Construction and Application of a Corynebacterium glutamicum Mutant Strain Producing L-Serine

Abstract

Construction and application of a Corynebacterium glutamicum mutant strain producing L-serine, belonging to the technical field of fermentation engineering. In this invention, Corynebacterium glutamicum A36 was used as the starting strain. Based on the study of amino acid transporters, key sites of the L-serine transporter were mutated to construct 19 recombinant strains. Among them, mutant strains A36-SerE E277H , A36-SerE E277K and A36-SerE E277M all significantly increased the production of L-serine. When the mutant strains were cultured in shake flasks for 120 h, the highest production of L-serine could reach 46.57 g / L, which was 1.51 times that of the original strain.

Description

Technical Field

[0001] The present invention relates to the technical field of fermentation engineering, and particularly to the construction and application of a Corynebacterium glutamicum mutant strain producing L-serine. Background Art

[0002] L-serine is a non-essential amino acid and has wide applications in the fields of medicine, food, cosmetics, etc. Corynebacterium glutamicum is a food safety-grade strain and is widely used in the production of amino acids such as L-glutamic acid, L-lysine, and L-valine. Corynebacterium glutamicum is a safe industrial microorganism and can use cheaper culture media as raw materials. Therefore, Corynebacterium glutamicum shows great potential for the production of L-serine and its derivatives. However, general Corynebacterium glutamicum cannot utilize saccharide raw materials to ferment and produce L-serine.

[0003] Currently, domestic and foreign research on the production of L-serine by Corynebacterium glutamicum focuses on the molecular modification of its synthesis and degradation pathways. Stolz et al. used Corynebacterium glutamicum ATCC13032 that does not produce L-serine as the starting strain, and the recombinant strain constructed had an L-serine production of 36.2 g / L when using glucose and fructose as mixed carbon sources (cited from the literature: Stolz M, Peters-Wendisch P, Etterich H, Gerharz T, Faurie R, Sahm H, Fersterra H, Eggeling L. Reduced folate supply as a key to enhanced L-serine production by Corynebacterium glutamicum. Appl Environ Microbiol. 2007 Feb;73(3):750-5.). Lai Shujuan et al. strengthened the expression of 3-phosphoglycerate kinase (PGK) in Corynebacterium glutamicum ATCC13032, increased the synthesis of the L-serine precursor 3-phosphoglycerate, and improved the production of L-serine (cited from the literature: Lai Shujuan, Zhang Yun, Liu Shuwen, etc. Metabolic engineering transformation and metabolic flux analysis of Corynebacterium glutamicum producing L-serine [J]. Science in China: Life Sciences, 2012, 42(04):295-303.).

[0004] In the early stage of this research group, a wild-type Corynebacterium glutamicum SYPS-062 capable of fermenting L-serine using saccharide raw materials was screened from nature. Using it as the starting strain, a mutant strain C. glutamicum SYPS-062-33a was obtained through multiple rounds of ARTP mutagenesis. The L-serine yield of this mutant strain increased by 65% and reached 11.0 g / L, and the accumulation of by-products L-alanine and L-valine also increased significantly. Further, the feedback inhibition of the key enzyme in the L-serine synthesis pathway was relieved in the mutant strain, the degradation pathway was knocked out, and the by-product accumulation pathway was blocked and weakened. The obtained recombinant strain C. glutamicum SYPS-06233aΔSSA (abbreviated as ΔSSA) (CGMCC NO.8668) had an L-serine shake flask yield of up to 26.25 g / L, which was 3.9 times that of the wild-type strain. Chinese Patent CN201510570110.6 discloses a method for promoting the growth of Corynebacterium glutamicum and producing L-serine. During the cultivation of Corynebacterium glutamicum SYPS-062-33aΔSSA, protocatechuic acid was added, and the final yield reached 19.75 g / L. Chinese Patent CN201310389798.9 discloses a method for constructing a Corynebacterium glutamicum SYPS-062 resistant to L-serine feedback inhibition, which was obtained by genetically modifying the gene encoding 3-phosphoglycerate dehydrogenase serA at the genomic level of Corynebacterium glutamicum SYPS-062. In shake flask fermentation, the yield of the recombinant strain was 21-26 g / L, which was nearly 2.4 times higher than that of the starting strain; Chinese Patent CN202011001880.6 discloses a Corynebacterium glutamicum containing an aminodeoxybranch acid synthase mutant, and the yield of fermenting L-serine reached 30.4 g / L.

[0005] Although great results have been achieved in genetically engineering the L-serine synthesis and degradation pathways, in order to apply to industrial-scale production, the current L-serine yield still needs to be improved. The transport of amino acids out of the cell is an important prerequisite for their accumulation in the culture medium. Therefore, in order to achieve large-scale production of amino acids, the transport system has received increasing attention. In the past few decades, many amino acid export proteins have been identified in Corynebacterium glutamicum and Escherichia coli, and metabolic engineering has been used to improve the amino acid yield; in Corynebacterium glutamicum, only 7 proteins have been identified as amino acid secretion transporters, involving the secretion of 13 amino acids. BrnFE is involved in the secretion of L-methionine, L-isoleucine, L-valine, and L-leucine; CgmA is involved in the secretion of L-arginine; LysE is involved in the secretion of L-lysine, L-arginine, L-citrulline, and L-ornithine, and MscCG is involved in the secretion of L-glutamate and L-aspartate; MscCG2 is involved in the secretion of L-glutamate; only the SerE and ThrE proteins have been identified to have the function of secreting and transporting L-threonine and L-serine.

[0006] Based on the discovery that SerE has the function of transporting L-serine, the present invention uses genetic engineering means to perform saturation mutagenesis on the key sites of the L-serine transporter SerE gene in the serine-producing bacterium A36. The recombinant bacterium A36-SerE after the mutation of SerE E277K significantly increases the L-serine production. Summary of the Invention

[0007] To solve the above problems, the present invention constructs a recombinant Corynebacterium glutamicum strain, so that Corynebacterium glutamicum can efficiently produce L-serine using sucrose as the main carbon source.

[0008] The present invention is achieved through the following technical solutions:

[0009] The first object of the present invention is to provide a recombinant Corynebacterium glutamicum strain, which is obtained by mutating the 277th amino acid of the L-serine transporter in the starting strain Corynebacterium glutamicum A36. That is, the coding gene (SerE E277K ) of the L-serine transporter mutant is integrated and expressed on the genome.

[0010] The amino acid sequence of the L-serine transporter in the starting strain is shown in SEQ ID NO.1:

[0011] SEQ ID NO.1: MNKQSAAVLMVMGSALSLQFGAAIGTQLFPLIGPWAVTSLRLFIAGLIMCLVIRPRLRSWTKKQWIAVLLLGLSLGGMNSLFYASIELIPLGTAVTIEFLGPLIFSAVLARTLKNGLCVALAFLGMALLGIDSLSGETLDPLGVIFAAVAGIFWVCYILASKKIGQLIPGTSGLAVALIIGAVAVFPLGATHMGPIFQTPTLLILALGTALLGSLIPYSLELSALRRLPAPIFSILLSLEPAFAAAVGWILLDQTPTALKWAAIILVIAASIGVTWEPKKMLVDAPLHSKTQREEASTHT.

[0012] In an embodiment of the present invention, the 277th amino acid of the L-serine transporter in the starting strain is mutated to any one of the following:

[0013] (1) Obtained by mutating the 277th glutamate of the L-serine transporter in the starting strain to lysine, named mutant strain A36-SerE E277K ;

[0014] (2) It is obtained by mutating the 277th glutamate of the L-serine transporter in the starting strain into histidine, and is named mutant strain A36-SerE E277H ;

[0015] (3) It is obtained by mutating the 277th glutamate of the L-serine transporter in the starting strain into methionine, and is named mutant strain A36-SerE E277M 。

[0016] In one embodiment of the present invention, the L-serine transporter mutant SerE E277K has the amino acid sequence shown in SEQ ID NO.2:

[0017] SEQ ID NO.2: MNKQSAAVLMVMGSALSLQFGAAIGTQLFPLIGPWAVTSLRLFIAGLIMCLVIRPRLRSWTKKQWIAVLLLGLSLGGMNSLFYASIELIPLGTAVTIEFLGPLIFSAVLARTLKNGLCVALAFLGMALLGIDSLSGETLDPLGVIFAAVAGIFWVCYILASKKIGQLIPGTSGLAVALIIGAVAVFPLGATHMGPIFQTPTLLILALGTALLGSLIPYSLELSALRRLPAPIFSILLSLEPAFAAAVGWILLDQTPTALKWAAIILVIAASIGVTWKPKKMLVDAPLHSKTQREEASTHT

[0018] In one embodiment of the present invention, the nucleotide sequence encoding the L-serine transporter mutant SerE E277K is shown in SEQ ID NO.3.

[0019] SEQ ID NO.3:

[0020] ATGAATAAACAGTCCGCTGCAGTGTTGATGGTGATGGGTTCCGCCCTATCCCTGCAATTTGGTGCTGCCATTGGAACGCAGCTTTTCCCCCTCATCGGCCCCTGGGCTGTCACCTCTTTAAGGCTGTTCATCGCAGGCTTGATCATGTGCCTGGTGATCCGCCCGCGACTTCGTTCCTGGACTAAAAAACAATGGATCGCCGTGCTGCTGTTGGGATTATCTCTTGGCGGAATGAACAGCCTGTTTTACGCATCCATCGAACTCATCCCGCTGGGCACCGCCGTGACCATTGAGTTCCTCGGCCCCCTGATTTTCTCCGCGGTGTTAGCCCGCACGCTGAAAAACGGATTGTGCGTGGCTTTAGCGTTTCTCGGCATGGCACTGCTGGGTATCGATTCCCTCAGCGGCGAAACCCTTGACCCACTCGGCGTCATTTTCGCAGCCGTCGCAGGAATCTTCTGGGTGTGCTACATCCTGGCATCAAAGAAAATCGGCCAACTCATCCCCGGAACAAGTGGCCTCGCCGTCGCACTGATCATCGGCGCAGTAGCAGTATTTCCGCTGGGTGCCACACACATGGGCCCGATTTTCCAGACCCCAACCCTACTCATCCTGGCGCTTGGCACAGCACTTCTCGGGTCGCTTATCCCCTATTCGCTGGAATTATCGGCACTGCGCCGACTCCCCGCCCCCATTTTCAGCATTCTGCTCAGCCTCGAACCGGCATTCGCCGCCGCCGTCGGCTGGATCCTGCTTGATCAAACCCCCACCGCGCTCAAGTGGGCCGCGATCATCCTTGTCATCGCGGCCAGCATCGGCGTCACGTGGAAGCCTAAAAAGATGCTTGTCGACGCGCCCCTCCACTCAAAAACGCAACGCGAAGAGGCGAGTACACACACCTAG。

[0021] The second object of the present invention is to provide a method for producing L-serine, using the recombinant Corynebacterium glutamicum strain as a fermentation strain to ferment and produce L-serine.

[0022] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum is inoculated into a seed medium for culture to obtain a seed solution, and then the seed solution is transferred to a fermentation medium for fermentative production of L-serine.

[0023] In one embodiment of the present invention, by mass percentage, the composition of the seed medium is as follows: glucose 1%-10%, brain heart infusion 1%-10%, ammonium sulfate 1%-5%, magnesium sulfate 0.01%-0.1%, dihydrogen phosphate 0.01%-0.1%, hydrogen phosphate 0.01%-0.1%.

[0024] In one embodiment of the present invention, by mass percentage, the composition of the fermentation medium is as follows: sucrose 5%-15%, ammonium sulfate 1%-5%, calcium carbonate 1%-5%, magnesium sulfate 0.01%-0.1%, ferric sulfate 0.001%-0.01%, manganese sulfate 0.001%-0.01%, dihydrogen phosphate 0.1%-0.5%, protocatechuic acid 30-50 mg / L, biotin 50 μg / L-70 μg / L, vitamin B1 450 μg / L-550 μg / L.

[0025] In one embodiment of the present invention, fermentation production is carried out using sucrose as a carbon source.

[0026] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum is added to a system containing a carbon source for fermentation when the OD 562 is 20-30.

[0027] In one embodiment of the present invention, fermentative production is carried out under the conditions of 25°C-35°C and 170 rpm-250 rpm.

[0028] The third object of the present invention is to provide the use of the recombinant Corynebacterium glutamicum, or the method in the preparation of L-serine or products containing L-serine in the biological and chemical fields.

[0029] The fourth object of the present invention is to provide a plasmid or vector containing the gene, and the vector is selected from the pK18mobsacB vector.

[0030] In one embodiment of the present invention, the plasmid pK18mobsacB is used to mutate the L-serine transporter gene SerE on the genome.

[0031] The present invention also provides a method for constructing a recombinant Corynebacterium glutamicum, that is, a method for site-directed mutagenesis of the L-serine transporter gene in Corynebacterium glutamicum A36, including the following steps:

[0032] (1) Acquisition of the target gene of L-serine transporter: The genomic DNA of Corynebacterium glutamicum A36 (CGMCC NO.15171) was extracted using the Bacterial Genomic DNA Extraction Kit from Shanghai Jierui Co., Ltd.; Using the genomic DNA of A36 as a template, a high-fidelity enzyme from Takara Co., Ltd. was used, and gene-specific primers were designed to amplify the target gene SerE, obtaining a recombinant fragment SerE with homologous arm fragments at both ends;

[0033] (2) Construction of recombinant plasmid: The recombinant fragment SerE was ligated to the linearized vector of pK18mobsacB to obtain a recombinant plasmid containing the recombinant fragment SerE;

[0034] (3) Construction of mutant plasmid: Mutant primers for the E277 site of L-serine transporter were designed to amplify the vector in the reverse direction to obtain a linearized vector with homologous arms, and the linearized vector was circularized using the in vitro homologous recombination enzyme from Novoprotein Co., Ltd. to obtain a mutant plasmid;

[0035] (4) Construction of recombinant Corynebacterium glutamicum: The mutant plasmid was electrotransformed into the competent cells of the host bacterium Corynebacterium glutamicum A36 in sequence; Screening was carried out using kanamycin and 10% sucrose plates, and then verified by PCR to obtain a recombinant bacterium with gene mutation. Among them, the nucleotide sequence of the coding gene of the L-serine transporter SerE E277K mutant is shown in SEQ ID NO.2; The deposit number of Corynebacterium glutamicum A36 is CGMCC NO.15171.

[0036] The present invention also provides a strain expressing the L-serine transporter NCgl0580.

[0037] Fermentation culture method of Corynebacterium glutamicum:

[0038] Corynebacterium glutamicum was inoculated into the fermentation medium and fermented for 120 h, and samples were taken at regular intervals to detect the biomass and amino acid concentration. The fermentation medium (g / L): sucrose 100; ammonium sulfate 30; KH2PO4 3; MgSO4·7H2O 0.5; FeSO4·7H2O 0.02; MnSO4·H2O 0.02; protocatechuic acid 30 mg; biotin 50 μg; thiamine hydrochloride 450 μg; calcium carbonate 60; Adjust the initial pH to 7.0.

[0039] The above technical solutions of the present invention have the following advantages compared with the prior art:

[0040] Transportation is an important approach in metabolic engineering for modifying strains to produce high yields of amino acids. So far, multiple amino acid transporters have been discovered in Corynebacterium glutamicum. However, currently, only the transporters ThrE and SerE have been reported to be able to transport L-serine. The present invention provides a novel L-serine transporter mutant, SerE E277K , which has the nucleotide sequence shown in SEQ ID NO:2, with a total length of 903 nucleotides and encoding 300 amino acids. By means of genetic engineering, the mutation of SerE was achieved in Corynebacterium glutamicum A36 that produces L-serine, and the yield of L-serine could be increased to 46.57 g / L. This provides a new idea for metabolic engineering to modify strains to increase the yield of L-serine. Specific embodiments

[0041] The present invention will be further described below in conjunction with specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it. However, the specific embodiments cited are not intended to limit the present invention.

[0042] (I) Strains and plasmids:

[0043] The strain is Corynebacterium glutamicum A36 (deposited in the China General Microbiological Culture Collection Center, the deposit address is No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is January 11, 2018, the deposit number is CGMCC No. 15171, and the taxonomic name is Corynebacterium glutamicum).

[0044] The plasmid is pK18mobsacB (described in the literature Schafer A, Tauch, W Jager, et al. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene, 1994, 145(1): 69-73.).

[0045] (II) Measurement methods

[0046] Measurement of cell concentration: Take a certain amount of bacterial suspension and appropriately dilute it with deionized water, and measure the OD value at 562 nm using a UV 1600 visible light spectrophotometer.

[0047] Determination of amino acids: High-performance liquid chromatography (HPLC). Instrument: Agilent 1260 high-performance liquid chromatograph (equipped with a UV detector and an autosampler). Chromatographic conditions: Chromatographic column: C18 chromatographic column with the column model Vensusil AA (4.6×250 nm, 5 μm); Mobile phase: Mobile phase A: 7.6 g of anhydrous sodium acetate plus 925 mL of deionized water, stirred evenly (adjust the pH to 6.5 with glacial acetic acid), filtered through a 0.22 μm water membrane, and then 70 mL of acetonitrile was added (volume ratio 925 / 70); Mobile phase B: Acetonitrile-water (volume ratio 80 / 20) solution; Mobile phase C: Ultra-pure water; Mobile phase D: Acetonitrile. Flow rate: 1 mL / min, column temperature: 40 °C, injection volume: 10 μL. Sample preparation: 1 mL of fermentation broth was centrifuged at 12,000 rpm for 10 min. After the supernatant was appropriately diluted and filtered through a 0.22 μL membrane, high-performance liquid chromatography analysis was carried out.

[0048] (III) Culture medium

[0049] Seed culture medium: BHI 37 g / L, glucose 20 g / L, (NH4)SO4 10 g / L, MgSO4·7H2O 0.5 g / L, KH2PO4 0.2 g / L, NaH2PO4 0.3 g / L. 20 g / L of agar powder was additionally added to the solid culture medium.

[0050] Fermentation culture medium: Sucrose 100 g / L; Ammonium sulfate 30 g / L; KH2PO4 3 g / L; MgSO4·7H2O 0.5 g / L; FeSO4·7H2O 0.02 g / L; MnSO4·H2O 0.02 g / L; Protocatechuic acid 30 mg / L; Biotin 50 μg / L; Thiamine hydrochloride 450 μg / L; Calcium carbonate 60 g / L; Adjust the initial pH to 7.0 with NaOH.

[0051] LBHIS culture medium: Peptone 5 g / L, yeast extract 2.5 g / L, sodium chloride 5 g / L, BHI 18.5 g / L, D-sorbitol 91 g / L. 20 g / L of agar powder was added to prepare LBHIS solid culture medium.

[0052] (IV) Methods involved in strain construction

[0053] Gibson assembly method: For specific steps, refer to Gibson et al., Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods, 2009, 6(5): 343-5. Electrotransformation of Corynebacterium glutamicum: The steps are described in Luo Yuchang, Metabolic engineering of Corynebacterium glutamicum SYPS-062 for L-serine production [D]. Jiangnan University, 2013.

[0054] Example 1: Construction of a mutant strain with site-directed mutation of the transporter SerE in Corynebacterium glutamicum A36 E277

[0055] 1. Construction of mutant plasmids

[0056] Digest plasmid pK18mobsacB with restriction enzymes EcoR I and Xba I to obtain the linearized pK18mobsacB vector;

[0057] According to the genome of Corynebacterium glutamicum A36 (CGMCC NO. 15171), amplify the SerE fragment using primers SerE-F / R, and assemble the SerE fragment with the linearized pK18mobsacB vector by Gibson assembly method to obtain the integration plasmid pK18mobsacB-SerE.

[0058] Using plasmid pK18mobsacB-SerE as a template, reverse amplify the SerE fragments with different mutant sequences using 19 pairs of mutant primers; use the in vitro homologous recombination enzyme from Novoprotein to circularize the linearized vector to obtain mutant plasmids. E277

[0059] 2. Construction of mutant strains

[0060] (1) Electrotransform the mutant plasmid pK18mobsacB-SerE E277 into the competent cells of Corynebacterium glutamicum A36, spread the transformed bacterial solution on LBHIS medium containing 100 mg / mL kanamycin, and culture at 30 °C until single colonies grow; pick the single colonies on the plate and inoculate them into the wells of a 3 mL seed medium, culture at 30 °C and 120 rpm for 24 h, take 1 μL of the bacterial solution, dilute it 3000 times with sterile water, spread it on 10% sucrose medium, culture at 30 °C for 3 d, pick the single colonies for verification, and obtain the correctly mutated transformants for fermentation verification.

[0061] Table 1 Mutant strains of Corynebacterium glutamicum constructed in Example 1

[0062]

[0063] Table 2. Primers used in Example 1

[0064]

[0065]

[0066] Example 2: Fermentation culture method of Corynebacterium glutamicum mutant strain

[0067] Inoculate the Corynebacterium glutamicum mutant strain prepared in Example 1 on a seed plate and streak it in three zones. After culturing for 3 days, pick single colonies and streak them densely on the seed plate. After culturing for 3 days, inoculate the strains on the plate into 20 mL of seed liquid and culture overnight at 30 °C and 120 rpm for about 10 - 12 h until the OD 562 reaches 25, and inoculate it into a 250 mL conical flask containing 25 mL of fermentation medium to make the OD 562 reach 1. Ferment and culture at 30 °C and 120 rpm for 5 days. 60 g / L of calcium carbonate is added to buffer the pH during fermentation and maintain the pH at 6.5 - 7.5. Measure its OD 562 and amino acid concentration every 12 h. The L-serine yields of the Corynebacterium glutamicum mutant strain are shown in Table 3. The yields of A36-SerE E277H 、A36-SerE E277K and A36-SerE E277M can reach 37.12 g / L, 35.64 g / L and 33.58 g / L respectively

[0068] Table 3 Fermentation results of mutant strains

[0069]

[0070]

[0071] Example 3: Re-screening fermentation of Corynebacterium glutamicum mutant strain

[0072] Perform fermentation re-screening evaluation on the high-yield Corynebacterium glutamicum mutant strains A36-SerE E277H 、A36-SerE E277K and A36-SerE E277M according to the method of Example 2. The L-serine yields of the Corynebacterium glutamicum mutant strain are shown in Table 4. The yields of A36-SerE E277H 、A36-SerE E277K and A36-SerE E277M can reach 40.37 g / L, 46.57 g / L and 36.43 g / L respectively. The yield of A36-SerE E277KThe L-serine production of [the mutant] was 51.40% higher than that of the starting strain A36, indicating that the SerE mutant was successfully applied to improve L-serine production.

[0073] Table 4 Fermentation results of the rescreening of mutant strains

[0074]

[0075] Obviously, the above examples are merely illustrations for clear explanation and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A recombinant Corynebacterium glutamicum strain, characterized in that, The recombinant Corynebacterium glutamicum is obtained by mutating the 277th amino acid of the L-serine transporter in the starting strain Corynebacterium glutamicum A36; The mutation of the 277th amino acid of the L-serine transporter in the starting strain is any one of the following: (1) obtained by mutating the 277th glutamate of the L-serine transporter in the starting strain to lysine; (2) obtained by mutating the 277th glutamate of the L-serine transporter in the starting strain to histidine; (3) obtained by mutating the 277th glutamate of the L-serine transporter in the starting strain to methionine; The amino acid sequence of the L-serine transporter in the starting strain is as shown in SEQ ID NO.

1.

2. A method for producing L-serine, characterized in that, Using the recombinant Corynebacterium glutamicum described in claim 1 as the fermentation strain to ferment and produce L-serine.

3. The method according to claim 2, wherein Inoculating the recombinant Corynebacterium glutamicum into a seed medium for culture to obtain a seed liquid, and then transferring the seed liquid to a fermentation medium to ferment and produce L-serine.

4. The method according to claim 3, characterized in that By mass percentage, the composition of the seed medium is: glucose 1% - 10%, brain heart infusion 1% - 10%, ammonium sulfate 1% - 5%, magnesium sulfate 0.01% - 0.1%, dihydrogen phosphate 0.01% - 0.1%, hydrogen phosphate 0.01% - 0.1%.

5. The method according to claim 3, wherein By mass percentage, the composition of the fermentation medium is: sucrose 5% - 15%, ammonium sulfate 1% - 5%, calcium carbonate 1% - 5%, magnesium sulfate 0.01% - 0.1%, ferric sulfate 0.001% - 0.01%, manganese sulfate 0.001% - 0.01%, dihydrogen phosphate 0.1% - 0.5%, protocatechuic acid 30 - 50 mg / L, biotin 50 μg / L - 70 μg / L, vitamin B1 450 μg / L - 550 μg / L.

6. The method according to claim 2, characterized in that, Using sucrose as the carbon source for fermentation production.

7. The method according to claim 2, characterized in that, Add the recombinant Corynebacterium glutamicum strain to a system containing a carbon source for fermentation when the OD 562 is 20 - 30.

8. The method according to claim 2, characterized in that Carrying out fermentation production under the conditions of 25°C - 35°C and 170 rpm - 250 rpm.

9. Use of the recombinant Corynebacterium glutamicum described in claim 1, or any of the methods described in claims 2 - 8 in the preparation of L-serine or products containing L-serine in the biological and chemical fields.

Images