Application of PHF20 inhibitors in the preparation of anti-skin cancer drugs

By knocking out the PHF20 gene in skin squamous cell carcinoma cells and preparing PHF20 inhibitors using siRNA and CRISPR technology, the problem of limited treatment options for cSCC is solved, and effective treatment of skin squamous cell carcinoma and inhibiting metastasis is achieved.

CN118161615BActive Publication Date: 2025-08-12SHANDONG UNIV QILU HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410310675.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-19
Publication Date
2025-08-12
Estimated Expiration
2044-03-19

AI Technical Summary

Technical Problem

In the prior art, the pathogenesis of skin squamous cell carcinoma (cSCC) is unclear, the treatment options are limited and the recurrence rate is high, chemotherapy has potential toxic side effects, and there is a lack of effective therapeutic targets.

Method used

By knocking down the PHF20 gene expression in skin squamous cell carcinoma cells using small interfering RNA (siRNA), knocking out the PHF20 gene using CRISPR gene editing technology, and preparing PHF20 inhibitors are used to prepare anti-dermal cancer drugs to inhibit the expression level of PHF20 gene.

Benefits of technology

It significantly increased the apoptosis rate of cSCC cells, reduced migration and invasion ability, promoted tumor cell apoptosis, improved the therapeutic effect of skin squamous cell carcinoma, and provided new therapeutic targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118161615B_ABST
    Figure CN118161615B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedicine and relates to the use of PHF20 inhibitors in the preparation of anti-skin cancer drugs. The present invention discovered that plant homeodomain finger protein 20 (PHF20) is expressed at high levels in cutaneous squamous cell carcinoma samples. In this application, small interfering RNA was used to knock down PHF20 in cSCC cells. The results showed that the apoptosis rate of cSCC cells increased, and the migration and invasion abilities were significantly reduced. Furthermore, the expression levels of proteins associated with apoptosis, migration, and invasion also changed, further highlighting the key role of PHF20 in regulating cSCC cell behavior. Therefore, PHF20 not only plays an important role in the malignant progression of cSCC but may also become a potential target in future therapeutic strategies to help inhibit the metastasis and spread of cutaneous squamous cell carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine and relates to the application of a PHF20 inhibitor in the preparation of anti-skin cancer drugs. Background Art

[0002] Cutaneous squamous cell carcinoma (cSCC) is the most common metastatic skin cancer, second only to basal cell carcinoma in incidence, accounting for 20% of skin malignancies, a proportion that is increasing. The etiology of cSCC is complex, with ultraviolet radiation as a risk factor, and viral infections and chemical agents also closely associated with its development. Although cSCC has a low mortality rate, it has a strong ability to metastasize and invade, eroding vital tissue structures or metastasizing to lymph nodes. Compared to basal cell carcinoma, cSCC is more malignant and carries a very poor prognosis.

[0003] Because the pathogenesis of cSCC remains unclear, treatment options for cSCC include surgery, radiotherapy, and drug therapy. Complete excision guided by histopathology is the standard treatment for cutaneous squamous cell carcinoma, but many treatment options are limited by the high recurrence rate of excision and the potential toxic side effects of chemotherapy.

[0004] Therefore, finding effective therapeutic targets for cSCC is a technical problem that needs to be solved urgently. Summary of the Invention

[0005] To address the above technical issues, the present invention analyzed skin squamous cell carcinoma tissue samples at different stages and found that the expression level of plant homeodomain finger protein 20 (PHF20) was significantly increased in tissues with higher malignancy. PHF20 is an epigenetic regulatory factor, a gene encoding a multi-domain protein, which belongs to the PHD (Plant Homeodomain) finger protein family. PHF20 proteins play important roles in various biological processes, including chromatin modification, transcriptional regulation, and DNA damage response. To explore the expression of PHF20 in skin squamous cell carcinoma and its role in pathogenesis, the present invention used small interfering RNA to knock down PHF20 in cSCC cells. The results showed that the apoptosis rate of cSCC cells increased and the migration and invasion abilities were significantly reduced. In addition, the expression levels of proteins related to apoptosis, migration, and invasion also changed accordingly, which further emphasized the key role of PHF20 in regulating cSCC cell behavior. It can be seen that PHF20 not only plays an important role in the malignant progression of cSCC, but also may become a potential target in future treatment strategies to help inhibit the metastasis and spread of skin squamous cell carcinoma.

[0006] Specifically, the scheme of the present invention is as follows:

[0007] The invention relates to the use of a PHF20 inhibitor in the preparation of an anti-skin cancer drug, wherein the anti-skin cancer drug has a therapeutic effect on skin cancer.

[0008] The PHF20 inhibitor includes but is not limited to a PHF20 gene expression inhibitor and a substance that specifically inhibits the activity of a protein encoded by PHF20. The PHF20 gene expression inhibitor is an interfering RNA corresponding to the PHF20 gene, and the interfering RNA includes miRNA, siRNA, dsRNA or shRNA.

[0009] The gene expression inhibitor is a gene knockout tool, which knocks out the PHF20 gene through CRISPR gene editing technology to inhibit the expression level of the PHF20 gene.

[0010] The skin cancer is cutaneous squamous cell carcinoma.

[0011] The PHF20 inhibitor is used for preparing an oral preparation or an injectable preparation for treating and / or preventing skin cancer.

[0012] The present invention also provides a drug for treating and / or preventing cutaneous squamous cell carcinoma, comprising a PHF20 inhibitor and pharmaceutically acceptable excipients.

[0013] On the other hand, based on PHF20 as a biomarker for cutaneous squamous cell carcinoma, the present invention provides a method for detecting the PHF20 gene and / or its encoded protein in the preparation of an auxiliary diagnostic reagent for cutaneous squamous cell carcinoma.

[0014] The beneficial effects of the present invention are:

[0015] Inhibitors targeting the PHF20 gene and its encoded protein can effectively treat cutaneous squamous cell carcinoma. After using siRNA to interfere with the PHF20 gene, it can inhibit the proliferation, migration and invasion of tumor cells, promote tumor cell apoptosis, and ultimately improve or treat cutaneous squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0017] Figure 1 Expression pattern analysis of PHF20 in skin squamous cell carcinoma tissue, adjacent non-cancerous tissue, and normal skin tissue. A shows the immunohistochemical staining results of PHF20 in different tissue samples. B shows the semi-quantitative analysis data of PHF20 in different tissue samples. C shows the expression trend of PHF20 in different grades of skin squamous cell carcinoma.

[0018] Figure 2is the protein expression level of PHF20 in Hacat, A431, and SCC13;

[0019] Figure 3 The mRNA and protein expression levels of PHF20 after small interfering siRNA treatment (RT-qPCR, Western Blot);

[0020] Figure 4 The data are related to flow cytometry of skin squamous cell carcinoma cell lines after gene knockout;

[0021] Figure 5 Left Figure 4 The quantitative comparison results of relevant data, Figure 5 The right shows the effect of PHF20 knockout on cell cycle proteins;

[0022] Figure 6 This is the apoptosis of human skin squamous cell carcinoma cells after PHF20 gene knockout;

[0023] Figure 7 for Figure 6 The quantitative comparison results of relevant data, Figure 7 The right side shows the comparison of protein cleavage activity in skin squamous cell carcinoma cells after PHF20 gene knockout;

[0024] Figure 8 The migration ability of skin squamous cell carcinoma after PHF20 gene knockout;

[0025] Figure 9 The migration and invasion ability of skin squamous cell carcinoma after PHF20 gene knockout;

[0026] Figure 10 Changes in protein levels related to squamous cell carcinoma metastasis ability after PHF20 gene knockout. DETAILED DESCRIPTION

[0027] In order to enable those skilled in the art to better understand the present application, the present application will be further elaborated in conjunction with specific implementation methods.

[0028] In some embodiments of the present invention, the PHF20 inhibitor is administered as a pharmaceutical formulation in a single dose, or multiple doses may be administered over a period of time. Dosage is achieved at a concentration in the total volume such that the dose is 10 nM, 30 nM, 100 nM, 1 μM, 100 μM, or higher, depending on the therapeutic effect. In other embodiments, administration is performed at a ratio of the mass of TFA to the mass of the subject being treated, such that the dose is 1 mg / kg, 5 mg / kg, 10 mg / kg, 20 mg / kg, 50 mg / kg, 100 mg / kg, or higher, depending on the therapeutic effect. In multiple-dose embodiments, the dosing schedule may be 1 dose / day, 2 doses / day, 3 doses / day, or more, and may be continued for as long as necessary, such that administration may continue for 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 10 weeks, 20 weeks, or indefinitely for the life of the organism.

[0029] In some embodiments of the present invention, the experimental materials used in the embodiments of the present invention are as follows:

[0030] A human skin squamous cell carcinoma tissue microarray (K054Sk01) was purchased from Bioaitech (Xi'an, China). Anti-PHF20 antibody (D96F6) was purchased from Cell Signaling Technology (Beverly, MA, USA). Anti-β-actin antibody (8F10) and anti-cyclin D1 antibody were obtained from Zenbio (Chengdu, China). Anti-MMP2 antibody (10373-2-AP), anti-MMP9 antibody (10375-2-AP), N-cadherin antibody (66219-1-Ig), E-cadherin antibody (60335-1-Ig), and Caspase3 / p17 / p19 antibody (66470-2-Ig) were obtained from Proteintech (Chicago, IL, USA). Horseradish peroxidase (HRP)-conjugated anti-mouse, anti-rabbit, and anti-goat immunoglobulin G (IgG) antibodies were obtained from Komabiotech (Seoul, South Korea). DNA staining cell cycle kit was purchased from Yeason (Shanghai, China), and DNA staining cell apoptosis kit was purchased from Novozymes (Nanjing, China).

[0031] All statistical analyses in the examples of the present invention were performed using GraphPad Prism 9 software (GraphPad Software). Data from at least three independent experiments are presented as mean ± standard deviation (SD), and comparisons were made using t-test and analysis of variance. P < 0.05 was considered statistically significant.

[0032] Experimental Example 1

[0033] Cell culture:

[0034] Hacat cells (human skin keratinocytes), A431 cells (human skin squamous cell carcinoma cells), and SCC13 cells were routinely cultured in DMEM-high glucose (Gibco, Detroit, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, Detroit, USA) and 1% bispecific antibiotics (100 U / mL penicillin and 100 U / mL streptomycin) (Gibco, Detroit, USA). When the cell confluence reached 90%, the cells were passaged using 25% trypsin (Gibco, Detroit, USA) in a cleanroom and incubated at 37°C with 5% CO2.

[0035] siRNA transient transfection:

[0036] When the cells reached 60-70% confluency, they were serum-starved for 6 hours and then transfected with small interfering RNA (siRNA) (GenePharma, Shanghai, China) under serum-free conditions. PHF20 siRNA was transfected using the recommended protocol of Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) in serum-free medium. Oligonucleotide sequences are shown in the table below. Following transfection, cells were cultured for 24 / 48 hours before subsequent experiments.

[0037] Table 1 Oligonucleotide sequences

[0038]

[0039] SEQ ID NO.1:UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT

[0040] SEQ ID NO.2: GGAGAAAACACGAUGAAAATTUUUUCAUCGUGUUUUCCCTT

[0041] SEQ ID NO.3: CUACAAAAGACAAGGAAAATTUUUUCCUUGUCUUUUGUAGTT

[0042] Western blotting:

[0043] The prepared cells were placed on ice and lysed with RIPM lysis buffer (Biyuntian, Beijing, China) to prepare cell lysates. The cell lysates were centrifuged at 13,000 rpm for 20 minutes at 4°C to obtain proteins. The proteins were separated by 10.0% polyacrylamide gel electrophoresis (SDS PAGE). The separated proteins were transferred to Immobilon P membrane (Millipore, Billerica, Massachusetts, USA). The membrane was then blocked for 20 minutes using Rapid Blocking Buffer (Biyuntian, Beijing, China). The primary antibody was diluted to a specific multiple according to the instructions and incubated on a shaker at 4°C overnight. After the reaction, the membrane was washed with TBST (TBS + 0.1% Tween-20) buffer. Antibodies (anti-mouse immunoglobulin G or anti-rabbit immunoglobulin G conjugated with horseradish peroxidase (Komabiotech, Seoul, South Korea)) diluted 2000 times were used and incubated on a shaker at room temperature for 1 hour. Protein expression levels were detected using the ECL Plus bioimaging system (Millipore, Billerica, MA, USA).

[0044] qRT-PCR:

[0045] Total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA using a transcriptase kit (Takara, Otsu, Japan). qRT-PCR was then performed using TB Green PCR Master Mix (Takara, Otsu, Japan) and a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, CA, USA). Primer sequences are shown in Table 2.

[0046] Table 2 Primer sequences

[0047] Primers Forward sequence (5′→3′) Reverse sequence (5′→3′) PHF20 (human) ATGGCCTGCAGCTCAAGATGA CTCCCCTGAGTGCTGTTTCCA β-tubulin (human) CATGGACTCTGTTCGCTCAGG CCTTTGGCCCAGTTGTTACCT

[0048] Detection of PHF20 by immunohistochemical staining analysis:

[0049] Tissue microarrays (K054Sk01) (bioaitech, Xi'an, China) were fixed in 4% paraformaldehyde and transferred to PBS after fixation. The tissue microarrays were dewaxed in a series of increasing concentrations of xylene and ethanol solutions and then hydrated. To expose antigenic sites, heat-induced antigen retrieval (HIER) was performed. Endogenous peroxidase activity was blocked with 3% H2O2 solution and blocked with bovine serum albumin (BSA). The tissue microarrays were incubated with specific primary antibodies at 4°C overnight. After washing, secondary antibodies with detection tags (such as HRP or FITC) were incubated at room temperature for 1 hour. After washing, a chromogenic substrate (such as DAB) was used for color development. After sealing, positive reactions were observed and recorded using a microscope, and photographs were taken for archiving.

[0050] Experimental Example 2

[0051] Flow cytometry detection of cell cycle:

[0052] The cell cycle was studied using a DNA staining cell cycle kit (Yeasen, Shanghai, China). Cells were harvested and fixed with 70% cold ethanol overnight at 4°C. The cells were resuspended in staining buffer and then incubated with RNase A solution and PI staining solution at 37°C in the dark for 30 minutes. The cell suspension was then analyzed using a FACS Calibur (BD Biosciences, Franklin Lakes, NJ, USA).

[0053] Flow cytometry detection of cell apoptosis:

[0054] Apoptosis was investigated using a DNA staining apoptosis kit (Novagen, Nanjing, China). Cells were harvested, washed with pre-chilled PBS, and resuspended in staining buffer. FITC and PI staining solutions were then added and incubated at 37°C in the dark for 10 minutes. The cell suspension was then analyzed using a FACS Calibur (BD Biosciences, Franklin Lakes, NJ, USA).

[0055] Scratch test:

[0056] The cells were seeded in a 6-well culture plate, transfected, and cultured to a nearly fully confluent monolayer. Use a sterile 200 μl pipette tip to gently scratch the cell layer horizontally along the culture plate to form a clear cell blank band (scratch). Gently wash the cell culture plate with phosphate-buffered saline (PBS) to remove loose cells and debris at the scratch, and add fresh complete culture medium. Return the culture plate to a 37°C, 5% CO2 incubator, and take photos of the scratch area at set observation time points according to experimental requirements to record cell migration. Finally, use image processing software to analyze the photos taken, measure the initial width of the scratch area and the width at subsequent time points, and calculate the cell migration distance or scratch closure rate.

[0057] Experimental Example 3

[0058] Transwell transmembrane assay:

[0059] 1. Transwell transmembrane assay to measure the migration ability of skin squamous cell carcinoma cells

[0060] The transfected cells were cultured until the logarithmic growth phase, and the cell suspension concentration was adjusted with serum-free medium. A Transwell membrane with an 8.0 μm pore size (Jie Te, Guangzhou, China) was selected, and the cell suspension was evenly added dropwise to the upper chamber of the Transwell membrane. Complete medium with 15% FBS was added to the lower chamber. The Transwell device was placed in an incubator at 37°C and 5% CO2 for a certain period of time, then fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Biyuntian, Beijing, China). The upper chamber side of the Transwell membrane was gently wiped with a cotton swab to remove cells that did not pass through the membrane. Finally, the cells were observed and counted under a microscope.

[0061] 2. Transwell transmembrane assay to measure the invasive ability of skin squamous cell carcinoma cells

[0062] A Transwell membrane with an 8.0 μm pore size (Jie Te, Guangzhou, China) was used. Matrigel:DMEM medium was pre-added to the upper chamber at a ratio of 1:8. Transfected cells were cultured until the logarithmic growth phase, and the cell suspension concentration was adjusted with serum-free medium. The cell suspension was evenly added dropwise to the upper chamber of the Transwell membrane, and complete medium containing 15% FBS was added to the lower chamber. The Transwell device was placed in an incubator at 37°C and 5% CO2 for a specified period of time. After incubation, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Biyuntian, Beijing, China). The upper chamber of the Transwell membrane was gently wiped with a cotton swab to remove cells that had not crossed the membrane. Finally, the cells were observed and counted under a microscope.

[0063] Experimental Example 4

[0064] Analysis of PHF20 expression in cutaneous squamous cell carcinoma:

[0065] 1. Tissue Microarray

[0066] In this study, we used tissue microarray technology to analyze the expression pattern of PHF20 in human cutaneous squamous cell carcinoma tissues, adjacent non-cancerous tissues, and normal skin tissues. The basic characteristics of the tissue samples are summarized in Table 3. Figure 1 A shows the immunohistochemical staining results of PHF20 in different tissue samples, and Figure 1 B presents the corresponding semi-quantitative analysis data. The analysis results show that the expression level of PHF20 in skin squamous cell carcinoma tissue is significantly higher than that in adjacent tissues and normal skin tissues, and its expression level shows an upward trend as the malignancy of the tumor increases ( Figure 1 C, Table 4).

[0067] 2. Cell Lines

[0068] In addition, we also detected the protein expression level of PHF20 in two human skin squamous cell carcinoma cell lines, A431 and SCC13, and compared them with human epidermal keratinocytes (Hacat) as a control. The results showed that the expression level of PHF20 in cancer cell lines was significantly higher than that in normal cell lines ( Figure 2 ).

[0069] In conclusion, PHF20 expression is upregulated in human cutaneous squamous cell carcinoma.

[0070] Effects of PHF20 gene knockout on the cell cycle of human skin squamous cell carcinoma:

[0071] To verify the efficiency of siRNA-mediated PHF20 gene knockdown in human skin squamous cell carcinoma cell lines, this study used quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting to detect the mRNA and protein expression levels of PHF20. The relevant results are shown in Figure 3 .

[0072] Considering the impact of cell cycle distribution on cell proliferation, we performed cell cycle analysis on two human skin squamous cell carcinoma cell lines. Flow cytometry data showed that after PHF20 gene knockout, the proportion of S phase cells increased in both cell lines, showing S phase arrest ( Figure 4 In addition, the expression levels of cyclins D1 and E were reduced in PHF20 knockout cells ( Figure 5 These findings suggest that PHF20 may affect the cell cycle distribution of cutaneous squamous cell carcinoma and accelerate its proliferation by regulating the expression of cell cycle proteins.

[0073] Experimental Example 5

[0074] Effects of PHF20 gene knockout on apoptosis in human skin squamous cell carcinoma cells:

[0075] In order to explore the role of PHF20 in regulating apoptosis in human skin squamous cell carcinoma cells, flow cytometry was used to analyze changes in cell apoptosis. The experimental results showed that normal skin squamous cell carcinoma cells have a low apoptosis rate, but when PHF20 expression is inhibited, the cell apoptosis rate, especially the late apoptosis rate, increases significantly (see Figure 6 In addition, the detection of protein levels further confirmed this finding: in PHF20 silenced cells, Caspase-3 protein cleavage activity was enhanced (see Figure 7 These results together reveal the important function of PHF20 in inhibiting cell apoptosis.

[0076] Effects of PHF20 gene knockout on metastasis of human cutaneous squamous cell carcinoma:

[0077] 1. Effects of PHF20 gene knockout on migration and invasion of human cutaneous squamous cell carcinoma

[0078] Migration and invasion play a vital role in the progression of skin squamous cell carcinoma, especially in the metastasis process. First, the scratch test ( Figure 8 ) and transwell experiments ( Figure 9 ), we found that the loss of PHF20 significantly reduced the migration and invasion ability of skin squamous cell carcinoma cell lines. Furthermore, we observed that the expression levels of two key tumor metastasis regulators, matrix metalloproteinase 2 (MMP-2) and matrix metalloproteinase 9 (MMP-9), were suppressed when PHF20 was knocked out. Figure 10 These results reveal a role for PHF20 in enhancing migration and invasion of cutaneous squamous cell carcinoma cells.

[0079] 2. Effect of PHF20 gene knockout on epithelial-mesenchymal transition in human cutaneous squamous cell carcinoma

[0080] Epithelial-mesenchymal transition (EMT) is a biological process in which epithelial cells transform into mesenchymal cells. EMT biomarkers, including the epithelial phenotype marker E-cadherin and the mesenchymal phenotype marker N-cadherin, were analyzed by Western blot. PHF20 knockout increased E-cadherin expression and decreased N-cadherin expression ( Figure 10 ). Therefore, PHF20 plays an active role in promoting the EMT process of skin squamous cell carcinoma cells.

[0081] In summary, knockout of the PHF20 gene can significantly inhibit the metastatic ability of human cutaneous squamous cell carcinoma, providing a new potential target for the treatment of squamous cell carcinoma.

[0082] Table 1 Basic characteristics of tissue microarray samples

[0083]

[0084]

[0085] Table 2 PHF20 staining in skin squamous cell carcinoma tissues (n=38)

[0086]

[0087]

[0088] a Comparisons between age groups ≥60 years and those less than 60 years, and between males and females were performed using t-tests; b Comparison among grade, stage, and TNM stage, analysis of variance.

Claims

1. Use of a PHF20 inhibitor in the preparation of an anti-skin cancer drug, wherein the skin cancer is cutaneous squamous cell carcinoma, and the PHF20 inhibitor is an siRNA corresponding to the PHF20 gene, wherein the oligonucleotide sequences of the siRNA corresponding to the PHF20 gene are shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3: SEQ ID NO.1:UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT SEQ ID NO.2: GGAGAAAACACGAUGAAAATTUUUUCAUCGUGUUUUCUCCTT SEQ ID NO. 3: CUACAAAAGACAAGGAAAATTUUUUCCUUGUCUUUUGUAGTT.

2. The use according to claim 1, characterized in that The PHF20 inhibitor is used for preparing an oral preparation or an injectable preparation for treating and / or preventing skin cancer.

Citation Information

Patent Citations

  • Method of providing information for cancer cell using PHF20

    KR1020170109340A

  • A composition comprising PHF20 inhibitor for preventing or treating fatty liver disease

    KR1020180137222A