fisher;

[0238] Ultra pure water instrument Unique-R20 was purchased from Xiamen Reshijie;

[0239] Dry block heater DB1-100 was purchased from Titan;

[0240] Chromatography; ACQUITY UPLC Protein BEH C18 Column( 1.7 μm, 2.1 mm × 150 mm) was purchased from Waters.

[0241] The test sample (purified by the same method as in Example 2) was denatured and reduced, alkylated and protected, digested, and then separated by ultra-high performance liquid chromatography, and detected and confirmed by an ultraviolet detector and a high-resolution mass spectrometer. In this experiment, Thermo Vanquish-Q Exactive Plus was used for detection, and the quality peptide map analysis of the test sample was carried out by analyzing with Biopharma Finder software.

[0242] 2.1 Reagent Preparation and Sample Treatment

[0243] Mobile phase A (0.1% FA aqueous solution): Take 0.8 mL of FA and add it to 800 mL of purified water, and mix well.

[0244] Mobile phase B (0.1% FA acetonitrile solution): Take 0.8 mL of FA and add it to 800 mL of acetonitrile, and mix well.

[0245] 1 mol / L IAM solution: Weigh 20.805 mg of IAM, add 112.4 μL of purified water, and mix well in the dark.

[0246] 1 mol / L DTT solution: Weigh 17.335 mg of DTT, add 112.6 μL of purified water, and mix well.

[0247] 8 mol / L guanidine hydrochloride solution: Weigh 9.945940 g of guanidine hydrochloride, add purified water to about 13 mL, and mix well.

[0248] Enzyme digestion buffer: Weigh 0.488285 g of calcium chloride, add 22 mL of 1 M Tris-HCl pH 8.0 solution, and then add purified water to about 440 mL, and mix well by ultrasonic treatment to obtain the enzyme digestion buffer (50 mmol / L Tris-HCl, 10 mmol / L CaCl2, pH 8.0).

[0249] 20% formic acid solution: Take 20 μL of formic acid, add 80 μL of purified water, and mix well.

[0250] 100 mM Tris-HCl solution: Measure 1 ml of 1 mol / L Tris-HCl, add 9 mL of purified water, and mix well.

[0251] Take 500 μg of the sample, use a 10 kD ultrafiltration centrifugal tube to replace the solution with 100 μL of 100 mM Tris-HCl, add 360 μL of 8 M guanidine hydrochloride and 25 μL of 1 M Tris-HCl, mix well by shaking, then add 5 μL of 1 M DTT, react at 37 °C for 30 min, and then add 10 μL of 1 M IAM, react in the dark for 40 min. Use a NAP-5 column to replace the solution with 1 mL of enzymatic digestion buffer. Take 100 μL of the replaced solution and add 4 μL of 0.5 mg / mL Trypsin enzyme, react at 37 °C for 4 h, then add 2 μL of 20% formic acid to terminate the reaction, and perform on-machine detection after termination.

[0252] 2) Experimental parameters

[0253] Liquid phase parameters: The test sample was separated using an ultra-high performance liquid chromatography system. Mobile phase A was an aqueous solution of 0.1% FA, and mobile phase B was an acetonitrile solution of 0.1% FA. The chromatographic column was equilibrated with mobile phase A at the initial gradient. The test sample was loaded by an autoinjector, and then gradient separated by the chromatographic column at a flow rate of 0.25 mL / min. The detection wavelength was 214 nm, the column temperature was 60 °C, and the injection volume was 25 μL. The relevant liquid phase gradient is shown in Table 11.

[0254] Table 11

[0255] Time (min) Mobile Phase A (%) Mobile Phase B (%) 0 99 1 2 99 1 82 62 38 83 30 70 84 10 90 88 90 10 92 10 90 95 50 50 96 50 50 98 99 1 110 99 1

[0256] The test sample was denatured and reduced, alkylated and protected, digested with enzymes, and then separated by ultra-high performance liquid chromatography, and detected and confirmed by an ultraviolet detector and a high-resolution mass spectrometer. In this experiment, Thermo Vanquish-Q ExactivePlus was used for detection, and the test sample was analyzed by Biopharma Finder software for quality peptide mapping analysis.

[0257] Mass spectrometry parameters: The test sample was analyzed by mass spectrometry using a Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography-mass spectrometry combined instrument.

[0258] Processing parameters: Analyzed by Biopharma Finder software, the method processing type was Peptide MappingAnalysis. The parameter processing is shown in Table 12.

[0259] Table 12

[0260] Parameter Value Mass Accuracy (ppm) 10 Minimum Confidence 0.80 Protease Specificity High Confidence (Conf.Score) ≥80 Best ASR ≤2 ID Type MS2

[0261] The peptide map results are shown in detail in Table 13 and Figure 28, 1:M1-K6 represents that this peptide segment is the M1-K6 peptide segment of the light chain; Q7-K34 represents that this peptide segment is the Q7-K34 peptide segment of the light chain; M loss(M1) represents that the first amino acid M of this protein is lost, and Carbamidomethylation(C135) represents that the 134th amino acid C of this protein undergoes alkylation modification, which is a fixed modification introduced during protein pretreatment.

[0262] Table 13

[0263]

[0264]

[0265]

[0266]

[0267]

[0268] Among them, the peptide segments marked with * are the peptide segments obtained by chymotrypsin digestion, and the rest are the peptide segments obtained by trypsin digestion;

[0269] All peptide segments and modifications are confirmed by secondary spectra;

[0270] Carbamidomethylation: Cysteine alkylation modification, introduced by sample pretreatment.

[0271] Coverage analysis of purified botulinum toxin type A protein in Example 3 of effects

[0272] Peptide segment coverage refers to the degree of consistency matching between the protein amino acid sequence and the theoretical sequence, mainly for the confirmation of the protein primary sequence. This information can help researchers quickly understand the structure of the protein and determine whether the protein expression is correct.

[0273] The experimental related materials and equipment are as follows:

[0274] Acetonitrile (ACN) was purchased from Honeywell, product number: UN1648, batch number: 22040013;

[0275] Formic acid (FA) was purchased from Aladdin, product number: F301957, batch number: B2307725;

[0276] Guanidine hydrochloride was purchased from Aladdin, product number: F1918055, batch number: C2130215;

[0277] 1 mol / L Tris-HCl was purchased from Adamas life, product number: E8029, batch number: P2317886;

[0278] 10kD ultrafiltration centrifuge tubes were purchased from Millipore, catalog number: UFC5010BK, batch number: R0AB79806;

[0279] Calcium chloride was purchased from Shanghai Test, product number: 10005861, batch number: 20220218;

[0280] Trypsin was purchased from Promega, catalog number: V511A, batch number: V511A;

[0281] Chymotrypsin was purchased from Adamas, product number: Adamas, batch number: ENI20220701;

[0282] Glu-C protein endonuclease was purchased from Sigma, catalog number: P6181-50UG, batch number: SLCL1060;

[0283] Dithiothreitol (DTT) was purchased from Sinopharm Group, catalog number: 63002632, batch number: 20200326;

[0284] Iodoacetamide (IAM) was purchased from Sigma, catalog number: I1149-5G, batch number: SLCL5599;

[0285] NAP-5 column was purchased from Citiva, catalog number: 17085302, batch number: 17582933;

[0286] Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography-mass spectrometry was purchased from Thermo Fisher Scientific;

[0287] Ultrapure water instrument Unique-R20 was purchased from Xiamen Ruisijie;

[0288] The dry thermostat DB1-100 was purchased from Titan;

[0289] Chromatography; ACQUITY UPLC Protein BEH C18 Column( 1.7 μm, 2.1 mm×150 mm) was purchased from Waters.

[0290] This experiment was detected using a Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography-mass spectrometry instrument and analyzed by Biopharma Finder software. Sequence coverage analysis was performed on the sample (the purification method was the same as in Example 2).

[0291] 2.1 Reagent Preparation and Sample Treatment

[0292] Mobile phase A (0.1% FA aqueous solution): Take 0.8 mL of FA and add it to 800 mL of purified water, and mix well.

[0293] Mobile phase B (0.1% FA acetonitrile solution): Take 0.8 mL of FA and add it to 800 mL of acetonitrile, and mix well.

[0294] 1 mol / L IAM solution: Weigh 20.805 mg of IAM, add 112.4 μL of purified water, and mix well in the dark.

[0295] 1 mol / L DTT solution: Weigh 17.335 mg of DTT, add 112.6 μL of purified water, and mix well.

[0296] 8 mol / L guanidine hydrochloride solution: Weigh 9.945940 g of guanidine hydrochloride, add purified water to about 13 mL, and mix well.

[0297] Enzymatic digestion buffer: Weigh 0.488285 g of calcium chloride, add 22 mL of 1 M Tris-HCl pH 8.0 solution, and then add purified water to about 440 mL. Mix well by ultrasound to obtain the enzymatic digestion buffer (50 mmol / L Tris-HCl, 10 mmol / L CaCl2, pH 8.0).

[0298] 20% formic acid solution: Take 20 μL of formic acid, add 80 μL of purified water, and mix well.

[0299] 100 mM Tris-HCl solution: Measure 1 ml of 1 mol / L Tris-HCl and add it to 9 mL of purified water, and mix well.

[0300] Take 500 μg of the sample, and use a 10 kD ultrafiltration centrifugal tube to replace the solution with 100 μL of 100 mM Tris-HCl. Add 360 μL of 8 M guanidine hydrochloride and 25 μL of 1 M Tris-HCl. After shaking and mixing evenly, add 5 μL of 1 M DTT, react at 37 °C for 30 min, then add 10 μL of 1 M IAM, and react in the dark for 40 min. Use a NAP-5 column to replace the solution with 1 mL of enzymatic digestion buffer. Take 100 μL of the replaced solution and add 4 μL of 0.5 mg / mL Trypsin enzyme; take 100 μL of the replaced solution and add 4 μL of 0.5 mg / mL Chymotrypsin enzyme, and react at room temperature for 2 h; take 100 μL of the replaced solution and add 4 μL of 0.5 mg / mL Glu-C enzyme, and react at 37 °C for 16 h. After the above enzymatic digestion, add 2 μL of 20% formic acid to terminate the reaction, and perform on-machine detection after termination.

[0301] 2) Experimental parameters

[0302] Liquid phase parameters: The test sample was separated using an ultra-high performance liquid chromatography system. Mobile phase A was an aqueous solution of 0.1% FA, and mobile phase B was an acetonitrile solution of 0.1% FA. The chromatographic column was equilibrated with mobile phase A at the initial gradient. The test sample was loaded by an automatic sampler, and then gradient separated by the chromatographic column. The flow rate of the Trypsin-digested sample and the Glu-C-digested sample was 0.25 mL / min, and the flow rate of the Chymotrypsin-digested sample was 0.3 mL / min. The detection wavelength was 214 nm, the column temperature was 60 °C, and the injection volume was 25 μL. The relevant liquid phase gradient is shown in Table 11.

[0303] Mass spectrometry parameters: The test sample was analyzed by mass spectrometry using a Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography-mass spectrometry instrument.

[0304] Processing parameters: Analyzed by Biopharma Finder software, the method processing type was Peptide Mapping Analysis. The parameter processing is shown in Table 12.

[0305] The results showed that after digestion with Trypsin, Chymotrypsin, and Glu-C respectively, combining the results of the three enzymatic digestions, by comparing the first-order mass spectrometry and second-order mass spectrometry data of the measured peptide segments with the theoretical peptide segment information, the amino acid sequences of the enzymatically digested peptide segments of the sample were all detected and were consistent with the theoretical sequences. The amino acid sequence coverage rate of the purified botulinum toxin type A protein of the present invention was 100% ( Figures 29 - 31 ).

[0306] Comparative Example 1

[0307] The steps of recombinant host cell construction, fermentation culture, and purification were the same as those in Examples 1-3.

[0308] This comparative example used an intracellular soluble expression strategy to construct PET series vectors, PQE series vectors, and PSF vectors, cloned them into the series vectors, transformed them into different competent cells, detected the protein expression, and screened out the optimal vector-cell combination. That is, pET-28a-bonta, and the cells were BL21(DE3), BL21 Star(DE3), T7express, Tuner(DE3)( Figures 32 - 34 ).

[0309] Comparison of the sequences in Comparative Example 2

[0310] (1) Detection of the expression of BoNT / A with different optimized sequences / tags

[0311] A total of 9 different optimized sequences encoding BoNT / A (the nucleotide sequences of sequences 1-9 are shown in SEQ ID NO:120-128) were compared with the nucleotide sequence of SEQ ID NO:3 of the present invention, denoted as sequence 10.

[0312] They were inserted into the pET-28a vector and protein induction expression was carried out in the E. coli BL21(DE3) host cell. The SDS-PAGE results of the soluble expression of the protein are as Figure 35 and Figure 36 shown. The results showed that the recombinant bacteria containing the plasmid of sequence 10 could efficiently express soluble BoNT / A; the recombinant bacteria containing the other 9 plasmids could hardly or rarely express soluble BoNT / A.

[0313] (2) Purification of BoNT / A protein with different optimized sequences / tags

[0314] After the recombinant strains encoding BoNT / A containing 9 different optimized sequences / tags and the optimized BoNT / A sequence of the present invention were cultured in shake flasks and induced to express, purification comparison was carried out. The purification method was as follows:

[0315] They were dispersed and emulsified according to the mass-volume ratio of the bacterial cells to the lysis solution (20 mM Tris-HCl, pH 8.0) of 1:18, broken with a homogenizer, and the supernatant was obtained after centrifugation at 13,000 r / min. Then they were loaded onto an SP column (MaXtar SP HR, Bio-Link, 5 mL), with the same sample loading volume of 100 mL, using SP buffer (20 mM Tris-HCl, pH 8.0) and elution buffer (20 mM Tris-HCl, 1 M NaCl, pH 8.0), and eluted with 10% (volume ratio of SP buffer to elution buffer), 15% and 100% to remove impurities (volume ratio of SP buffer to elution buffer) to obtain the target protein.

[0316] The SDS-PAGE detection results are as follows:

[0317] From Figure 37 It can be seen that the target protein was not obtained by ion exchange chromatography purification of the supernatant protein after homogenization of the host bacteria containing sequences 1 / 2 / 3.

[0318] From Figure 38 It can be seen that the target protein was not obtained by ion exchange chromatography purification of the supernatant protein after homogenization of the host bacteria containing sequence 6 and sequence 4.

[0319] From Figure 40 It can be seen that a large amount of the target protein was obtained by ion exchange chromatography purification of the supernatant protein after homogenization of the host bacteria containing sequence 10; the target protein was not obtained by ion exchange chromatography purification of the supernatant protein after homogenization of the host bacteria containing sequences 5 / 7 / 8 ( Figure 39 and Figure 40 ).

[0320] In summary, the plasmid containing sequence 10 (i.e., SEQ ID NO:3) is the most preferred for expressing BoNT / A.

[0321] The nine sequences are as follows:

[0322] The nucleotide sequence of sequence 1 is shown as SEQ ID NO:120.

[0323] SEQ ID NO:120:

[0324]

[0325] ATCGTGCCGAAAGTTAATTATACCATTTATGATGGTTTCAACCTGCGCAATACCAATCT

[0326] GGCCGCAAATTTTAATGGTCAGAATACCGAAATTAACAACATGAATTTCACCAAACTG

[0327] AAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTGCTGTGCGTGCGTGGTATTATTAC

[0328] CAGTGGTGGCGGTAGTGGCGGCGGTGAAAATCTGTATTTTCAGGGTGGTGGTAGTGGC

[0329] GGTGGCGCCCTGAATGATCTGTGTATTAAAGTTAATAACTGGGATCTGTTCTTCAGTCC

[0330] GAGCGAAGATAATTTCACCAATGATCTGAATAAGGGTGAAGAAATTACCAGCGATACC

[0331] AATATTGAAGCCGCCGAAGAAAATATTAGCCTGGATCTGATTCAGCAGTATTATCTGA

[0332] CCTTTAATTTCGATAACGAGCCGGAAAATATTAGTATTGAAAATCTGAGTAGCGACATT

[0333] ATTGGTCAGCTGGAACTGATGCCGAATATTGAACGTTTTCCGAATGGCAAAAAATATG

[0334] AACTGGATAAATACACCATGTTCCATTATCTGCGTGCACAGGAATTTGAACATGGCAA

[0335] AAGTCGTATTGCACTGACCAATAGTGTGAATGAAGCACTGCTGAAACCGAGCCGTGTG

[0336] TATACCTTTTTTAGCAGTGATTATGTGAAGAAAGTGAATAAAGCAACCGAAGCCGCAA

[0337] TGTTTCTGGGCTGGGTGGAACAGCTGGTTTATGATTTTACCGATGAAACCAGCGAAGTT

[0338] AGCACCACCGATAAAATTGCAGATATTACCATTATCATCCCGTATATTGGTCCGGCCCT

[0339] GAATATTGGTAATATGCTGTATAAAGACGACTTTGTGGGTGCCCTGATTTTTAGCGGTG

[0340] CAGTTATTCTGCTGGAATTTATTCCGGAAATTGCAATTCCGAAACTGGGTACCTTTGCC

[0341] CTGGTTAGTTATAAAGCCAATAAAGTTCTGACCGTGCAGACCATTGATAATGCACTGA

[0342] GTAAACGCAATGAAAAATGGGATGAAGTTTATAAATACATCGTGACCAATTGGCTGGC

[0343] CAAAGTTAATACCCAGATTGATCTGATTCGCAAAAAAATGAAAGAGGCCCTGGAAAAT

[0344] CAGGCCGAAGCCACCAAAGCCATTATTAATTATCAGTATAACCAGTACAAGGAGAAAG

[0345] AAAAAAACAATATCAACTTCAACATCGACGATCTGAGCAGCAAACTGAATGAAAGCAT

[0346] TAATAAAGCAATGATCAACATCAACAAGTTCCTGAATCAGTGTAGCGTTAGCTATCTG

[0347] ATGAATAGCATGATTCCGTATGGTGTTAAACGCCTGGAAGATTTTGATGCAAGCCTGA

[0348] AAGATGCCCTGCTGAAATATATTTATGATAATCGTGGCACCCTGATTGGTCAGGTTGAT

[0349] CGCCTGAAAGATAAAGTGAATAATACCCTGAGCACCGATATTCCGTTTCAGCTGAGCA

[0350] AATATGTTGATAATCAGCGTCTGCTGAGCACCTTTACCGAATATATTAAAAATATCATC

[0351] AACACCAGCATCCTGAATCTGCGTTATGAAAGTAATCATCTGATTGATCTGAGTCGCTA

[0352] TGCCAGTAAAATTAATATTGGCAGTAAGGTTAACTTCGATCCGATTGATAAAAATCAG

[0353] ATTCAGCTGTTTAACCTGGAAAGCAGCAAAATTGAAGTTATTCTGAAAAACGCCATCG

[0354] TGTATAATAGCATGTATGAAAATTTCAGCACCAGCTTTTGGATTCGTATTCCGAAATAT

[0355] TTTAACAGCATCAGTCTGAATAACGAATATACCATTATCAACTGCATGGAAAATAACA

[0356] GCGGCTGGAAAGTTAGCCTGAATTATGGCGAAATTATTTGGACCCTGCAGGATACCCA

[0357] GGAAATTAAACAGCGCGTGGTTTTTAAATATAGTCAGATGATTAACATCAGCGATTAT

[0358] ATTAACCGTTGGATTTTTGTTACCATCACCAATAATCGTCTGAATAATAGTAAGATCTA

[0359] CATCAATGGCCGCCTGATTGATCAGAAACCGATTAGCAATCTGGGTAATATTCATGCA

[0360] AGCAATAATATTATGTTCAAGCTGGATGGCTGTCGCGATACCCATCGCTATATTTGGAT

[0361] TAAATATTTCAACCTGTTCGACAAAGAGCTGAATGAAAAAGAAATTAAGGACCTGTAT

[0362] GACAATCAGAGCAATAGCGGCATTCTGAAAGATTTTTGGGGCGATTATCTGCAGTATG

[0363] ATAAACCGTATTATATGCTGAATCTGTATGATCCGAATAAATATGTTGACGTTAACAAT

[0364] GTTGGCATTCGTGGTTATATGTATCTGAAAGGTCCGCGCGGCAGTGTTATGACCACCAA

[0365] TATTTATCTGAATAGTAGTCTGTACCGCGGTACCAAATTTATTATTAAAAAGTACGCCA

[0366] GCGGTAATAAAGATAATATTGTGCGTAATAACGACCGCGTTTATATTAATGTTGTGGTT

[0367] AAAAACAAGGAGTACCGTCTGGCAACCAATGCAAGTCAGGCCGGTGTGGAAAAAATT

[0368] CTGAGCGCCCTGGAAATTCCGGATGTTGGCAATCTGAGCCAGGTTGTGGTGATGAAAA

[0369] GCAAAAATGATCAGGGTATTACCAATAAATGCAAAATGAATCTGCAGGATAACAATGG

[0370] CAATGATATTGGCTTTATTGGTTTTCATCAGTTTAACAATATCGCCAAACTGGTGGCAA

[0371] GTAATTGGTATAATCGCCAGATTGAACGTAGCAGTCGTACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGATGATGGCTGGGGTGAACGTCCGCTGtga。

[0372] The nucleotide sequence of Sequence 2 is shown in SEQ ID NO:121.

[0373] SEQ ID NO:121:

[0374]

[0375] CCGAAGATAATTTTGTGAAGTTCTTCAAAGTGCTGAATCGTAAAACCTATCTGAATTTT

[0376] GATAAGGCAGTGTTTAAGATTAACATCGTGCCGAAAGTTAATTATACCATTTATGATGG

[0377] TTTCAACCTGCGCAATACCAATCTGGCCGCAAATTTTAATGGTCAGAATACCGAAATTA

[0378] ACAACATGAATTTCACCAAACTGAAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTG

[0379] CTGTGCGTGCGTGGTATTATTACCAGTGGTGGCGGTAGTGGCGGCGGTGAAAATCTGT

[0380] ATTTTCAGGGTGGTGGTAGTGGCGGTGGCGCCCTGAATGATCTGTGTATTAAAGTTAAT

[0381] AACTGGGATCTGTTCTTCAGTCCGAGCGAAGATAATTTCACCAATGATCTGAATAAGG

[0382] GTGAAGAAATTACCAGCGATACCAATATTGAAGCCGCCGAAGAAAATATTAGCCTGGA

[0383] TCTGATTCAGCAGTATTATCTGACCTTTAATTTCGATAACGAGCCGGAAAATATTAGTA

[0384] TTGAAAATCTGAGTAGCGACATTATTGGTCAGCTGGAACTGATGCCGAATATTGAACG

[0385] TTTTCCGAATGGCAAAAAATATGAACTGGATAAATACACCATGTTCCATTATCTGCGTG

[0386] CACAGGAATTTGAACATGGCAAAAGTCGTATTGCACTGACCAATAGTGTGAATGAAGC

[0387] ACTGCTGAAACCGAGCCGTGTGTATACCTTTTTTAGCAGTGATTATGTGAAGAAAGTGA

[0388] ATAAAGCAACCGAAGCCGCAATGTTTCTGGGCTGGGTGGAACAGCTGGTTTATGATTT

[0389] TACCGATGAAACCAGCGAAGTTAGCACCACCGATAAAATTGCAGATATTACCATTATC

[0390] ATCCCGTATATTGGTCCGGCCCTGAATATTGGTAATATGCTGTATAAAGACGACTTTGT

[0391] GGGTGCCCTGATTTTTAGCGGTGCAGTTATTCTGCTGGAATTTATTCCGGAAATTGCAA

[0392] TTCCGAAACTGGGTACCTTTGCCCTGGTTAGTTATAAAGCCAATAAAGTTCTGACCGTG

[0393] CAGACCATTGATAATGCACTGAGTAAACGCAATGAAAAATGGGATGAAGTTTATAAAT

[0394] ACATCGTGACCAATTGGCTGGCCAAAGTTAATACCCAGATTGATCTGATTCGCAAAAA

[0395] AATGAAAGAGGCCCTGGAAAATCAGGCCGAAGCCACCAAAGCCATTATTAATTATCAG

[0396] TATAACCAGTACAAGGAGAAAGAAAAAAACAATATCAACTTCAACATCGACGATCTG

[0397] AGCAGCAAACTGAATGAAAGCATTAATAAAGCAATGATCAACATCAACAAGTTCCTGA

[0398] ATCAGTGTAGCGTTAGCTATCTGATGAATAGCATGATTCCGTATGGTGTTAAACGCCTG

[0399] GAAGATTTTGATGCAAGCCTGAAAGATGCCCTGCTGAAATATATTTATGATAATCGTG

[0400] GCACCCTGATTGGTCAGGTTGATCGCCTGAAAGATAAAGTGAATAATACCCTGAGCAC

[0401] CGATATTCCGTTTCAGCTGAGCAAATATGTTGATAATCAGCGTCTGCTGAGCACCTTTA

[0402] CCGAATATATTAAAAATATCATCAACACCAGCATCCTGAATCTGCGTTATGAAAGTAA

[0403] TCATCTGATTGATCTGAGTCGCTATGCCAGTAAAATTAATATTGGCAGTAAGGTTAACT

[0404] TCGATCCGATTGATAAAAATCAGATTCAGCTGTTTAACCTGGAAAGCAGCAAAATTGA

[0405] AGTTATTCTGAAAAACGCCATCGTGTATAATAGCATGTATGAAAATTTCAGCACCAGCT

[0406] TTTGGATTCGTATTCCGAAATATTTTAACAGCATCAGTCTGAATAACGAATATACCATT

[0407] ATCAACTGCATGGAAAATAACAGCGGCTGGAAAGTTAGCCTGAATTATGGCGAAATTA

[0408] TTTGGACCCTGCAGGATACCCAGGAAATTAAACAGCGCGTGGTTTTTAAATATAGTCA

[0409] GATGATTAACATCAGCGATTATATTAACCGTTGGATTTTTGTTACCATCACCAATAATC

[0410] GTCTGAATAATAGTAAGATCTACATCAATGGCCGCCTGATTGATCAGAAACCGATTAG

[0411] CAATCTGGGTAATATTCATGCAAGCAATAATATTATGTTCAAGCTGGATGGCTGTCGCG

[0412] ATACCCATCGCTATATTTGGATTAAATATTTCAACCTGTTCGACAAAGAGCTGAATGAA

[0413] AAAGAAATTAAGGACCTGTATGACAATCAGAGCAATAGCGGCATTCTGAAAGATTTTT

[0414] GGGGCGATTATCTGCAGTATGATAAACCGTATTATATGCTGAATCTGTATGATCCGAAT

[0415] AAATATGTTGACGTTAACAATGTTGGCATTCGTGGTTATATGTATCTGAAAGGTCCGCG

[0416] CGGCAGTGTTATGACCACCAATATTTATCTGAATAGTAGTCTGTACCGCGGTACCAAAT

[0417] TTATTATTAAAAAGTACGCCAGCGGTAATAAAGATAATATTGTGCGTAATAACGACCG

[0418] CGTTTATATTAATGTTGTGGTTAAAAACAAGGAGTACCGTCTGGCAACCAATGCAAGT

[0419] CAGGCCGGTGTGGAAAAAATTCTGAGCGCCCTGGAAATTCCGGATGTTGGCAATCTGA

[0420] GCCAGGTTGTGGTGATGAAAAGCAAAAATGATCAGGGTATTACCAATAAATGCAAAAT

[0421] GAATCTGCAGGATAACAATGGCAATGATATTGGCTTTATTGGTTTTCATCAGTTTAACA

[0422] ATATCGCCAAACTGGTGGCAAGTAATTGGTATAATCGCCAGATTGAACGTAGCAGTCG

[0423] TACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGATGATGGCTGGGGTGAACGTCCGCTGGAAAACCTGTATTTCCAGGGCcatcatcatcatcatcactga。

[0424] The nucleotide sequence of Sequence 3 is shown in SEQ ID NO: 122.

[0425] SEQ ID NO: 122:

[0426] ATGcatcatcatcatcatcacGAAAACCTGTATTTCCAGGGCATGCCGTTTGTTAATAAGCAGTTTAACTATAAGGACCCGGTGAATGGCGTTGATATTGCATATATTAAAATCCCGAACGCCGGCCAGATGCAGCCGGTTAAAGCATTTAAAATTCATAATAAGATCTGGGTGATCCCGGAACGCGATACCTTTACCAATCCGGAAGAAGGCGATCTGAATCCGCCGCCGGAAGCAAAACAGGTTCCGGTGAGTTATTATGATAGTACCTATCTGAGTACCGATAATGAAAAAGATAACTATCTGAAGGGTGTTACCAAACTGTTTGAACGCATTTATAGTACCGATCTGGGTCGTATGCTGCTGACCAGTATTGTTCGCGGCATTCCGTTTTGGGGCGGCAGCACCATTGATACCGAACTGAAAGTGATTGATACCAATTGTATTAACGTGATTCAGCCGGATGGTAGCTATCGCAGTGAAGAACTGAATCTGGTGATTATTGGCCCGAGCGCAGATATTATTCAGTTTGAATGCAAAAGTTTCGGCCATGAAGTGCTGAATCTGACCCGTAATGGTTATGGCAGCACCCAGTATATTCGTTTTAGTCCGGATTTTACCTTTGGTTTTGAAGAAAGTCTGGAAGTTGATACCAATCCGCTGCTGGGTGCAGGTAAATTTGCCACCGATCCGGCCGTGACCCTGGCCCATGAACTGATTCATGCCGGTCATCGCCTGTATGGCATTGCCATTAATCCGAATCGTGTGTTTAAAGTGAATACCAATGCCTATTATGAGATGAGTGGCCTGGAAGTGAGTTTTGAAGAACTGCGCACCTTTGGCGGTCATGATGCAAAATTTATTGATAGCCTGCAGGAAAATGAATTTCGCCTGTATTATTATAACAAGTTCAAGGATATCGCGAGTACCCTGAATAAAG

[0427] CCAAAAGCATTGTTGGCACCACCGCCAGCCTGCAGTATATGAAAAATGTGTTTAAAGA

[0428] GAAGTACCTGCTGAGCGAAGATACCAGTGGTAAATTTAGCGTGGATAAACTGAAATTT

[0429] GACAAACTGTATAAGATGCTGACCGAAATTTATACCGAAGATAATTTTGTGAAGTTCTT

[0430] CAAAGTGCTGAATCGTAAAACCTATCTGAATTTTGATAAGGCAGTGTTTAAGATTAAC

[0431] ATCGTGCCGAAAGTTAATTATACCATTTATGATGGTTTCAACCTGCGCAATACCAATCT

[0432] GGCCGCAAATTTTAATGGTCAGAATACCGAAATTAACAACATGAATTTCACCAAACTG

[0433] AAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTGCTGTGCGTGCGTGGTATTATTAC

[0434] CAGTAAGGGTGGCGGTAGTGGCGGCGGTGAAAATCTGTATTTTCAGGGTGGTGGTAGT

[0435] GGCGGTGGCGCCCTGAATGATCTGTGTATTAAAGTTAATAACTGCGATCTGTTCTTCAG

[0436] TCCGAGCGAAGATAATTTCACCAATGATCTGAATAAGGGTGAAGAAATTACCAGCGAT

[0437] ACCAATATTGAAGCCGCCGAAGAAAATATTAGCCTGGATCTGATTCAGCAGTATTATC

[0438] TGACCTTTAATTTCGATAACGAGCCGGAAAATATTAGTATTGAAAATCTGAGTAGCGA

[0439] CATTATTGGTCAGCTGGAACTGATGCCGAATATTGAACGTTTTCCGAATGGCAAAAAA

[0440] TATGAACTGGATAAATACACCATGAGTGTGAATGAAGCACTGCTGAATCCGAGCCGTG

[0441] TGTATACCTTTTTTAGCAGTGATTATGTGAAGAAAGTGAATAAAGCAACCGAAGCCGC

[0442] AATGTTTCTGGGCGGTTGGAATCAGCTGGTTTATGATTTTACCGATGAAACCAGCGAAG

[0443] TTAGCACCACCGATAAAATTGCAGATATTACCATTATCATCCCGTATATTGGTCCGGCC

[0444] CTGAATATTGGTAATATGCTGTATAAAGACGACTTTGTGGGTGCCCTGATTTTTAGCGG

[0445] TGCAGTTATTCTGCTGGAATTTATTCCGGAAATTGCAATTCCGGTTCTGGGTACCTTTGC

[0446] CCTGGTTAGTTATATTGCCAATAAAGTTCTGACCGTGCAGACCATTGATAATGCACTGA

[0447] GTAAACGCAATGAAAAATGGGATGAAGTTTATAAATACATCGTGACCAATTGGCTGGC

[0448] CAAAGTTAATACCCAGATTGATCTGATTCGCAAAAAAATGAAAGAGGCCCTGGAAAAT

[0449] CAGGCCGAAGCCACCAAAGCCATTATTAATTATCAGTATAACCAGTACACCGAGGAAG

[0450] AAAAAAACAATATCAACTTCAACATCGACGATCTGAGCAGCAAACTGAATGAAAGCAT

[0451] TAATAAAGCAATGATCAACATCAACAAGTTCCTGAATCAGTGTAGCGTTAGCTATCTG

[0452] ATGAATAGCATGATTCCGTATGGTGTTAAACGCCTGGAAGATTTTGATGCAAGCCTGA

[0453] AAGATGCCCTGCTGAAATATATTTATGATAATCGTGGCACCCTGATTGGTCAGGTTGAT

[0454] CGCCTGAAAGATAAAGTGAATAATACCCTGAGCACCGATATTCCGTTTCAGCTGAGCA

[0455] AATATGTTGATAATCAGCGTCTGCTGAGCACCTTTACCGAATATATTGGCCCTCTGGGC

[0456] CTGTGGGCCCAGCTGAATCTGGTTCCGCGTGGTAGTTATGAAAGCAATCATCTGATTGA

[0457] TCTGGTGCCGCGCGGCAGTCGCTATGCCAGTAAAATTAATATTGGCAGTAAGGTTAAC

[0458] TTCGATCCGATTGATAAAAATCAGATTCAGCTGTTTAACCTGGAAAGCAGCAAAATTG

[0459] AAGTTATTCTGAAAAACGCCATCGTGTATAATAGCATGTATGAAAATTTCAGCACCAG

[0460] CTTTTGGATTCGTATTCCGAAATATTTTAACAGCATCAGTCTGAATAACGAATATACCA

[0461] TTATCAACTGCATGGCCAATAACAGCGCCTGGAAAGTTAGCCTGAATTATGGCGAAAT

[0462] TATTTGGACCCTGCAGGATACCCAGGAAATTAAACAGCGCGTGGTTTTTAAATATAGTC

[0463] AGATGATTAACATCAGCGATTATATTAACCGTTGGATTTTTGTTACCATCACCAATAAT

[0464] CGTCTGAATAATAGTAAGATCTACATCAATGGCCGCCTGATTGATCAGAAACCGATTA

[0465] GCAATCTGGGTAATATTCATGCAAGCAATAATATTATGTTCAAGCTGGATGGCTGTCGC

[0466] GATACCCATCGCTATATTTGGATTAAATATTTCAACCTGTTCGACAAAGAGCTGAATGA

[0467] AAAAGAAATTAAGGACCTGTATGACAATCAGAGCAATAGCGGCATTCTGAAAGATTTT

[0468] TGGGGCGATTATCTGCAGTATGATAAACCGTATTATATGCTGAATCTGTATGATCCGAA

[0469] TAAATATGTTGACGTTAACAATGTTGGCATTCGTGGTTATATGTATCTGAAAGGTCCGC

[0470] GCGGCAGTGTTATGACCACCAATATTTATCTGAATAGTAGTCTGTACCGCGGTACCAAA

[0471] TTTATTATTAAAAAGTACGCCAGCGGTAATAAAGATAATATTGTGCGTAATAACGACC

[0472] GCGTTTATATTAATGTTGTGGTTAAAAACAAGGAGTACCGTCTGGCAACCAATGCAAG

[0473] TCAGGCCGGTGTGGAAAAAATTCTGAGCGCCCTGGAAATTCCGGATGTTGGCAATCTG

[0474] AGCCAGGTTGTGGTGATGAAAAGCAAAAATGATCAGGGTATTACCAATAAATGCAAA

[0475] ATGAATCTGCAGGATAACAATGGCAATGATATTGGCTTTATTGGTTTTCATCAGTTTAA

[0476] CAATATCGCCAAACTGGTGGCAAGTAATTGGTATAATCGCCAGATTGAACGTAGCAGT

[0477] CGTACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGATGATGGCTGGGGTGAACGTCCGCTGtga。

[0478] The nucleotide sequence of Sequence 4 is shown in SEQ ID NO: 123.

[0479] SEQ ID NO: 123:

[0480] ATGCCGTTTGTTAATAAGCAGTTTAACTATAAGGACCCGGTGAATGGCGTTGATATTGCATATATTAAAATCCCGAACGCCGGCCAGATGCAGCCGGTTAAAGCATTTAAAATTCATAATAAGATCTGGGTGATCCCGGAACGCGATACCTTTACCAATCCGGAAGAAGGCGATCTGAATCCGCCGCCGGAAGCAAAACAGGTTCCGGTGAGTTATTATGATAGTACCTATCTGAGTACCGATAATGAAAAAGATAACTATCTGAAGGGTGTTACCAAACTGTTTGAACGCATTTATAGTACCGATCTGGGTCGTATGCTGCTGACCAGTATTGTTCGCGGCATTCCGTTTTGGGGCGGCAGCACCATTGATACCGAACTGAAAGTGATTGATACCAATTGTATTAACGTGATTCAGCCGGATGGTAGCTATCGCAGTGAAGAACTGAATCTGGTGATTATTGGCCCGAGCGCAGATATTATTCAGTTTGAATGCAAAAGTTTCGGCCATGAAGTGCTGAATCTGACCCGTAATGGTTATGGCAGCACCCAGTATATTCGTTTTAGTCCGGATTTTACCTTTGGTTTTGAAGAAAGTCTGGAAGTTGATACCAATCCGCTGCTGGGTGCAGGTAAATTTGCCACCGATCCGGCCGTGACCCTGGCCCATGAACTGATTCATGCCGGTCATCGCCTGTATGGCATTGCCATTAATCCGAATCGTGTGTTTAAAGTGAATACCAATGCCTATTATGAGATGAGTGGCCTGGAAGTGAGTTTTGAAGAACTGCGCACCTTTGGCGGTCATGATGCAAA

[0481] ATTTATTGATAGCCTGCAGGAAAATGAATTTCGCCTGTATTATTATAACAAGTTCAAGG

[0482] ATATCGCGAGTACCCTGAATAAAGCCAAAAGCATTGTTGGCACCACCGCCAGCCTGCA

[0483] GTATATGAAAAATGTGTTTAAAGAGAAGTACCTGCTGAGCGAAGATACCAGTGGTAAA

[0484] TTTAGCGTGGATAAACTGAAATTTGACAAACTGTATAAGATGCTGACCGAAATTTATA

[0485] CCGAAGATAATTTTGTGAAGTTCTTCAAAGTGCTGAATCGTAAAACCTATCTGAATTTT

[0486] GATAAGGCAGTGTTTAAGATTAACATCGTGCCGAAAGTTAATTATACCATTTATGATGG

[0487] TTTCAACCTGCGCAATACCAATCTGGCCGCAAATTTTAATGGTCAGAATACCGAAATTA

[0488] ACAACATGAATTTCACCAAACTGAAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTG

[0489] CTGTGCGTGCGTGGTATTATTACCAGTAAGGGTGGCGGTAGTGGCGGCGGTGAAAATC

[0490] TGTATTTTCAGGGTGGTGGTAGTGGCGGTGGCGCCCTGAATGATCTGTGTATTAAAGTT

[0491] AATAACTGCGATCTGTTCTTCAGTCCGAGCGAAGATAATTTCACCAATGATCTGAATAA

[0492] GGGTGAAGAAATTACCAGCGATACCAATATTGAAGCCGCCGAAGAAAATATTAGCCTG

[0493] GATCTGATTCAGCAGTATTATCTGACCTTTAATTTCGATAACGAGCCGGAAAATATTAG

[0494] TATTGAAAATCTGAGTAGCGACATTATTGGTCAGCTGGAACTGATGCCGAATATTGAA

[0495] CGTTTTCCGAATGGCAAAAAATATGAACTGGATAAATACACCATGAGTGTGAATGAAG

[0496] CACTGCTGAATCCGAGCCGTGTGTATACCTTTTTTAGCAGTGATTATGTGAAGAAAGTG

[0497] AATAAAGCAACCGAAGCCGCAATGTTTCTGGGCGGTTGGAATCAGCTGGTTTATGATT

[0498] TTACCGATGAAACCAGCGAAGTTAGCACCACCGATAAAATTGCAGATATTACCATTAT

[0499] CATCCCGTATATTGGTCCGGCCCTGAATATTGGTAATATGCTGTATAAAGACGACTTTG

[0500] TGGGTGCCCTGATTTTTAGCGGTGCAGTTATTCTGCTGGAATTTATTCCGGAAATTGCA

[0501] ATTCCGGTTCTGGGTACCTTTGCCCTGGTTAGTTATATTGCCAATAAAGTTCTGACCGT

[0502] GCAGACCATTGATAATGCACTGAGTAAACGCAATGAAAAATGGGATGAAGTTTATAAA

[0503] TACATCGTGACCAATTGGCTGGCCAAAGTTAATACCCAGATTGATCTGATTCGCAAAA

[0504] AAATGAAAGAGGCCCTGGAAAATCAGGCCGAAGCCACCAAAGCCATTATTAATTATCA

[0505] GTATAACCAGTACACCGAGGAAGAAAAAAACAATATCAACTTCAACATCGACGATCTG

[0506] AGCAGCAAACTGAATGAAAGCATTAATAAAGCAATGATCAACATCAACAAGTTCCTGA

[0507] ATCAGTGTAGCGTTAGCTATCTGATGAATAGCATGATTCCGTATGGTGTTAAACGCCTG

[0508] GAAGATTTTGATGCAAGCCTGAAAGATGCCCTGCTGAAATATATTTATGATAATCGTG

[0509] GCACCCTGATTGGTCAGGTTGATCGCCTGAAAGATAAAGTGAATAATACCCTGAGCAC

[0510] CGATATTCCGTTTCAGCTGAGCAAATATGTTGATAATCAGCGTCTGCTGAGCACCTTTA

[0511] CCGAATATATTGGCCCTCTGGGCCTGTGGGCCCAGCTGAATCTGGTTCCGCGTGGTAGT

[0512] TATGAAAGCAATCATCTGATTGATCTGGTGCCGCGCGGCAGTCGCTATGCCAGTAAAA

[0513] TTAATATTGGCAGTAAGGTTAACTTCGATCCGATTGATAAAAATCAGATTCAGCTGTTT

[0514] AACCTGGAAAGCAGCAAAATTGAAGTTATTCTGAAAAACGCCATCGTGTATAATAGCA

[0515] TGTATGAAAATTTCAGCACCAGCTTTTGGATTCGTATTCCGAAATATTTTAACAGCATC

[0516] AGTCTGAATAACGAATATACCATTATCAACTGCATGGCCAATAACAGCGCCTGGAAAG

[0517] TTAGCCTGAATTATGGCGAAATTATTTGGACCCTGCAGGATACCCAGGAAATTAAACA

[0518] GCGCGTGGTTTTTAAATATAGTCAGATGATTAACATCAGCGATTATATTAACCGTTGGA

[0519] TTTTTGTTACCATCACCAATAATCGTCTGAATAATAGTAAGATCTACATCAATGGCCGC

[0520] CTGATTGATCAGAAACCGATTAGCAATCTGGGTAATATTCATGCAAGCAATAATATTAT

[0521] GTTCAAGCTGGATGGCTGTCGCGATACCCATCGCTATATTTGGATTAAATATTTCAACC

[0522] TGTTCGACAAAGAGCTGAATGAAAAAGAAATTAAGGACCTGTATGACAATCAGAGCA

[0523] ATAGCGGCATTCTGAAAGATTTTTGGGGCGATTATCTGCAGTATGATAAACCGTATTAT

[0524] ATGCTGAATCTGTATGATCCGAATAAATATGTTGACGTTAACAATGTTGGCATTCGTGG

[0525] TTATATGTATCTGAAAGGTCCGCGCGGCAGTGTTATGACCACCAATATTTATCTGAATA

[0526] GTAGTCTGTACCGCGGTACCAAATTTATTATTAAAAAGTACGCCAGCGGTAATAAAGA

[0527] TAATATTGTGCGTAATAACGACCGCGTTTATATTAATGTTGTGGTTAAAAACAAGGAGT

[0528] ACCGTCTGGCAACCAATGCAAGTCAGGCCGGTGTGGAAAAAATTCTGAGCGCCCTGGA

[0529] AATTCCGGATGTTGGCAATCTGAGCCAGGTTGTGGTGATGAAAAGCAAAAATGATCAG

[0530] GGTATTACCAATAAATGCAAAATGAATCTGCAGGATAACAATGGCAATGATATTGGCT

[0531] TTATTGGTTTTCATCAGTTTAACAATATCGCCAAACTGGTGGCAAGTAATTGGTATAAT

[0532] CGCCAGATTGAACGTAGCAGTCGTACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGA

[0533] TGATGGCTGGGGTGAACGTCCGCTGGAAAACCTGTATTTCCAGGGCcatcatcatcatcatcactga。

[0534] The nucleotide sequence of Sequence 5 is shown in SEQ ID NO:124.

[0535] SEQ ID NO:124:

[0536] ATGcatcatcatcatcatcacGAAAACCTGTATTTCCAGGGCATGCCGTTTGTTAATAAGCAGTTTAACTATAAGGACCCGGTGAATGGCGTTGATATTGCATATATTAAAATCCCGAACGCCGGCCAGATGCAGCCGGTTAAAGCATTTAAAATTCATAATAAGATCTGGGTGATCCCGGAACGCGATACCTTTACCAATCCGGAAGAAGGCGATCTGAATCCGCCGCCGGAAGCAAAACAGGTTCCGGTGAGTTATTATGATAGTACCTATCTGAGTACCAATAATGAAAAAGATAACTATCTGAAGGGTGTTACCAAACTGTTTGAACGCATTTATAGTACCCCGCTGGGTCGTATGCTGCTGACCAGTATTGTTCGCGGCATTCCGTTTTGGGGCGGCAGCACCATTGATACCGAACTGAAAGTGATTGATACCAATTGTATTAACGTGATTCAGCCGGATGGTAGCTATCGCAGTGAAGAACTGAATCTGGTGATTATTGGCCCGAGCGCAGATATTATTCAGTTTGAATGCAAAAGTTTCGGCCATGAAGTGCTGAATCTGACCCGTAATGGTTATGGCAGCACCCAGTATATTCGTTTTAGTCCGGATTTTACCTTTGGTTTTGAAGAAAGTCTGGAAGTTAATACCAATCCGCTGCTGGGTGCAGGTGAATTTGCCACCGATCCGGCCGTGACCCTGG

[0537] CCCATGAACTGATTCATGCCGGTCATCGCCTGTATGGCATTGCCATTAATCCGAATCGT

[0538] GTGTTTAAAGTGAATACCAATGCCTATTATGAGATGAGTGGCCTGGAAGTGAGTTTTG

[0539] AAGAACTGCGCACCTTTGGCGGTCATGATGCAAAATTTATTGATAGCCTGCAGGAAAA

[0540] TGAATTTCGCCTGTATTATTATAACAAGTTCAAGGATATCGCGAGTACCCTGAATAAAG

[0541] CCAATAGCATTGTTGGCACCACCGCCAGCCTGCAGTATATGAAAAATGTGTTTAAAGA

[0542] GAAGTACCTGCTGAGCGAAGATACCAGTGGTAATTTTAGCGTGGATAATCTGAAATTT

[0543] GACAAACTGTATAAGATGCTGACCGAAATTTATACCGAAGATAATTTTGTGAAGTTCTT

[0544] CAAAGTGCTGAATCGTAAAACCTATCTGAATTTTGATAAGGCAGTGTTTAAGATTAAC

[0545] ATCGTGCCGAAAGTTAATTATACCATTTATGATGGTTTCAACCTGCGCAATACCAATCT

[0546] GGCCGCAAATTTTAATGGTCAGAATACCGAAATTAACAACATGAATTTCACCAAACTG

[0547] AAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTGCTGTGCGTGCGTGGTATTATTAC

[0548] CAGTGGTGGCGGTAGTGGCGGCGGTGAAAATCTGTATTTTCAGGGTGGTGGTAGTGGC

[0549] GGTGGCGCCCTGAATGATCTGTGTATTAAAGTTAATAACTGCGATCTGTTCTTCAGTCC

[0550] GAGCGAAGATAATTTCACCAATGATCTGAATAAGGGTGAAGAAATTACCAGCGATACC

[0551] AATATTGAAGCCGCCGAAGAAAATATTAGCCTGGATCTGATTCAGCAGTATTATCTGA

[0552] CCTTTAATTTCGATAACGAGCCGGAAAATATTAGTATTGAAAATCTGAGTAGCGACATT

[0553] ATTGGTCAGCTGGAACTGATGCCGAATATTGAACGTTTTCCGAATGGCAAAAAATATG

[0554] AACTGGATAAATACACCATGAGTGTGAATGAAGCACTGCTGAATCCGAGCCGTGTGTA

[0555] TACCTTTTTTAGCAGTGATTATGTGAATAAAGTGAATAAAGCAACCGAAGCCGCAATG

[0556] TTTCTGGGCGGTTGGAATCAGCTGGTTTATGATTTTACCGATGAAACCAGCGAAGTTAG

[0557] CACCACCGATAAAATTGCAGATATTACCATTATCATCCCGTATATTGGTCCGGCCCTGA

[0558] ATATTGGTAATATGCTGTATAAAGACGACTTTGTGGGTGCCCTGATTTTTAGCGGTGCA

[0559] GTTATTCTGCTGGAATTTATTCCGGAAATTGCAATTCCGGTTCTGGGTACCTTTGCCCTG

[0560] GTTAGTTATATTGCCAATAAAGTTCTGACCGTGCAGACCATTGATAATGCACTGAGTCA

[0561] GCGCAATGAAAAATGGGATGAAGTTTATAAATACATCGTGACCAATTGGCTGGCCAAA

[0562] GTTAATACCCAGATTGATCTGATTCGCAAAAAAATGAAAGAGGCCCTGGAAAATCAGG

[0563] CCGAAGCCACCAAAGCCATTATTAATTATCAGTATAACCAGTACACCGAGGAAGAAAA

[0564] AAACAATATCAACTTCAACATCGACGATCTGAGCAGCAAACTGAATGAAAGCATTAAT

[0565] AAAGCAATGATCAACATCAACAAGTTCCTGAATCAGTGTAGCGTTAGCTATCTGATGA

[0566] ATAGCATGATTCCGTATGGTGTTAATCGCCTGGAAGATTTTGATGCAAGCCTGAAAGAT

[0567] GCCCTGCTGAAATATATTTATGATAATCGTGGCACCCTGATTGGTCAGGTTGATCGCCT

[0568] GAAAGATAAAGTGAATAATACCCTGAGCACCAATATTCCGTTTCAGCTGAGCAAATAT

[0569] GTTGATAATCAGCGTCTGCTGAGCACCTTTACCGAATATATTGGCCCTCTGGGCCTGTG

[0570] GGCCCAGCTGAATCTGGTTCCGCGTGGTAGTTATGAAAGCAATCATCTGATTGATCTGG

[0571] TGCCGCGCGGCAGTCGCTATGCCAGTAATATTAATATTGGCAGTGATGTTAACTTCGAT

[0572] CCGATTGATAAAAATCAGATTCAGCTGTTTAACCTGGAAAGCAGCAAAATTGAAGTTA

[0573] TTCTGAAAAACGCCATCGTGTATAATAGCATGTATGAAAATTTCAGCACCAGCTTTTGG

[0574] ATTCGTATTCCGAAATATTTTAACAGCATCAGTCTGAATAACGAATATACCATTATCAA

[0575] CTGCATGGCCAATAACAGCGCCTGGAAAGTTAGCCTGAATTATGGCGAAATTATTTGG

[0576] ACCCTGCAGGATACCCAGGAAATTAAACAGCGCGTGGTTTTTAAATATAGTCAGATGA

[0577] TTAACATCAGCGATTATATTAACCGTTGGATTTTTGTTACCATCACCAATAATCGTCTG

[0578] AATAATAGTAAGATCTACATCAATGGCCGCCTGATTGATCAGAAACCGATTAGCAATC

[0579] TGGGTAATATTCATGCAAGCAATAATATTATGTTCAAGCTGGATGGCTGTCGCGATACC

[0580] CATCGCTATATTTGGATTAAATATTTCAACCTGTTCGACAAAGAGCTGAATGAAAAAG

[0581] AAATTAAGGACCTGTATGACAATCAGAGCAATAGCGGCATTCTGAAAGATTTTTGGGG

[0582] CGATTATCTGCAGTATGATAAACCGTATTATATGCTGAATCTGTATGATCCGAATAAAT

[0583] ATGTTGACGTTAACAATGTTGGCATTCGTGGTTATATGTATCTGGTCCCGCGCGGCAGT

[0584] GTTATGACCACCAATATTTATCTGAATAGTAGTCTGTACCGCGGTACCAAATTTATTAT

[0585] TAAAAAGTACGCCAGCGGTAATAAAGATAATATTGTGCGTAATAACGACCGCGTTTAT

[0586] ATTAATGTTGTGGTTAAAAACAAGGAGTACCGTCTGGCAACCAATGCAAGTCAGGCCG

[0587] GTGTGGAAAAAATTCTGAGCGCCCTGGAAATTCCGGATGTTGGCAATCTGAGCCAGGT

[0588] TGTGGTGATGAAAAGCAAAAATGATCAGGGTATTACCAATAAATGCCAGATGAATCTG

[0589] CAGGATAACAATGGCAATGATATTGGCTTTATTGGTTTTCATCAGTTTAACAATATCGC

[0590] CAAACTGGTGGCAAGTAATTGGTATAATCGCCAGATTGAACGTAGCAGTCGTACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGATGATGGCTGGGGTGAACGTCCGCTGtga。

[0591] The nucleotide sequence of Sequence 6 is shown in SEQ ID NO: 125.

[0592] SEQ ID NO: 125:

[0593] ATGCCGTTTGTTAATAAGCAGTTTAACTATAAGGACCCGGTGAATGGCGTTGATATTGCATATATTAAAATCCCGAACGCCGGCCAGATGCAGCCGGTTAAAGCATTTAAAATTCATAATAAGATCTGGGTGATCCCGGAACGCGATACCTTTACCAATCCGGAAGAAGGCGATCTGAATCCGCCGCCGGAAGCAAAACAGGTTCCGGTGAGTTATTATGATAGTACCTATCTGAGTACCAATAATGAAAAAGATAACTATCTGAAGGGTGTTACCAAACTGTTTGAACGCATTTATAGTACCCCGCTGGGTCGTATGCTGCTGACCAGTATTGTTCGCGGCATTCCGTTTTGGGGCGGCAGCACCATTGATACCGAACTGAAAGTGATTGATACCAATTGTATTAACGTGATTCAGCCGGATGGTAGCTATCGCAGTGAAGAACTGAATCTGGTGATTATTGGCCCGAGCGCAGATATTATTCAGTTTGAATGCAAAAGTTTCGGCCATGAAGTGCTGAATCTGACCCGTAATGGTTATGGCAGCACCCAGTATATTCGTTTTAGTCCGGATTTTACCTTTGGTTTTGAAGAAAGTCTGGAAGTTAATACCAATCCGCTGCTGGGTGCAGGTGAATTT

[0594] GCCACCGATCCGGCCGTGACCCTGGCCCATGAACTGATTCATGCCGGTCATCGCCTGTA

[0595] TGGCATTGCCATTAATCCGAATCGTGTGTTTAAAGTGAATACCAATGCCTATTATGAGA

[0596] TGAGTGGCCTGGAAGTGAGTTTTGAAGAACTGCGCACCTTTGGCGGTCATGATGCAAA

[0597] ATTTATTGATAGCCTGCAGGAAAATGAATTTCGCCTGTATTATTATAACAAGTTCAAGG

[0598] ATATCGCGAGTACCCTGAATAAAGCCAATAGCATTGTTGGCACCACCGCCAGCCTGCA

[0599] GTATATGAAAAATGTGTTTAAAGAGAAGTACCTGCTGAGCGAAGATACCAGTGGTAAT

[0600] TTTAGCGTGGATAATCTGAAATTTGACAAACTGTATAAGATGCTGACCGAAATTTATAC

[0601] CGAAGATAATTTTGTGAAGTTCTTCAAAGTGCTGAATCGTAAAACCTATCTGAATTTTG

[0602] ATAAGGCAGTGTTTAAGATTAACATCGTGCCGAAAGTTAATTATACCATTTATGATGGT

[0603] TTCAACCTGCGCAATACCAATCTGGCCGCAAATTTTAATGGTCAGAATACCGAAATTA

[0604] ACAACATGAATTTCACCAAACTGAAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTG

[0605] CTGTGCGTGCGTGGTATTATTACCAGTGGTGGCGGTAGTGGCGGCGGTGAAAATCTGT

[0606] ATTTTCAGGGTGGTGGTAGTGGCGGTGGCGCCCTGAATGATCTGTGTATTAAAGTTAAT

[0607] AACTGCGATCTGTTCTTCAGTCCGAGCGAAGATAATTTCACCAATGATCTGAATAAGG

[0608] GTGAAGAAATTACCAGCGATACCAATATTGAAGCCGCCGAAGAAAATATTAGCCTGGA

[0609] TCTGATTCAGCAGTATTATCTGACCTTTAATTTCGATAACGAGCCGGAAAATATTAGTA

[0610] TTGAAAATCTGAGTAGCGACATTATTGGTCAGCTGGAACTGATGCCGAATATTGAACG

[0611] TTTTCCGAATGGCAAAAAATATGAACTGGATAAATACACCATGAGTGTGAATGAAGCA

[0612] CTGCTGAATCCGAGCCGTGTGTATACCTTTTTTAGCAGTGATTATGTGAATAAAGTGAA

[0613] TAAAGCAACCGAAGCCGCAATGTTTCTGGGCGGTTGGAATCAGCTGGTTTATGATTTTA

[0614] CCGATGAAACCAGCGAAGTTAGCACCACCGATAAAATTGCAGATATTACCATTATCAT

[0615] CCCGTATATTGGTCCGGCCCTGAATATTGGTAATATGCTGTATAAAGACGACTTTGTGG

[0616] GTGCCCTGATTTTTAGCGGTGCAGTTATTCTGCTGGAATTTATTCCGGAAATTGCAATT

[0617] CCGGTTCTGGGTACCTTTGCCCTGGTTAGTTATATTGCCAATAAAGTTCTGACCGTGCA

[0618] GACCATTGATAATGCACTGAGTCAGCGCAATGAAAAATGGGATGAAGTTTATAAATAC

[0619] ATCGTGACCAATTGGCTGGCCAAAGTTAATACCCAGATTGATCTGATTCGCAAAAAAA

[0620] TGAAAGAGGCCCTGGAAAATCAGGCCGAAGCCACCAAAGCCATTATTAATTATCAGTA

[0621] TAACCAGTACACCGAGGAAGAAAAAAACAATATCAACTTCAACATCGACGATCTGAGC

[0622] AGCAAACTGAATGAAAGCATTAATAAAGCAATGATCAACATCAACAAGTTCCTGAATC

[0623] AGTGTAGCGTTAGCTATCTGATGAATAGCATGATTCCGTATGGTGTTAATCGCCTGGAA

[0624] GATTTTGATGCAAGCCTGAAAGATGCCCTGCTGAAATATATTTATGATAATCGTGGCAC

[0625] CCTGATTGGTCAGGTTGATCGCCTGAAAGATAAAGTGAATAATACCCTGAGCACCAAT

[0626] ATTCCGTTTCAGCTGAGCAAATATGTTGATAATCAGCGTCTGCTGAGCACCTTTACCGA

[0627] ATATATTGGCCCTCTGGGCCTGTGGGCCCAGCTGAATCTGGTTCCGCGTGGTAGTTATG

[0628] AAAGCAATCATCTGATTGATCTGGTGCCGCGCGGCAGTCGCTATGCCAGTAATATTAAT

[0629] ATTGGCAGTGATGTTAACTTCGATCCGATTGATAAAAATCAGATTCAGCTGTTTAACCT

[0630] GGAAAGCAGCAAAATTGAAGTTATTCTGAAAAACGCCATCGTGTATAATAGCATGTAT

[0631] GAAAATTTCAGCACCAGCTTTTGGATTCGTATTCCGAAATATTTTAACAGCATCAGTCT

[0632] GAATAACGAATATACCATTATCAACTGCATGGCCAATAACAGCGCCTGGAAAGTTAGC

[0633] CTGAATTATGGCGAAATTATTTGGACCCTGCAGGATACCCAGGAAATTAAACAGCGCG

[0634] TGGTTTTTAAATATAGTCAGATGATTAACATCAGCGATTATATTAACCGTTGGATTTTT

[0635] GTTACCATCACCAATAATCGTCTGAATAATAGTAAGATCTACATCAATGGCCGCCTGAT

[0636] TGATCAGAAACCGATTAGCAATCTGGGTAATATTCATGCAAGCAATAATATTATGTTCA

[0637] AGCTGGATGGCTGTCGCGATACCCATCGCTATATTTGGATTAAATATTTCAACCTGTTC

[0638] GACAAAGAGCTGAATGAAAAAGAAATTAAGGACCTGTATGACAATCAGAGCAATAGC

[0639] GGCATTCTGAAAGATTTTTGGGGCGATTATCTGCAGTATGATAAACCGTATTATATGCT

[0640] GAATCTGTATGATCCGAATAAATATGTTGACGTTAACAATGTTGGCATTCGTGGTTATA

[0641] TGTATCTGGTCCCGCGCGGCAGTGTTATGACCACCAATATTTATCTGAATAGTAGTCTG

[0642] TACCGCGGTACCAAATTTATTATTAAAAAGTACGCCAGCGGTAATAAAGATAATATTG

[0643] TGCGTAATAACGACCGCGTTTATATTAATGTTGTGGTTAAAAACAAGGAGTACCGTCTG

[0644] GCAACCAATGCAAGTCAGGCCGGTGTGGAAAAAATTCTGAGCGCCCTGGAAATTCCGG

[0645] ATGTTGGCAATCTGAGCCAGGTTGTGGTGATGAAAAGCAAAAATGATCAGGGTATTAC

[0646] CAATAAATGCCAGATGAATCTGCAGGATAACAATGGCAATGATATTGGCTTTATTGGT

[0647] TTTCATCAGTTTAACAATATCGCCAAACTGGTGGCAAGTAATTGGTATAATCGCCAGAT

[0648] TGAACGTAGCAGTCGTACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGATGATGGCTGGGGTGAACGTCCGCTGGAAAACCTGTATTTCCAGGGCcatcatcatcatcatcactga。

[0649] The nucleotide sequence of Sequence 7 is shown in SEQ ID NO:126.

[0650] SEQ ID NO:126:

[0651] ATGcatcatcatcatcatcacGAAAACCTGTATTTCCAGGGCATGCCGTTTGTTAATAAGCAGTTTAACTATAAGGACCCGGTGAATGGCGTTGATATTGCATATATTAAAATCCCGAACGCCGGCCAGATGCAGCCGGTTAAAGCATTTAAAATTCATAATAAGATCTGGGTGATCCCGGAACGCGATACCTTTACCAATCCGGAAGAAGGCGATCTGAATCCGCCGCCGGAAGCAAAACAGGTTCCGGTGAGTTATTATGATAGTACCTATCTGAGTACCAATAATGAAAAAGATAACTATCTGAAGGGTGTTACCAAACTGTTTGAACGCATTTATAGTACCCCGCTGGGTCGTATGCTGCTGACCAGTATTGTTCGCGGCATTCCGTTTTGGGGCGGCAGCACCATTGATACCGAACTGAAAGTGATTGATACCAATTGTATTAACGTGATTCAGCCGGATGGTAGCTATCGCAGTGAAGAACTGAATCTGGTGATTATTGGCCCGAGCGCAGATATTATTCAGTTTGAATGCAAAAGTTTCGGCCATGAAGTGCTGAATCTGACCCGTAATGGTTATGGCAGCA

[0652] CCCAGTATATTCGTTTTAGTCCGGATTTTACCTTTGGTTTTGAAGAAAGTCTGGAAGTT

[0653] AATACCAATCCGCTGCTGGGTGCAGGTGAATTTGCCACCGATCCGGCCGTGACCCTGG

[0654] CCCATGAACTGATTCATGCCGGTCATCGCCTGTATGGCATTGCCATTAATCCGAATCGT

[0655] GTGTTTAAAGTGAATACCAATGCCTATTATGAGATGAGTGGCCTGGAAGTGAGTTTTG

[0656] AAGAACTGCGCACCTTTGGCGGTCATGATGCAAAATTTATTGATAGCCTGCAGGAAAA

[0657] TGAATTTCGCCTGTATTATTATAACAAGTTCAAGGATATCGCGAGTACCCTGAATAAAG

[0658] CCAATAGCATTGTTGGCACCACCGCCAGCCTGCAGTATATGAAAAATGTGTTTAAAGA

[0659] GAAGTACCTGCTGAGCGAAGATACCAGTGGTAATTTTAGCGTGGATAATCTGAAATTT

[0660] GACAAACTGTATAAGATGCTGACCGAAATTTATACCGAAGATAATTTTGTGAAGTTCTT

[0661] CAAAGTGCTGAATCGTAAAACCTATCTGAATTTTGATAAGGCAGTGTTTAAGATTAAC

[0662] ATCGTGCCGAAAGTTAATTATACCATTTATGATGGTTTCAACCTGCGCAATACCAATCT

[0663] GGCCGCAAATTTTAATGGTCAGAATACCGAAATTAACAACATGAATTTCACCAAACTG

[0664] AAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTGCTGTGCGTGCGTGGTATTATTAC

[0665] CAGTAAGACCAAAAGCCTGGTTCCGCGTGGTAGTAAAGCCCTGAATGATCTGTGTATT

[0666] AAAGTTAATAACTGCGATCTGTTCTTCAGTCCGAGCGAAGATAATTTCACCAATGATCT

[0667] GAATAAGGGTGAAGAAATTACCAGCGATACCAATATTGAAGCCGCCGAAGAAAATAT

[0668] TAGCCTGGATCTGATTCAGCAGTATTATCTGACCTTTAATTTCGATAACGAGCCGGAAA

[0669] ATATTAGTATTGAAAATCTGAGTAGCGACATTATTGGTCAGCTGGAACTGATGCCGAA

[0670] TATTGAACGTTTTCCGAATGGCAAAAAATATGAACTGGATAAATACACCATGAGTGTG

[0671] AATGAAGCACTGCTGAATCCGAGCCGTGTGTATACCTTTTTTAGCAGTGATTATGTGAA

[0672] TAAAGTGAATAAAGCAACCGAAGCCGCAATGTTTCTGGGCGGTTGGAATCAGCTGGTT

[0673] TATGATTTTACCGATGAAACCAGCGAAGTTAGCACCACCGATAAAATTGCAGATATTA

[0674] CCATTATCATCCCGTATATTGGTCCGGCCCTGAATATTGGTAATATGCTGTATAAAGAC

[0675] GACTTTGTGGGTGCCCTGATTTTTAGCGGTGCAGTTATTCTGCTGGAATTTATTCCGGA

[0676] AATTGCAATTCCGGTTCTGGGTACCTTTGCCCTGGTTAGTTATATTGCCAATAAAGTTCT

[0677] GACCGTGCAGACCATTGATAATGCACTGAGTCAGCGCAATGAAAAATGGGATGAAGTT

[0678] TATAAATACATCGTGACCAATTGGCTGGCCAAAGTTAATACCCAGATTGATCTGATTCG

[0679] CAAAAAAATGAAAGAGGCCCTGGAAAATCAGGCCGAAGCCACCAAAGCCATTATTAA

[0680] TTATCAGTATAACCAGTACACCGAGGAAGAAAAAAACAATATCAACTTCAACATCGAC

[0681] GATCTGAGCAGCAAACTGAATGAAAGCATTAATAAAGCAATGATCAACATCAACAAGT

[0682] TCCTGAATCAGTGTAGCGTTAGCTATCTGATGAATAGCATGATTCCGTATGGTGTTAAT

[0683] CGCCTGGAAGATTTTGATGCAAGCCTGAAAGATGCCCTGCTGAAATATATTTATGATA

[0684] ATCGTGGCACCCTGATTGGTCAGGTTGATCGCCTGAAAGATAAAGTGAATAATACCCT

[0685] GAGCACCAATATTCCGTTTCAGCTGAGCAAATATGTTGATAATCAGCGTCTGCTGAGCA

[0686] CCTTTACCGAATATATTGGCCCTCTGGGCCTGTGGGCCCAGCTGAATCTGCGTTATGAA

[0687] AGCAATCATCTGATTGATCTGAGTCGCTATGCCAGTAATATTAATATTGGCAGTGATGT

[0688] TAACTTCGATCCGATTGATAAAAATCAGATTCAGCTGTTTAACCTGGAAAGCAGCAAA

[0689] ATTGAAGTTATTCTGAAAAACGCCATCGTGTATAATAGCATGTATGAAAATTTCAGCAC

[0690] CAGCTTTTGGATTCGTATTCCGAAATATTTTAACAGCATCAGTCTGAATAACGAATATA

[0691] CCATTATCAACTGCATGGCCAATAACAGCGCCTGGAAAGTTAGCCTGAATTATGGCGA

[0692] AATTATTTGGACCCTGCAGGATACCCAGGAAATTAAACAGCGCGTGGTTTTTAAATAT

[0693] AGTCAGATGATTAACATCAGCGATTATATTAACCGTTGGATTTTTGTTACCATCACCAA

[0694] TAATCGTCTGAATAATAGTAAGATCTACATCAATGGCCGCCTGATTGATCAGAAACCG

[0695] ATTAGCAATCTGGGTAATATTCATGCAAGCAATAATATTATGTTCAAGCTGGATGGCTG

[0696] TCGCGATACCCATCGCTATATTTGGATTAAATATTTCAACCTGTTCGACAAAGAGCTGA

[0697] ATGAAAAAGAAATTAAGGACCTGTATGACAATCAGAGCAATAGCGGCATTCTGAAAG

[0698] ATTTTTGGGGCGATTATCTGCAGTATGATAAACCGTATTATATGCTGAATCTGTATGAT

[0699] CCGAATAAATATGTTGACGTTAACAATGTTGGCATTCGTGGTTATATGTATCTGAAAGG

[0700] TCCGCGCGGCAGTGTTATGACCACCAATATTTATCTGAATAGTAGTCTGTACCGCGGTA

[0701] CCAAATTTATTATTAAAAAGTACGCCAGCGGTAATAAAGATAATATTGTGCGTAATAA

[0702] CGACCGCGTTTATATTAATGTTGTGGTTAAAAACAAGGAGTACCGTCTGGCAACCAAT

[0703] GCAAGTCAGGCCGGTGTGGAAAAAATTCTGAGCGCCCTGGAAATTCCGGATGTTGGCA

[0704] ATCTGAGCCAGGTTGTGGTGATGAAAAGCAAAAATGATCAGGGTATTACCAATAAATG

[0705] CCAGATGAATCTGCAGGATAACAATGGCAATGATATTGGCTTTATTGGTTTTCATCAGT

[0706] TTAACAATATCGCCAAACTGGTGGCAAGTAATTGGTATAATCGCCAGATTGAACGTAG

[0707] CAGTCGTACCCTGGGTTGCAGCTGGGAATTTATTCCTGTGGATGATGGCTGGGGTGAACGTCCGCTGtga。

[0708] The nucleotide sequence of Sequence 8 is shown in SEQ ID NO: 127.

[0709] SEQ ID NO: 127:

[0710] ATGCCGTTTGTTAATAAGCAGTTTAACTATAAGGACCCGGTGAATGGCGTTGATATTGCATATATTAAAATCCCGAACGCCGGCCAGATGCAGCCGGTTAAAGCATTTAAAATTCATAATAAGATCTGGGTGATCCCGGAACGCGATACCTTTACCAATCCGGAAGAAGGCGATCTGAATCCGCCGCCGGAAGCAAAACAGGTTCCGGTGAGTTATTATGATAGTACCTATCTGAGTACCAATAATGAAAAAGATAACTATCTGAAGGGTGTTACCAAACTGTTTGAACGCATTTATAGTACCCCGCTGGGTCGTATGCTGCTGACCAGTATTGTTCGCGGCATTCCGTTTTGGGGCGGCAGCACCATTGATACCGAACTGAAAGTGATTGATACCAATTGTATTAACGTGATTCAGCCGGATGGTAGCTATCGCAGTGAAGAACTGAATCTGGTGATTATTGGCCCGAGCGCAGATATTATTCAGTTTGAATGCAAAAGTTTCGGCCATGAAGTGCTGAA

[0711] TCTGACCCGTAATGGTTATGGCAGCACCCAGTATATTCGTTTTAGTCCGGATTTTACCTT

[0712] TGGTTTTGAAGAAAGTCTGGAAGTTAATACCAATCCGCTGCTGGGTGCAGGTGAATTT

[0713] GCCACCGATCCGGCCGTGACCCTGGCCCATGAACTGATTCATGCCGGTCATCGCCTGTA

[0714] TGGCATTGCCATTAATCCGAATCGTGTGTTTAAAGTGAATACCAATGCCTATTATGAGA

[0715] TGAGTGGCCTGGAAGTGAGTTTTGAAGAACTGCGCACCTTTGGCGGTCATGATGCAAA

[0716] ATTTATTGATAGCCTGCAGGAAAATGAATTTCGCCTGTATTATTATAACAAGTTCAAGG

[0717] ATATCGCGAGTACCCTGAATAAAGCCAATAGCATTGTTGGCACCACCGCCAGCCTGCA

[0718] GTATATGAAAAATGTGTTTAAAGAGAAGTACCTGCTGAGCGAAGATACCAGTGGTAAT

[0719] TTTAGCGTGGATAATCTGAAATTTGACAAACTGTATAAGATGCTGACCGAAATTTATAC

[0720] CGAAGATAATTTTGTGAAGTTCTTCAAAGTGCTGAATCGTAAAACCTATCTGAATTTTG

[0721] ATAAGGCAGTGTTTAAGATTAACATCGTGCCGAAAGTTAATTATACCATTTATGATGGT

[0722] TTCAACCTGCGCAATACCAATCTGGCCGCAAATTTTAATGGTCAGAATACCGAAATTA

[0723] ACAACATGAATTTCACCAAACTGAAGAATTTCACCGGTCTGTTTGAATTTTATAAGCTG

[0724] CTGTGCGTGCGTGGTATTATTACCAGTAAGACCAAAAGCCTGGTTCCGCGTGGTAGTA

[0725] AAGCCCTGAATGATCTGTGTATTAAAGTTAATAACTGCGATCTGTTCTTCAGTCCGAGC

[0726] GAAGATAATTTCACCAATGATCTGAATAAGGGTGAAGAAATTACCAGCGATACCAATA

[0727] TTGAAGCCGCCGAAGAAAATATTAGCCTGGATCTGATTCAGCAGTATTATCTGACCTTT

[0728] AATTTCGATAACGAGCCGGAAAATATTAGTATTGAAAATCTGAGTAGCGACATTATTG

[0729] GTCAGCTGGAACTGATGCCGAATATTGAACGTTTTCCGAATGGCAAAAAATATGAACT

[0730] GGATAAATACACCATGAGTGTGAATGAAGCACTGCTGAATCCGAGCCGTGTGTATACC

[0731] TTTTTTAGCAGTGATTATGTGAATAAAGTGAATAAAGCAACCGAAGCCGCAATGTTTCT

[0732] GGGCGGTTGGAATCAGCTGGTTTATGATTTTACCGATGAAACCAGCGAAGTTAGCACC

[0733] ACCGATAAAATTGCAGATATTACCATTATCATCCCGTATATTGGTCCGGCCCTGAATAT

[0734] TGGTAATATGCTGTATAAAGACGACTTTGTGGGTGCCCTGATTTTTAGCGGTGCAGTTA

[0735] TTCTGCTGGAATTTATTCCGGAAATTGCAATTCCGGTTCTGGGTACCTTTGCCCTGGTTA

[0736] GTTATATTGCCAATAAAGTTCTGACCGTGCAGACCATTGATAATGCACTGAGTCAGCGC

[0737] AATGAAAAATGGGATGAAGTTTATAAATACATCGTGACCAATTGGCTGGCCAAAGTTA

[0738] ATACCCAGATTGATCTGATTCGCAAAAAAATGAAAGAGGCCCTGGAAAATCAGGCCGA

[0739] AGCCACCAAAGCCATTATTAATTATCAGTATAACCAGTACACCGAGGAAGAAAAAAAC

[0740] AATATCAACTTCAACATCGACGATCTGAGCAGCAAACTGAATGAAAGCATTAATAAAG

[0741] CAATGATCAACATCAACAAGTTCCTGAATCAGTGTAGCGTTAGCTATCTGATGAATAG

[0742] CATGATTCCGTATGGTGTTAATCGCCTGGAAGATTTTGATGCAAGCCTGAAAGATGCCC

[0743] TGCTGAAATATATTTATGATAATCGTGGCACCCTGATTGGTCAGGTTGATCGCCTGAAA

[0744] GATAAAGTGAATAATACCCTGAGCACCAATATTCCGTTTCAGCTGAGCAAATATGTTG

[0745] ATAATCAGCGTCTGCTGAGCACCTTTACCGAATATATTGGCCCTCTGGGCCTGTGGGCC

[0746] CAGCTGAATCTGCGTTATGAAAGCAATCATCTGATTGATCTGAGTCGCTATGCCAGTAA

[0747] TATTAATATTGGCAGTGATGTTAACTTCGATCCGATTGATAAAAATCAGATTCAGCTGT

[0748] TTAACCTGGAAAGCAGCAAAATTGAAGTTATTCTGAAAAACGCCATCGTGTATAATAG

[0749] CATGTATGAAAATTTCAGCACCAGCTTTTGGATTCGTATTCCGAAATATTTTAACAGCA

[0750] TCAGTCTGAATAACGAATATACCATTATCAACTGCATGGCCAATAACAGCGCCTGGAA

[0751] AGTTAGCCTGAATTATGGCGAAATTATTTGGACCCTGCAGGATACCCAGGAAATTAAA

[0752] CAGCGCGTGGTTTTTAAATATAGTCAGATGATTAACATCAGCGATTATATTAACCGTTG

[0753] GATTTTTGTTACCATCACCAATAATCGTCTGAATAATAGTAAGATCTACATCAATGGCC

[0754] GCCTGATTGATCAGAAACCGATTAGCAATCTGGGTAATATTCATGCAAGCAATAATAT

[0755] TATGTTCAAGCTGGATGGCTGTCGCGATACCCATCGCTATATTTGGATTAAATATTTCA

[0756] ACCTGTTCGACAAAGAGCTGAATGAAAAAGAAATTAAGGACCTGTATGACAATCAGA

[0757] GCAATAGCGGCATTCTGAAAGATTTTTGGGGCGATTATCTGCAGTATGATAAACCGTAT

[0758] TATATGCTGAATCTGTATGATCCGAATAAATATGTTGACGTTAACAATGTTGGCATTCG

[0759] TGGTTATATGTATCTGAAAGGTCCGCGCGGCAGTGTTATGACCACCAATATTTATCTGA

[0760] ATAGTAGTCTGTACCGCGGTACCAAATTTATTATTAAAAAGTACGCCAGCGGTAATAA

[0761] AGATAATATTGTGCGTAATAACGACCGCGTTTATATTAATGTTGTGGTTAAAAACAAG

[0762] GAGTACCGTCTGGCAACCAATGCAAGTCAGGCCGGTGTGGAAAAAATTCTGAGCGCCC

[0763] TGGAAATTCCGGATGTTGGCAATCTGAGCCAGGTTGTGGTGATGAAAAGCAAAAATGA

[0764] TCAGGGTATTACCAATAAATGCCAGATGAATCTGCAGGATAACAATGGCAATGATATT

[0765] GGCTTTATTGGTTTTCATCAGTTTAACAATATCGCCAAACTGGTGGCAAGTAATTGGTA

[0766] TAATCGCCAGATTGAACGTAGCAGTCGTACCCTGGGTTGCAGCTGGGAATTTATTCCTG

[0767] TGGATGATGGCTGGGGTGAACGTCCGCTGGAAAACCTGTATTTCCAGGGCcatcatcatcatcatcactga。

[0768] The nucleotide sequence of Sequence 9 is shown in SEQ ID NO:128.

[0769] SEQ ID NO:128:

[0770] ATGCCGTTCGTCAACAAACAGTTCAACTACAAAGATCCGGTCAACGGCGTCGATATTGCATACATCAAAATCCCGAACGCCGGTCAGATGCAGCCGGTCAAAGCGTTCAAAATCCACAACAAAATCTGGGTCATTCCGGAACGCGATACCTTTACCAACCCGGAAGAAGGCGATCTGAACCCACCACCAGAAGCAAAACAAGTTCCGGTTAGCTACTACGATAGCACCTATCTGAGCACCGACAACGAGAAAGACAACTACCTGAAAGGCGTCACCAAACTGTTCGAGCGCATCTATAGCACCGATCTGGGTCGTATGCTGCTGACCAGCATTGTTCGCGGTATTCCATTTTGGGGCGGTAGCACCATCGATACCGAGCTGAAAGTCATCGACACCAACTGCATCAACGTTATTCAGCCGGACGGTAGCTATCGTAGCGAAGAACTGAACCTGGTCATTATT

[0771] GGCCCGAGCGCAGATATTATCCAGTTCGAGTGCAAAAGCTTCGGCCACGAAGTACTGA

[0772] ATCTGACCCGTAACGGCTACGGTAGTACCCAGTATATCCGTTTTAGCCCGGACTTCACC

[0773] TTTGGCTTTGAAGAAAGCCTGGAAGTCGATACCAATCCACTGCTGGGCGCAGGTAAAT

[0774] TTGCGACCGATCCAGCAGTTACCCTGGCACACGAACTGATTCACGCAGGTCATCGTCTG

[0775] TACGGTATTGCGATTAACCCGAACCGCGTTTTCAAAGTCAACACCAACGCCTACTACG

[0776] AAATGAGCGGTCTGGAAGTCAGCTTCGAAGAACTGCGTACCTTTGGCGGTCACGACGC

[0777] AAAATTCATCGACAGCCTGCAGGAGAACGAATTCCGCCTGTACTACTACAACAAATTC

[0778] AAAGACATCGCGAGCACCCTGAACAAAGCAAAAAGCATTGTTGGTACCACCGCGTCTC

[0779] TGCAGTACATGAAAAACGTCTTCAAAGAGAAATACCTGCTGAGCGAAGATACCAGCGG

[0780] TAAATTCAGCGTCGACAAACTGAAATTCGACAAACTGTACAAAATGCTGACCGAGATC

[0781] TACACCGAGGACAACTTCGTCAAATTCTTCAAAGTCCTGAACCGCAAAACCTACCTGA

[0782] ACTTCGACAAAGCGGTCTTCAAAATCAACATCGTCCCGAAAGTCAACTACACCATCTA

[0783] CGACGGCTTCAACCTGCGTAATACCAATCTGGCGGCGAATTTCAACGGCCAGAACACC

[0784] GAGATCAACAACATGAACTTCACCAAACTGAAAAACTTCCCGCGCGGTTCTGGTATGA

[0785] AAACCGGTCTGTTTGAGTTCTACAAACTGCTGTGCGTTCGCGGTATCATCACCAGCAAA

[0786] ACCAAAAGCCTGGACAAAGGCTACAACAAAGCCCTGAACGACCTGTGCATCAAAGTC

[0787] AACAACTGGGACCTGTTCTTTAGCCCGAGCGAAGACAACTTCACCAACGATCTGAACA

[0788] AAGGCGAAGAAATTACCAGCGATACCAACATCGAAGCGGCGGAAGAAAACATCAGCC

[0789] TGGATCTGATCCAGCAGTACTACCTGACCTTCAACTTCGACAACGAACCGGAAAACAT

[0790] CAGCATCGAGAACCTGAGCAGCGATATCATCGGCCAACTGGAACTGATGCCGAATATC

[0791] GAACGCTTCCCGAACGGCAAAAAATACGAGCTGGACAAATACACCATGTTCCACTACC

[0792] TGCGCGCACAAGAATTCGAACACGGTAAAAGCCGCATTGCACTGACCAATAGCGTTAA

[0793] CGAAGCACTGCTGAATCCGAGTCGCGTTTATACCTTCTTCAGCAGCGACTACGTCAAAA

[0794] AAGTTAACAAAGCGACCGAGGCGGCAATGTTTCTGGGTTGGGTTGAACAGCTGGTATA

[0795] CGACTTCACCGACGAAACCAGCGAAGTTAGTACCACCGACAAAATCGCGGACATCACC

[0796] ATCATCATCCCGTATATTGGCCCGGCACTGAACATTGGCAACATGCTGTACAAAGACG

[0797] ACTTCGTCGGCGCACTGATTTTTAGCGGCGCGGTTATTCTGCTGGAATTCATCCCGGAA

[0798] ATCGCGATTCCAGTTCTGGGTACCTTTGCACTGGTTAGCTACATCGCGAACAAAGTCCT

[0799] GACCGTTCAGACCATTGACAACGCACTGAGCAAACGCAACGAGAAATGGGACGAGGT

[0800] CTACAAATACATCGTCACCAACTGGCTGGCGAAAGTTAATACCCAGATCGACCTGATC

[0801] CGCAAAAAGATGAAAGAAGCGCTGGAAAATCAAGCAGAAGCAACCAAAGCGATCATC

[0802] AACTACCAGTACAACCAGTACACCGAAGAAGAGAAAAACAACATCAACTTCAACATC

[0803] GACGACCTGAGCAGCAAACTGAACGAGAGCATCAACAAAGCGATGATCAACATCAAC

[0804] AAATTCCTGAACCAGTGCAGCGTCTCCTATCTGATGAACAGCATGATCCCGTACGGCGT

[0805] TAAACGCCTGGAAGATTTTGACGCAAGCCTGAAAGACGCGCTGCTGAAATACATCTAC

[0806] GATAACCGCGGTACCCTGATTGGTCAAGTTGACCGCCTGAAAGACAAAGTCAACAACA

[0807] CCCTGAGCACCGATATTCCGTTTCAGCTGAGCAAATACGTCGACAACCAACGTCTGCTG

[0808] AGCACCTTCACCGAGTACATCAAAAACATCATCAACACCAGCATCCTGAACCTGCGTT

[0809] ACGAAAGCAACCATCTGATCGATCTGAGCCGTTACGCGAGCAAAATCAACATCGGCAG

[0810] CAAAGTCAACTTCGACCCGATCGACAAAAACCAGATCCAGCTGTTCAACCTGGAGTCC

[0811] AGCAAAATCGAGGTCATCCTGAAAAACGCGATCGTCTACAACAGCATGTACGAGAACT

[0812] TCAGCACCAGCTTCTGGATCCGCATCCCGAAATACTTCAACAGCATCAGCCTGAACAA

[0813] CGAGTACACCATCATCAACTGCATGGAGAACAACAGCGGTTGGAAAGTCAGCCTGAAC

[0814] TACGGCGAAATCATTTGGACCCTGCAGGATACCCAGGAAATCAAACAGCGCGTCGTCT

[0815] TCAAATACAGCCAGATGATCAACATCAGCGACTACATCAACCGCTGGATCTTCGTTAC

[0816] CATCACCAACAACCGCCTGAACAACAGCAAAATCTACATCAACGGCCGCCTGATCGAT

[0817] CAGAAACCGATTTCCAACCTGGGCAATATTCACGCGAGCAACAACATCATGTTCAAAC

[0818] TGGACGGTTGTCGCGATACCCATCGCTACATCTGGATCAAATACTTCAACCTGTTCGAC

[0819] AAAGAGCTGAACGAGAAAGAGATCAAAGACCTGTACGACAACCAGAGCAACAGCGGC

[0820] ATCCTGAAAGATTTCTGGGGCGATTACCTGCAGTACGACAAACCGTACTACATGCTGA

[0821] ACCTGTACGACCCGAACAAATACGTAGACGTGAACAACGTTGGCATTCGCGGTTATAT

[0822] GTACCTGAAAGGTCCACGCGGTTCTGTTATGACCACCAACATCTACCTGAACAGCAGC

[0823] CTGTACCGCGGCACCAAATTCATCATCAAAAAATACGCGAGCGGCAACAAAGACAAC

[0824] ATCGTTCGCAACAACGATCGCGTCTACATCAACGTCGTCGTCAAAAACAAAGAGTACC

[0825] GCCTGGCAACCAACGCAAGTCAAGCAGGCGTTGAAAAAATCCTGAGCGCACTGGAAA

[0826] TTCCGGACGTTGGTAACCTGAGCCAGGTCGTTGTTATGAAAAGCAAAAACGACCAGGG

[0827] CATCACCAACAAATGCAAAATGAACCTGCAGGACAACAACGGCAACGATATTGGCTTC

[0828] ATCGGCTTTCACCAGTTCAACAACATCGCGAAACTGGTCGCAAGCAATTGGTACAACC

[0829] GCCAGATCGAACGTTCTAGTCGTACCCTGGGTTGTTCTTGGGAATTCATTCCGGTAGACGACGGTTGGGGCGAACGTCCACTGCCACGCGGTTCTGGTATGAAACTCGAG。

[0830] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than limiting the protection scope of the present invention. Any simple modification or equivalent replacement made by those of ordinary skill in the art to the technical solution of the present invention shall not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A method for increasing the yield or purity of botulinum toxin type A, characterized in that: The method comprises: inserting a polynucleotide with a sequence as shown in SEQ ID NO. 3 into a vector pET28a, and expressing it in Escherichia coli BL21 (DE3).

Images