Molecular Marker Ms_Chr2_57847082 Closely Linked to the Drought Resistance Trait of Alfalfa and Its Application

By developing molecular markers closely linked to alfalfa drought resistance traits, the problem of lack of accurate selection tools during breeding is solved, and the rapid identification of drought resistance traits is achieved, and breeding efficiency and drought resistance are improved.

CN118166147BActive Publication Date: 2025-06-17LANZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410346253.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-25
Publication Date
2025-06-17
Estimated Expiration
2044-03-25

AI Technical Summary

Technical Problem

Alfalfa started late in breeding, and the development of molecular markers related to drought resistance was very limited, resulting in a lack of accurate and rapid selection tools during the breeding process, affecting the drought tolerance and yield of crops.

Method used

A pair of molecular markers closely linked to the drought resistance trait of alfalfa was developed, located on chromosome 2, and PCR amplification was designed for PCR.

Benefits of technology

The rapid and accurate identification of the drought resistance traits of alfalfa has been achieved, the breeding process has been simplified, and the breeding efficiency and drought resistance of varieties have been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118166147B_ABST
    Figure CN118166147B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker Ms_Chr2_57847082 closely linked to the drought resistance trait of alfalfa and its application. By using GWAS (Genome-Wide Association Study) combined with molecular marker development, the drought resistance trait of alfalfa was mapped and analyzed, and a polymorphic, stable and reliable InDel molecular marker Ms_Chr2_57847082 closely linked to the drought resistance trait was obtained. The molecular marker in the present invention can be used for the assisted selection of molecular markers in natural populations and the offspring of hybrid populations of different drought-tolerant alfalfa. This method is simple, rapid and accurate, which is beneficial to the screening and utilization of alfalfa drought-resistant germplasm, can not only accelerate the breeding process, but also improve the breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to molecular markers closely linked to the drought-resistant traits of alfalfa. Background Art

[0002] Breeding techniques are developing rapidly. Among them, gene editing technology represents the latest progress in the fifth generation of breeding techniques and is expected to be widely applied in agricultural production soon. The key to gene editing technology lies in accurately regulating genes that affect key traits, which is the basis for realizing gene function improvement and directional breeding. Therefore, it is crucial to identify key candidate genes and their functions. During the breeding process, the selection of target traits depends to a large extent on genotype and phenotype. Traditional breeding techniques mainly rely on phenotypic identification, but this method has a long cycle and is easily affected by the environment. In contrast, molecular marker-assisted selection technology has the advantages of accuracy, speed, and high efficiency, and has been widely applied in more and more crops. The research and application of molecular marker technology based on genome-wide association analysis have become one of the important hotspots and competitive fields in the current breeding field.

[0003] Alfalfa (Medicago sativa L.), as the forage with the longest history and the largest planting area in China, has significant advantages in livestock products, economy, and ecological governance. Alfalfa belongs to the legume family and can fix nitrogen. Using it as green manure helps to maintain biodiversity and the health of the agricultural ecosystem, reduces the use of chemical fertilizers, and maintains the balance of the nitrogen cycle. In addition, alfalfa also has ecological value, such as attracting bees, reducing soil and water loss and soil erosion. It has been successfully used for soil salinization treatment and high-nitrogen soil remediation in countries such as Australia and the United States. As an important source of protein, alfalfa provides 15% to 22% of crude protein grass products every year, which is easy for animals to digest and absorb. Alfalfa is rich in various beneficial components, such as calcium, iron, selenium, vitamins B, C, K, and carotene, and also contains bioactive substances such as alfalfa polysaccharides, which can improve the digestion and absorption rate of feed for meat sheep and broilers. Alfalfa hay meal is a raw material rich in nutrients, which can reduce feed costs, improve reproductive performance, reduce constipation, and at the same time, as a concentrate supplement, save feed raw materials. Therefore, the development of molecular markers and marker-assisted selection breeding are also gradually carried out in alfalfa, but there is still a serious lack of a large number of reliable molecular markers.

[0004] The drought-resistant breeding of alfalfa is crucial for improving the drought tolerance of crops, increasing yields, and reducing resource consumption. Against the backdrop of climate change and increasingly scarce water resources, developing drought-resistant varieties can enhance the growth adaptability of agricultural crops under drought conditions, reduce disaster risks, maintain the stability of agricultural production, promote the sustainable development of agriculture, and at the same time increase economic benefits for farmers. It is of great significance for ensuring food security and the continuous improvement of the ecological environment. However, the breeding of alfalfa started late, and reports on marker development and mapping are very limited. Therefore, the development of molecular markers related to alfalfa drought resistance is of great significance for constructing an assisted selection breeding system, improving germplasm resources, and breeding new varieties. Summary of the Invention

[0005] One of the objectives of the present invention is to provide a molecular marker closely linked to the drought-resistant trait of alfalfa.

[0006] Another objective of the present invention is to provide the application of the above-mentioned molecular marker closely linked to the drought-resistant trait of alfalfa.

[0007] To achieve the above objectives, the present invention adopts the following technical solutions:

[0008] The present invention discloses a pair of molecular markers closely linked to the drought-resistant trait of alfalfa, which are located on chromosome 2 of alfalfa, and the molecular marker is Ms_Chr2_57847082.

[0009] A primer pair for amplifying the molecular marker closely linked to the drought-resistant trait of alfalfa, and the primer pair sequences corresponding to the molecular marker Ms Chr2_57847082 are as follows:

[0010] Ms_Chr2_57847082-F: ACTTAGTTCCTTAGAAACGTGCTTAGTC (shown in SEQ ID NO.1);

[0011] Ms_Chr2_57847082-R: CTATAGGCATAATTGTTATAGGAGTCTCAA (shown in SEQ ID NO.2).

[0012] The present invention also discloses the application of the above-mentioned molecular marker primer pair in the drought-resistant assisted breeding of alfalfa. That is to say, the molecular marker of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting whether the molecular marker of the present invention exists, the drought-related traits of alfalfa varieties can be identified. The detection can use the PCR detection method, specifically the above-mentioned molecular marker primer pair, and the detection can also be carried out by sequencing.

[0013] The present invention also discloses the application of the above-mentioned molecular markers in identifying the drought resistance traits of alfalfa, especially in screening and identifying the high or low drought resistance of alfalfa. Specifically, the specific steps for identifying whether alfalfa has drought resistance traits are as follows:

[0014] (1) Using the DNA of the test germplasm as the template for PCR amplification, and using the marker Ms_Chr2_57847082 as the primer, the reaction system for PCR amplification is shown in Table 1:

[0015] Table 1 Reaction system for PCR amplification

[0016]

[0017] PCR amplification program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 10 min; storage at 4°C.

[0018] (2) Agarose gel electrophoresis detection of PCR products: Take 3 μL and judge the drought resistance result of alfalfa according to the band results.

[0019] Perform PCR amplification using the primer pair Ms_Chr2_57847082-F and Ms_Chr2_57847082-R. If the PCR amplification product has only one characteristic band with a length of 285 bp as shown in SEQ ID NO.4, then the alfalfa is a non-drought-resistant type; if the PCR amplification product has only one characteristic band with a length of 315 bp as shown in SEQ ID NO.5, or both a characteristic band with a length of 285 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 315 bp as shown in SEQ ID NO.5, then the alfalfa is a drought-resistant type.

[0020] In addition, the present invention also protects a kit for identifying the drought resistance traits of alfalfa. The kit contains the primer pair Ms_Chr2_57847082-F and Ms_Chr2_57847082-R. The other components of the kit are all conventional reagents. Specifically, it also includes 10×PCR buffer, dNTP, and Taq DNA polymerase. The present invention has no special restrictions on the concentration of the primer pair, and the well-known primer concentration in the art can be used. The present invention has no special restrictions on the sources of the 10×PCR buffer, dNTP, and Taq DNA polymerase, and the common reagents for ordinary PCR amplification in the art can be used.

[0021] The kit of the present invention can quickly identify the drought-resistant traits of alfalfa and can also quickly identify the drought-resistant genotypes of alfalfa. For the specific method, refer to the specific steps for identifying whether alfalfa has drought-resistant traits. By performing electrophoresis detection and / or sequencing on the PCR amplification products, if there is only one characteristic band with a length of 285 bp as shown in SEQ ID NO.4 in the PCR amplification products, then the alfalfa is a homozygous non-drought-resistant genotype; if there is only one characteristic band with a length of 315 bp as shown in SEQ ID NO.5 in the PCR amplification products, then the alfalfa is a homozygous drought-resistant genotype; if there is both a characteristic band with a length of 285 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 315 bp as shown in SEQ ID NO.5 in the PCR amplification products, then the alfalfa is a heterozygous drought-resistant genotype.

[0022] The present invention has the following advantages:

[0023] (1) Screening with markers linked to drought-resistant traits is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which is beneficial to improving efficiency and saving costs.

[0024] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products, and high specificity, and can be simply, quickly, and high-throughput applied to alfalfa drought-resistant breeding practice and variety identification. Description of the Drawings

[0025] Figure 1 It is the genome-wide association analysis result of alfalfa drought tolerance, which is the Manhattan plot obtained based on the MLM model analysis. The InDel positions associated with the present invention are shown as red dots.

[0026] Figure 2 It is the box plot of the genotype corresponding RWC distribution of the Ms_Chr2_57847082 locus in the alfalfa population in Example 1 of the present invention. 0 / 0 means the genotype of the Ms_Chr2_57847082 locus is a homozygous non-drought-resistant genotype, 0 / 1 means the Ms_Chr2_57847082 locus is a heterozygous drought-resistant genotype, and 1 / 1 means the genotype of the Ms_Chr2_57847082 locus is a homozygous drought-resistant genotype. The dots are the extreme values of the data, and the One way ANOVA test is used to test the differences.

[0027] Figure 3 It is the partial sequence alignment result of drought-tolerant varieties and drought-sensitive varieties in the drought-tolerance associated region.

[0028] Figure 4 It is the electrophoresis map of the amplified molecular markers of 22 alfalfa germplasm resources, and the concentration of the agarose gel is 2%.

[0029] In the figure, M represents the DNA marker. Specific implementation manners

[0030] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, the specific experimental methods involved in the following embodiments are all conventional methods or are implemented according to the conditions recommended in the manufacturer's instructions unless otherwise specified.

[0031] Unless otherwise specified, the technical means used in the embodiments are conventional means well-known to those skilled in the art. The test methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be obtained by purchasing from the market.

[0032] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are only for illustrative purposes.

[0033] Example 1 Development of molecular markers related to alfalfa drought resistance

[0034] The present invention uses the ratio (RWC) of the water content retained in the treated leaves to the total water storage capacity of the leaves to measure the drought resistance of alfalfa. The higher the ratio, the less likely the leaves are to lose water; the lower the ratio, the more likely the leaves are to lose water. After measuring the RWC of the alfalfa population, through GWAS analysis, an InDel locus ( Figure 1 red locus), named Ms_Chr2_57847082, was located in alfalfa. This locus is located at the 57847082nd locus on chromosome 2 of the alfalfa reference genome. The first allele genotype is the 0 / 0 type; the second allele genotype is the 1 / 1 type; the third allele genotype is the 0 / 1 type. The box plot of the relative leaf water content corresponding to the genotype of the Ms_Chr2_57847082 locus in the population ( Figure 2 ) shows that the drought tolerance of alfalfa lines with the genotype of 0 / 1 is significantly higher than that of alfalfa with the genotype of 0 / 0, and the drought tolerance of alfalfa lines with the genotype of 1 / 1 is significantly higher than that of alfalfa with the genotypes of 0 / 0 and 0 / 1. At the 57847082nd locus on chromosome 2 of alfalfa, the insertion / deletion fragment

[0035] GACAATTATTTCTCGAAGATGCTTATATATT (shown in SEQ ID NO.3) ( Figure 3) has an impact on the drought tolerance of alfalfa. The alfalfa lacking the fragment shown in SEQ ID NO.3 is drought-sensitive alfalfa, and the alfalfa inserted with the fragment shown in SEQ ID NO.3 is drought-tolerant alfalfa.

[0036] According to this InDel variation and its upstream and downstream sequences, the following primers were designed using primer 5.0 software:

[0037] Ms_Chr2_57847082-F: ACTTAGTTCCTTAGAAACGTGCTTAGTC (shown in SEQ ID NO.1);

[0038] Ms_Chr2_57847082-R: CTATAGGCATAATTGTTATAGGAGTCTCAA (shown in SEQ ID NO.2);

[0039] Then, PCR amplification was performed on the test samples using these primers. The results showed that the PCR product of the homozygous drought-sensitive alfalfa sample had only a characteristic band of 285 bp, the PCR product of the homozygous drought-tolerant alfalfa sample had only a characteristic band of 315 bp, and the PCR product of the heterozygous alfalfa sample had both a characteristic band of 285 bp and a characteristic band of 315 bp.

[0040] Example 2 Verification of the accuracy of the molecular marker of the present invention

[0041] Twenty-two germplasms were identified. The specific germplasm materials used are shown in Table 2:

[0042] Table 2 Drought resistance and genotypes of 22 germplasm materials

[0043]

[0044]

[0045] 1) Using the genomic DNA of the alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain a PCR product;

[0046] The reaction system for PCR amplification was as follows: 10 - 100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×Taq PCR Master Mix, and made up to 20 μL with deionized water; The reaction program for the PCR amplification was preferably: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 25 s, for 35 cycles; extension at 72°C for 10 min. Electrophoresis separation was performed on a 2% agarose gel. After loading the samples, electrophoresis was carried out at a DC voltage of 140 V for 2 h, and then the PCR band patterns of each sample were read.

[0047] 2) Judging the drought tolerance of alfalfa according to the size of the PCR product: When the fragment shown in SEQ ID NO.3 is missing in the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-sensitive alfalfa;

[0048] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-tolerant alfalfa;

[0049] When the PCR product of the alfalfa to be identified has two bands, namely the band missing the fragment shown in SEQ ID NO.3 and the band inserted with the fragment shown in SEQ ID NO.3, the alfalfa to be identified is of heterozygous genotype.

[0050] Specifically, when the fragment shown in SEQ ID NO.3 is not present in the PCR product of the alfalfa to be identified and the band length of the PCR product is 285bp, the alfalfa to be identified is drought-sensitive alfalfa.

[0051] The sequence of SEQ ID NO.4 is as follows:

[0052]

[0053] When the fragment shown in SEQ ID NO.3 is missing in the PCR product of the alfalfa to be identified and the band length of the PCR product is 315bp, the alfalfa to be identified is drought-tolerant alfalfa.

[0054] The sequence of SEQ ID NO.5 is as follows:

[0055]

[0056] When the PCR product of the alfalfa to be identified has two bands, namely the band missing the fragment shown in SEQ ID NO.3 and the band inserted with the fragment shown in SEQ ID NO.3, and the lengths of the bands of the PCR product are 315bp and 285bp respectively, the alfalfa to be identified is of heterozygous genotype.

[0057] And, from Figure 4As can be seen from Table 1, 10 alfalfa materials amplified only one characteristic band of 285 bp, and the identification result was a homozygous drought-sensitive genotype (0 / 0). After measurement, the average relative leaf water content of these 10 alfalfa materials under drought was 0.484; 10 alfalfa materials amplified both a characteristic band of 285 bp and a characteristic band of 315 bp, and the identification result was a heterozygous drought-tolerant type (0 / 1). After measurement, the average relative leaf water content of these 10 alfalfa materials was 0.671, which was 0.187 higher than the average value of 10 drought-sensitive types. Two alfalfa materials amplified only one characteristic band of 315 bp, and the identification result was a homozygous drought-tolerant type. After measurement, the average relative leaf water content of these 2 alfalfa materials was 0.752, which was 0.268 higher than the average relative leaf water content of the homozygous drought-sensitive genotype and 0.081 higher than the average relative leaf water content of the heterozygous drought-tolerant genotype. Variance analysis showed that there was a highly significant difference in RWC between the drought-sensitive type and the drought-tolerant type (P < 0.05). The PCR detection results were consistent with the actual measurement results of the relative leaf water content. Therefore, the InDel molecular marker of the present invention can effectively identify the drought tolerance of alfalfa and can be used for the prediction and screening of drought-tolerant alfalfa varieties.

[0058] The above-described embodiments are only preferred embodiments of the present invention, which are only used to explain the present invention and do not limit the scope of implementation of the present invention. For those skilled in the art of this technology, of course, other implementation manners can be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker tightly linked to the drought resistance trait of alfalfa, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment ACAATTATTTCTCGAAGATGCTTATATATT on chromosome 2 of the alfalfa reference genome. The primer pair sequence corresponding to the molecular marker is: Ms_Chr2_57847082-F:ACTTAGTTCCTTAGAAACGTGCTTAGTC; Ms_Chr2_57847082-R: CTATAGGCATAATTGTTATAGGAGTCTCAA.

2. Use of the primer pair corresponding to the molecular marker described in claim 1 in identifying the drought resistance trait of alfalfa.

3. A method for identifying drought resistance traits of alfalfa, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification was performed using primer pairs Ms_Chr2_57847082-F and Ms_Chr2_57847082-R. If the PCR amplification product had only one characteristic band with a length of 285 bp as shown in SEQ ID NO.4, the alfalfa was not drought-resistant; if the PCR amplification product had only one characteristic band with a length of 315 bp as shown in SEQ ID NO.5, or had both one characteristic band with a length of 285 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 315 bp as shown in SEQ ID NO.5, the alfalfa was drought-resistant.

4. An application of a kit for identifying drought-resistant genotypes of alfalfa, characterized in that: The kit comprises a primer pair corresponding to the molecular marker described in claim 1.

5. The use according to claim 4, characterized in that: The PCR amplification products are subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 285 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous non-drought-resistant genotype; if the PCR amplification product has only one characteristic band with a length of 315 bp as shown in SEQ ID NO.5, the alfalfa is a homozygous drought-resistant genotype; if the PCR amplification product has both a characteristic band with a length of 285 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 315 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous drought-resistant genotype.

Citation Information

Patent Citations

  • Method for site-specific mutagenesis of medicago sativa gene by employing CRISPR / Cas9 system

    CN108866093A

  • Specific molecular marker for identifying authenticity of clover seeds and applications thereof

    CN110229929A