A lncRNA molecule and its application in preventing rotavirus replication

Abstract

The present invention belongs to the field of biomedicine technology, and specifically discloses a lncRNA molecule and an application thereof in resisting rotavirus replication. The present invention discloses a lncRNA molecule, whose nucleotide sequence is shown in SEQ ID No. 1. After in vitro and in vivo animal model detection, it is found that the lncRNA molecule is downregulated after rotavirus infection, and upregulating lncRNA-DARVR can significantly inhibit rotavirus replication.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a rotavirus proliferation-related lncRNA molecule and an application thereof in resisting rotavirus replication. Background Art

[0002] Rotavirus infection is the most common cause of diarrhea in infants and young children. Almost every child in the world has been infected with rotavirus at least once before the age of five. So far, there is no specific treatment. Although there are corresponding vaccines to prevent and control rotavirus infection, the number of cases of childhood gastroenteritis caused by RV infection still reaches about 125 million each year, resulting in about 200,000 deaths in children. RV belongs to the genus Reovirus and is a non-enveloped, icosahedral, double-stranded RNA virus. The genome is discontinuous and consists of 11 segments of double-stranded RNA, encoding 6 structural proteins (VP1-4, 6, 7) and 6 non-structural proteins (NSP1-6). After infecting cells, rotavirus releases its own nucleic acid into the cytoplasm, where it uses host factors to synthesize proteins for viral replication and packaging. Two hours after viral infection, viroplasm composed of NSP5 and NSP2 is formed in the cytoplasm, protecting rotavirus positive RNA from siRNA-induced degradation. Throughout the replication process, viral structural and non-structural proteins work together to participate in different stages of viral gene replication and viral particle assembly.

[0003] LncRNA is a type of non-coding RNA (ncRNA) with a length of more than 200 nucleotides (nt). It is transcribed by RNA polymerase II and III and does not have translation function. It plays an important regulatory role in various aspects of biology. Due to the complex and diverse mechanisms of lncRNA action, only a small number of lncRNA functions have been resolved so far, especially in virus research. With the development of high-throughput sequencing technology and bioinformatics, more and more host or virus-encoded lncRNAs have been discovered, and the modes of action of some lncRNA functions that regulate viral infection are being revealed. lncRNA can directly inhibit viral infection or inhibit further viral infection by activating pattern recognition receptors (PRRs), epigenetics, transcriptional and post-transcriptional levels to regulate innate immune responses. However, so far, there are relatively few studies on whether non-coding RNA, especially lncRNAs, play a regulatory role in the replication and proliferation of rotavirus, which urgently needs to be explored. Summary of the invention

[0004] One object of the present invention is to provide whether a lncRNAs molecule plays a regulatory role in the process of rotavirus entry, replication and proliferation.

[0005] The present invention discovers a new lncRNA molecule that regulates rotavirus proliferation by infecting host cells with isolated wild-type human rotavirus strains and performing full transcript sequencing. The nucleotide sequence is shown in SEQ ID No. 1, which is named LncRNA-DARVR in the present invention. It is differentially expressed in rotavirus-infected cells. Upregulating the lncRNA molecule has the function of inhibiting rotavirus proliferation, which is of great significance for preventing and treating diarrhea caused by rotavirus infection.

[0006] The present invention specifically provides the following technical solutions:

[0007] A lncRNA molecule, whose nucleotide sequence is shown as SEQ ID No. 1.

[0008] Furthermore, the product for regulating the expression of the lncRNA molecule is used in controlling the proliferation of rotavirus.

[0009] As an embodiment, the product is a product that upregulates the expression of lncRNA molecules, and inhibits the proliferation of rotavirus by upregulating the expression of lncRNA molecules.

[0010] As another embodiment, the product is a product that downregulates the expression of lncRNA molecules. It promotes the proliferation of rotavirus by downregulating the expression of lncRNA, and more specifically promotes the growth of rotavirus. It can be used to construct a cell model that highly expresses rotavirus for use in application fields such as detecting the effectiveness of drugs.

[0011] Use of a reagent for detecting the level of lncRNA in a sample to be tested in the preparation of a detection system for diagnosing rotavirus infection, wherein the nucleotide sequence of the lncRNA is shown in SEQ ID No. 1.

[0012] LncRNA-DARVR has antiviral effects. After rotavirus infects host cells, the expression level is negatively correlated with the rotavirus infection time. After viral infection, the expression level is downregulated relative to the normal cell expression level, which is an immune escape strategy made by the virus to adapt to host cells.

[0013] The use of the lncRNA molecule or a product for upregulating its expression level in the preparation of a drug for preventing and treating diarrhea caused by rotavirus infection.

[0014] The present invention also provides a kit for detecting rotavirus infection, which comprises reagent materials for detecting the level of lncRNA in a sample to be tested, wherein the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1.

[0015] Furthermore, the reagent material includes a primer pair for detecting the level of lncRNA in the sample to be tested.

[0016] Preferably, the primer pair sequence is shown as SEQ ID No. 2-3.

[0017] The technical effects achieved by the present invention are:

[0018] The present invention uses isolated wild-type rotavirus ZTR-68 strain to infect MA104 cells and then conducts whole transcriptome sequencing analysis, and discovers a new lncRNA molecule named lncRNA-DARVR, and the nucleotide sequence is shown in SEQ ID No. 1. After in vitro and in vivo animal model testing, it was found that the lncRNA was downregulated after viral infection, and in vitro overexpression of lncRNA-DARVR can significantly inhibit viral replication.

[0019] The present invention proposes a host lncRNA with the function of inhibiting rotavirus proliferation, which is of great significance for preventing and treating diarrhea caused by rotavirus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 lncRNA-DARVR gene location map.

[0021] Figure 2 RNA FISH detected the localization and expression level of lncRNA-DARVR in MA104 cells before and after rotavirus infection.

[0022] Figure 3 RT-PCR detection of lncRNA-DARVR expression levels after rotavirus infection of cells, where: (A) the virus infected cells at different MOIs (0, 0.2, 0.3 and 0.4); (B) the virus was infected for different time periods (0, 24h, 48h).

[0023] Figure 4 Figure 3. Effect of lncRNA-0666 on viral replication; (A) IF detection of viral replication after upregulation and downregulation of lncRNA-0666; (B) qRT-PCR detection of siRNA inhibition of DARVR expression; (C) WB detection of NSP3 expression; (D) Detection of infection rate under various treatments.

[0024] Figure 5 GO analysis and co-expressed gene prediction diagram; including: (A) GO analysis of cell transcriptome after transfection with pcDNA-DARVR; (B) prediction of co-expressed mRNA. DETAILED DESCRIPTION

[0025] In order to more clearly understand the present invention, the present invention is further described with reference to the following examples, which are only used for explanation and are not intended to limit the present invention in any way. A new lncRNA molecule for regulating rotavirus proliferation discovered in the present invention has a nucleotide sequence as shown in SEQ ID No. 1, which is named LncRNA-DARVR in the present invention.

[0026] Example 1

[0027] 1 Cell culture

[0028] The cells used in this study were MA104 cells, and the culture conditions were MEM medium containing 8% newborn calf serum and 1% double antibody.

[0029] (1) Recovery of MA104 cells: Take out the stored MA104 cells from the liquid nitrogen environment at -196°C, quickly transfer them to a 37°C water bath for heating, and shake them during the process to quickly melt the contents; disinfect them with 75% ethanol and bring them into a sterile laboratory. Operate in a biological clean bench, open the cryopreservation tube, gently blow the MA104 cells with a sterilized medium tube to make them evenly suspended, take out the MA104 cells and transfer them to a cell growth area of ​​25 cm 2 In a square oblique airtight T25 cell culture flask, take 8 mL of MEM solution containing 10% newborn calf serum, 100 U / mL penicillin and 100 ug / mL streptomycin preheated in a 37°C water bath and add it to the T25 cell culture flask. Shake to mix the cell suspension and MEM solution evenly, and place it in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for static culture. After 36 hours, observe the state of MA104 cells under a microscope. When the cell fusion in the T25 cell culture flask reaches 100%, expand the cell culture and subculture.

[0030] (2) Cell passaging: Discard the cell culture medium, add PBS and gently shake to clean the cell surface. Remove the PBS solution and wash repeatedly for 3 times; take 1mL of 0.125% trypsin and add it to the T25 cell culture flask along the non-cell growth surface, place the T25 cell culture flask horizontally, and gently shake the flask to make the cells fully contact with trypsin. When the cell growth surface is atomized, suck away the trypsin, gently tap the cell culture flask, and observe that the MA104 cells slowly slide down the cell growth surface in the form of quicksand; take 35mL of MEM solution containing 10% newborn calf serum, 100U / mL penicillin and 100ug / mL streptomycin, which has been preheated in a 37℃ water bath for half an hour in a 50mL sterile centrifuge tube, take 10mL with a pipette and transfer it to the completely digested T25 cell culture flask, shake it evenly, so that the MA104 cells in the T25 cell culture flask are evenly distributed in it; take 7mL of cell suspension to a brand new square oblique airtight T75 cell culture flask with a cell growth area of ​​75cm2, and add 25mL of 10% MEM solution containing newborn calf serum, 100U / mL penicillin and 100ug / mL streptomycin, shake well, and culture in T25 cell culture flask. When the next passage is made, digest with 2mL trypsin, take MEM solution containing 10% newborn calf serum, 100U / mL penicillin and 100ug / mL streptomycin and mix it into 25ml cell suspension, take 7mL for continued culture, and discard the rest or use it to spread cells to flat-bottom cell culture plates.

[0031] (3) Cell plating: Take 4 mL of MA104 cell suspension from the above T75 cell culture flask and mix it evenly with 36 mL of MEM solution containing 10% newborn calf serum, 100 U / mL penicillin and 100 ug / mL streptomycin. Inoculate the cells into two 6-well flat-bottom cell culture plates and add 3 mL of the mixed cell suspension to each well.

[0032] Viral infection and sequencing

[0033] (1) Virus infection: The rotavirus strain ZTR-68 was taken out of the -80℃ laboratory ultra-low temperature freezer, placed at room temperature, and allowed to thaw naturally. The virus was activated in a 37℃ water bath for 50 min by adding acetylase at 20μg / mL on a sterile laboratory biological clean bench; the bottom cell surface was gently washed twice with DMEM solution, and 2mL DMEM solution containing pancreatin was added to a 6-well flat-bottom cell culture plate for the last time. The activated ZTR-68 virus solution was inoculated into the plate, gently shaken, and placed in a carbon dioxide cell culture incubator for static culture. The ZTR-68 strain was infected in MA104 cells at MOI=0, MOI=0.2, 0.3 MO=0.3, and MOI=0.4, respectively. After 24 hours, the total RNA of the cells was extracted by TRIZOL method and stored in a -80℃ laboratory ultra-low temperature freezer for later use. After infection with ZTR-68 strain at an MOI of 0.2 at 0h, 24h, and 48h, total cellular RNA was extracted using the TRIZOL method and stored in a -80°C laboratory ultra-low temperature refrigerator for later use.

[0034] (2) Sequencing: The RNA samples were preserved and transferred to Shanghai OUYI Biotechnology for sequencing.

[0035] Detection of lncRNA-DARVR

[0036] (1) The total cellular RNA extracted by the TRIZOL method was stored in a -80°C laboratory ultra-low temperature refrigerator for future use.

[0037] (2) RT-PCR system is shown in Table 1

[0038] Table 1 RT-PCR system

[0039]

[0040] (3) RT-PCR procedure

[0041] Reverse transcription: 50°C, 3 min

[0042] Pre-denaturation: 95℃, 30sec

[0043] Cycle reaction (40): 95℃, 10sec; 60℃, 30sec

[0044] The primer sequences are:

[0045] LncRNA-DARVR upstream primer (SEQ ID No.2): TGCAGTTGGAACTTAGAGTGG

[0046] LncRNA-DARVR downstream primer (SEQ ID No.3): GGACAAAGTTCTGCTGAGAC

[0047] LncRNA - DARVR sequence (SEQ ID No.1):

[0048] AGATGACCTTATATgaatcattcatttaacaagcatTCATGGAATACACATTCCATGCAGTTGGAACTTAGAGTGGAAGGCCATCAGTTCACTGTTGTCTCAGCAGAACTTTGTCCCTGGGTCCCTGTTGAACTTAGAGTGGAAGGCCATCTGCTCACTATTGTCTGAGCAGAGCTTGGTCCCTGGGTCCCTGTTGAACTTAGAGTGGAAGGCCATCAACTCACTGTTGTCTGAGCAGAGCTTGGTCCCTGGGTCCCTGTTGAACTTAGAGTGGAAGGCCATCAGCTCACTGTTGTCTGAGCAGAGCTTGGTCTCTGGCTCCCTGTTGTAGCCTCCGCTCCTAGGAGGTGCACGGTGAGTGTTGGGGGACCCTCCACAGGCACAATTGCTGAACAAGGACCCCTCCCAAGGGTGTCAGCCCTAGGCCCTGAGCTCTGAAGAGGAGGAAGGCATTCCTGGGGCCATCTCCCCTTCTGGATACTGAGCTCTGCACAGAGAGAAACTCTTCCACATTCACTGCAGTGAAGTTCATACTTTAGAGACTGGGGCCTGCATTCCCCAGAATTTCCATGGCCACAGGTGGTGGCCGCACCATGCGACTGGTGTCTATGTTCCCTGGAATTTCCGTGGCCATAGatggtggctgtaccatgtgACTGGGGTCTGCATTCCCTGGAATTTCCGTGACTGCAGGTGGTGGCTGCACCATGCGACTGGAGTCTGTGTTCCCCAGGATTTCTGTGACCACAGG

[0049] 4 RNA FISH

[0050] 1. Soak the coverslip in 1% hydrochloric acid alcohol, cover it, and soak it for more than 1 hour. Rinse the coverslip with running water (control the flow rate and do not flush the coverslip); wash it with sterile double-distilled water 4-5 times at room temperature, shaking and washing; soak it in anhydrous ethanol 3 times, each time for several minutes; pour off the ethanol, put it in an oven at a temperature of about 60°C to dry for several hours, and sterilize it under high pressure to dry it; (2) Harvest cells at different stages of differentiation.

[0051] 2. Fixation and permeabilization: (1) Wash cells once with 1X PBS; (2) Fix with 4% paraformaldehyde for 10 min at room temperature; (3) Wash cells three times with 1X PBS, 1 min each time; (4) Add 1 ml of pre-cooled permeabilization solution to each well and place in a 4°C refrigerator for 5 min; (5) Discard the permeabilization solution; (6) Wash cells three times with 1X PBS, adding 1 ml each time.

[0052] 3. Detection of RNA in cells or tissues (1) Use a diamond pen to circle the area for in situ hybridization on the back of the slice; (2) Before hybridization, place the slice in about 200ul of pre-hybridization solution for sealing at 20-25 degrees for 20 minutes; (3) At the same time, preheat the hybridization solution to the same temperature as above; (4) Do not discard the pre-hybridization solution from the slice before the probe mixture is diluted and ready for use; (5) The slice needs to be placed in a humidified box; (6) Hybridize for 1 hour at the same temperature as the pre-hybridization temperature, using 100-300ul for each slice. The hybridization solution should be carefully pipetted onto the slice to ensure that the hybridization solution fully covers the slice; (7) Wash the slices with 4×SSC buffer three times, 5 minutes each time, at the same temperature as before, and avoid light; (8) Wash the slices with 1×SSC buffer once, 5 minutes, at the same temperature as before, and avoid light; (9) Wash the slices with 1×PBS buffer once, 5 minutes, at the same temperature as before, and avoid light; (10) Finally, wash the slices with 1XPBS once, 5 minutes, at room temperature, and avoid light.

[0053] 4. Nuclear staining (1) Add DAPI solution and incubate in the dark for 5 minutes; (2) Wash the slides with 1X PBS three times, 5 minutes each time, at room temperature, using a shaker.

[0054] 5. Sealing (1) Discard PBS, add sealing solution, cover with coverslip, and stand the slice upright for 2 minutes to dry, away from light; (2) Add anti-fluorescence quencher, seal with nail polish to avoid bubbles. 6. Image acquisition. Observe under laser confocal fluorescence microscope and collect images.

[0055] Establishment of diarrhea model in suckling mice

[0056] A diarrhea model was constructed by intragastric administration. Before intragastric administration, the feces of the suckling mice were collected, and an appropriate amount of feces was added to resuspend the feces, and the supernatant was obtained by high-speed centrifugation at 4°C. Colloidal gold and ELISA were used to detect whether the collected feces of the suckling mice contained RV antigens, and all suckling mice with positive RV antigens were removed. One hour before the infection, the suckling mice were separated from the mother mice and starved. A No. 8 intragastric needle was used to perform intragastric administration of the virus on the suckling mice. During the infection, the left hand gently pinched the head of the suckling mouse, tilted its head back, and kept the neck straight. The right hand held the intragastric needle, pressed the root of the tongue of the suckling mouse, and tentatively entered. When a pricking feeling appeared, the virus liquid was pushed into the stomach of the suckling mouse at a uniform speed. After the infection, pay attention to the activity status of the suckling mice. The skin of normal mice after intragastric administration was ruddy, breathing was normal, and they were in a prone position.

[0057] 6. Upregulation of lncRNA-DARVR

[0058] The lncRNA-DARVR gene was synthesized and constructed into the eukaryotic expression vector pcDNA3.1. The pcDNA3.1-lncRNA-DARVR overexpression vector was transfected into MA104 cells to upregulate the expression level of lncRNA-DARVR. The specific method is as follows: 24 hours after plating, the MA104 cells in the 6-well flat-bottomed cell culture plate can be seen to be uniformly fused to 80% under the microscope, and then transfection can be prepared. The solution in the 6-well flat-bottomed cell culture plate was removed, and the bottom cell surface was gently washed twice with serum-free MEM solution (DMEM solution), and replaced with 1 mL of Opti-MEM reduced serum medium per well for the third time. Prepare transfection reagent, solution A: Lipofectamine3000 3.75μL / well + Opti-MEM reduced serum medium 125μL / well; solution B1: pcDN3.1-lncRNA-DARVR plasmid 5μg / well + P3000 5μL / well + Opti-MEM reduced serum medium 125μL / well; solution B2: pcDNA3.1 empty plasmid 5μg / well + P3000 5μL / well + Opti-MEM reduced serum medium 125μL / well. Mix solution A and solution B1 / B2 at a ratio of 1:1 in 125 μL, incubate at room temperature for 15 min, use a 100-1000 μL pipette to evenly add 250 μL of transfection reagent to a 6-well flat-bottomed cell culture plate containing 1 mL of Opti-MEM reduced serum medium, shake well, place in a carbon dioxide cell culture incubator and culture for 6 h, remove the liquid, add MEM solution containing only 10% newborn calf serum, and continue culturing under the same conditions.

[0059] 7. Downregulation of lncRNA-DARVR

[0060] siRNA was designed for the lncRNA-DARVR sequence, and siRNA was transfected into MA104 cells to downregulate the expression level of lncRNA-DARVR. The specific method was as follows: a 6-well flat-bottom cell culture plate was taken out, the culture medium was removed, the cell surface was gently washed twice with DMEM, and the last time it was replaced with Opti-MEM reduced serum culture medium 1 mL / well. Prepare transfection reagents: Solution A: Lipofectamine3000 3.75μL / well + Opti-MEM reduced serum medium 125μL / well; Solution B1: pcDN3.1-lncRNA-DARVR plasmid 5μg / well + P3000 5μL / well + Opti-MEM reduced serum medium 125μL / well; Solution B2: pcDNA3.1 plasmid 5μg / well + P3000 5μL / well + Opti-MEM reduced serum medium 125μL / well; Solution B3: siRNA lncRNA-DARVR 5μg / well + Opti-MEM reduced serum medium 125μL / well; Solution B4: siRNA negative control 5μg / well + Opti-MEM reduced serum medium 125μL / well. Mix solution A and solution B1 / B2 / B3 / B4 at a ratio of 1:1 at 125 μL respectively, incubate at room temperature for 15 min, use a 100-1000 μL pipette to evenly add 250 μL of transfection reagent to a 6-well flat-bottomed cell culture plate containing 1 mL of Opti-MEM reduced serum medium, place the plate in a carbon dioxide cell culture incubator and culture for 6 h, remove the liquid, add MEM solution containing only 10% newborn calf serum, and continue culturing under the same conditions.

[0061] Detection of viral copy number

[0062] 1) The total cellular RNA extracted by TRIZOL method was stored in a -80℃ ultra-low temperature refrigerator for future use.

[0063] 2) RT-PCR is as shown in Table 2

[0064] Table 2

[0065]

[0066] 3) RT-PCR procedure

[0067] Reverse transcription: 50°C, 15 min

[0068] Pre-denaturation: 95℃, 30sec

[0069] Cycle reaction (45): 95°C, 10 sec; 60°C, 30 sec.

[0070] 9 Immunofluorescence

[0071] 1. Sample preparation (adherent cells, suspension cells, and tissues, etc.) (1) For adherent cells: first soak a clean coverslip in 70% ethanol, then place it in a culture dish with clean, sterile tweezers, and wash off the residual ethanol with sterile PBS. Remove the coverslip after the cells have grown into a single layer, and be careful to prevent the cells from falling off. (2) For suspension cells: There are two methods: ① First, perform the fixation step in the suspension, then drop the cells on the slide. After drying, the cells will adhere tightly to the slide. ② First, perform the fixation and staining steps in the suspension, centrifuge and elute, then use a pipette to transfer to a cassette slide for subsequent staining steps. (3) For frozen sections: After the sections are placed on the slide, they can be directly fixed and other subsequent operations can be performed. (4) For paraffin sections: There are fewer paraffin sections in immunofluorescence, so dewaxing and antigen retrieval must be performed first.

[0072] 2. Fixation (to prevent the diffusion of autolytic antigens in isolated tissues) The fixative includes: organic solvents (methanol, ethanol, acetone, etc.); cross-linking agents (4% PFA, 10% neutral formalin). The choice of fixative depends on the nature of the antigen being studied and the characteristics of the antibody used. However, formaldehyde is still the most commonly used, but it is not suitable for phosphorylated antibodies, which will cause the transfer of phosphoproteins from the membrane surface to the cytoplasm. Therefore, ice-cold anhydrous methanol or anhydrous ethanol should be selected. At the same time, it should be noted that formaldehyde will volatilize and should not be stored for too long at 4-8°C. Fixation time: depends on the size and type of the combination block. For most tissues, 18-24h is ideal. The cell fixation time is shorter, and generally 2% formaldehyde can be fixed at room temperature for 20min. Take cell samples as an example: fix the slides with 4% paraformaldehyde for 15min, and wash the slides with PBS 3 times, 3min each time. 3. Permeabilization (the purpose is to allow the antibody to enter the cell) 0.5% Triton X-100 (a detergent, prepared with PBS) permeabilization at room temperature for 20 minutes (for intracellular antigens, if the antibody is expressed on the cell membrane, this step should be omitted); in addition to Triton X-100, acetone can also be used as a permeabilization agent, and the sample fixed with acetone does not need to be permeabilized. 4. Blocking (to reduce the binding of primary and secondary antibodies to non-specific sites) After permeabilization, wash the slide with PBS 3 times, 3 minutes each time, absorb PBS with absorbent paper, add goat serum to the slide, and block at room temperature for 30 minutes. Commonly used blocking solutions include: serum from the same source as the secondary antibody, BSA or goat serum. From the beginning of blocking, all steps must pay attention to the moisture retention of the sample to avoid drying of the sample, otherwise it is very easy to produce a high background. Aldehyde-fixed samples should be blocked with a blocking solution containing 0.3M glycine before incubation with the primary antibody. 5. Primary antibody incubation: According to the instructions of the primary antibody, dilute the primary antibody with the primary antibody diluent in an appropriate ratio, absorb the blocking solution with absorbent paper, add the diluted primary antibody to each slide and put it in a wet box, incubate overnight at 4℃. Recover the primary antibody, add PBST, and wash it slowly on a shaker for 5 minutes, and wash it 3 times in total. 6. Fluorescent secondary antibody incubation: After absorbing the washing solution with absorbent paper, add the diluted fluorescent secondary antibody, incubate it in a wet box for 1 hour, recover the secondary antibody, and then wash it 3 times with PBST, 5 minutes each time; since fluorescence is easily quenched, all subsequent operation steps must be protected from light from the addition of fluorescent secondary antibodies. 7. Counterstaining the nucleus (the key to positioning) Add DAPI to the slide, and pay attention to incubate it in the dark for 5 minutes, stain the nucleus of the specimen, and then wash it 3 times with PBST, 5 minutes each time, and wash away the excess DAPI. 8. Sealing and fluorescence observation: Use absorbent paper to absorb the liquid on the slide, seal the slide with a sealing solution containing anti-fluorescence quencher, and then observe it under a fluorescence microscope.

[0073] Implementation Effect

[0074] 10.1 Screening of differentially expressed lncRNAs by whole transcriptome sequencing

[0075] In order to analyze whether lncRNA can regulate rotavirus replication and proliferation, rotavirus infected MA104 cells were subjected to whole transcriptome sequencing. The lncRNA molecule with the most obvious downregulation level was found, and the nucleotide sequence is shown in SEQ ID No. 1. Gene browser analysis showed that lncRNA-DARVR is an intergenic lncRNA with 751 base pairs, located on human chromosome 10. In order to facilitate subsequent research, it was named LncRNA-DARVR. ( Figure 1 )

[0076] 10.2 Expression analysis of lncRNA-DARVR

[0077] RNA FISH was used to detect the expression and localization of lncRNA-DARVR in MA104 cells 24 hours after rotavirus infection. It was found that lncRNA-DARVR migrated from the cell nucleus to the cytoplasm 24 hours after rotavirus infection. Compared with before virus infection, the expression level of lncRNA-DARVR decreased significantly. ( Figure 2 ) MA104 cells were infected with rotavirus at different MOIs (0, 0.2, 0.3 and 0.4). After 24 hours of infection, the cells were collected, RNA was extracted, and the expression of lncRNA-DARVR was detected by RT-PCR. The results showed that the expression of lncRNA-DARVR continued to decrease with the increase of viral infection. MA104 cells were infected with rotavirus at an MOI of 0.2, and RNA was extracted 24 hours and 48 hours after infection, and the expression of lncRNA-DARVR was detected by RT-PCR. The results showed that 24 hours after the virus infected MA104 cells, the expression of lncRNA-DARVR began to decrease, and continued to decrease with the extension of infection time. ( Figure 3 ).

[0078] Role in rotavirus proliferation

[0079] In order to analyze whether lncRNA-DARVR plays a regulatory role in rotavirus replication and proliferation, we cloned lncRNA-DARVR into the pcDNA3.1 vector and constructed an overexpression vector pcDNA3.1-lncRNA-DARVR. At the same time, we designed siRNA targeting lncRNA-DARVR and identified by RT-PCR that siRNA could inhibit the expression of lncRNA-DARVR ( Figure 4 A). pcDNA3.1-lncRNA-DARVR was transfected into MA104 cells to up-regulate the expression level of lncRNA-DARVR, and siRNA was transfected into MA104 cells to down-regulate the expression level of lncRNA-DARVR ( Figure 4 B). 48 hours after transfection, the cells were infected with rotavirus for 16 hours. Immunofluorescence was used to detect viral replication, and the results showed that upregulation of lncRNA-DARVR inhibited viral replication, while downregulation of lncRNA-DARVR promoted viral replication ( Figure 4 B, 4D). The expression of viral protein NSP3 was detected by Western blot, and the results also showed that upregulation of lncRNA-DARVR inhibited viral replication, while downregulation of lncRNA-DARVR promoted viral replication ( Figure 4 C).

[0080] Co-expressed gene prediction and GO analysis

[0081] In order to further analyze the possible mechanism of action of lncRNA-DARVR in rotavirus replication, we performed co-expression analysis of lncRNA-DARVR and differential mRNA based on the results of whole transcriptome sequencing after rotavirus infection of host cells in the previous study. Differential clustering analysis was performed on the co-expressed mRNAs, and the top 10 lncRNAs with the largest number of enriched GOs and no less than 5 were selected. The top 30 GO enrichment analysis of each lncRNA was plotted separately. It was found that after the virus infected the host cells, the genes significantly co-expressed with lncRNA-DARVR were mainly clustered in response to virus and defense response to virus ( Figure 5 ). The results suggest that lncRNA-DARVR may be associated with the activation of the interferon signaling pathway and has an antiviral effect. The downregulation of lncRNA-DARVR expression after viral infection is an immune escape strategy of the virus.

Claims

1. A lncRNA molecule, whose nucleotide sequence is shown in SEQ ID No.

1.

2. Use of the product for regulating the expression of the lncRNA molecule according to claim 1 in controlling the proliferation of rotavirus for non-disease diagnosis and treatment purposes.

3. The use according to claim 2, characterized in that: The product is a product that upregulates the expression of lncRNA molecules, and inhibits the proliferation of rotavirus by upregulating the expression of lncRNA molecules.

4. The use according to claim 2, characterized in that: The product is a product for down-regulating the expression of lncRNA molecules, and promotes the proliferation of rotavirus by down-regulating the expression of lncRNA.

Images