A PE-NRGEER mRNA in vitro transcription template plasmid, PE base editor and its applications

Abstract

This invention belongs to the technical field of genetic modification and animal genetic engineering, specifically relating to a PE-NRGEER mRNA in vitro transcription template plasmid, a PE base editor, and their applications. This invention provides a PE-NRGEER mRNA in vitro transcription template plasmid, the nucleotide sequence of which is shown in SEQ ID No. 1. This in vitro transcription template plasmid has been optimized for zebrafish codon preference, resulting in low toxicity. It integrates a RecO protein that can specifically improve the efficiency of RNA template gene editing, achieving high efficiency. The PE base editor prepared by mixing this plasmid with double pegRNA significantly improves gene editing efficiency. Experiments have shown that using the technical solution provided by this invention significantly improves gene editing efficiency by more than 10 times, enabling efficient point mutation, knockout, and knock-in of short nucleic acid sequences in fish genomes.

Description

Technical Field

[0001] This invention belongs to the technical field of genetic modification and animal genetic engineering, specifically relating to a PE-NRGEER mRNA in vitro transcription template plasmid, a PE base editor, and their applications. Background Technology

[0002] The ability to make targeted alterations to an organism's genome continues to drive advancements in life sciences and medicine. Double-strand break (DSB)-mediated DNA editing strategies utilize programmable nucleases, such as ZFNs, TALENs, or CRISPR-Cas nucleases, to efficiently disrupt genes by inducing insertions or deletions at target sites. However, DSBs often lead to undesirable outcomes, including uncontrolled editing, large-scale DNA rearrangements, p53 pathway activation, and chromosomal breakage rearrangements. While targeting DSBs can stimulate precise gene correction through homology-directed repair, this process is inefficient in most treatment-related cell types.

[0003] Existing research has shown that base editing (BE) and prime editing (PE) editors can efficiently achieve precise editing in relevant cells without the need for a base binding site (DSB). Cytosine and adenosine base editors can convert C•G to T•A and A•T to G•C, respectively, while PE can achieve virtually any local mutation, including substitution, insertion, or deletion of up to dozens of base pairs at the target DNA site. The PE system consists of at least two components: a protein containing a programmable DNA endonuclease fused with an engineered reverse transcriptase (RT), and primer-editing guide RNA or pegRNA. The pegRNA contains a spacer specifying the target site, an sgRNA scaffold, and a 3' extension sequence encoding the desired edit. This extension sequence contains a primer binding site (PBS) complementary to a portion of the original DNA spacer and an RT template encoding the desired edit and the downstream genomic sequence. After the PE ribonucleoprotein (RNP) binds to the target site and cleaves the PAM-containing DNA strand, the resulting cleaved DNA strand base pairs bind to PBS in the pegRNA, initiating reverse transcription of the RT template directly into the target DNA site. Then, the 3' end of the newly synthesized edited DNA is resolved through the cellular DNA repair pathway, thereby installing the desired edit at the target site. However, currently, there are no suitable PE-NRGEER mRNA in vitro transcription template plasmids and PE base editors for targeted modification of fish genes. Summary of the Invention

[0004] The purpose of this invention is to provide a PE-NRGEER mRNA in vitro transcription template plasmid, a PE base editor, and their applications. The PE base editor prepared by combining the PE-NRGEER mRNA in vitro transcription template plasmid with double peg sgRNA has the characteristic of high editing efficiency.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides a PE-NRGEER mRNA in vitro transcription template plasmid, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0007] This invention provides a PE base editor, which includes PE-NRGEER mRNA, pegsgRNA1, and pegsgRNA2;

[0008] The PE-NRGEER mRNA is obtained by in vitro transcription of the PE-NRGEER mRNA in vitro transcription template plasmid described in the above technical solution.

[0009] The peg sgRNA1 was obtained by in vitro transcription from a peg sgRNA1 in vitro transcription template;

[0010] The peg sgRNA2 was obtained by in vitro transcription from the peg sgRNA2 in vitro transcription template;

[0011] The peg sgRNA1 in vitro transcription template and the peg sgRNA2 in vitro transcription template each comprise a sequence obtained by sequentially linking the T7 promoter sequence, the PAM target recognition sequence, the PBS containing the reverse transcriptase recognition sequence that is partially complementary to the 5' end of the target sequence, and the reverse complementary sequence to the 3' end of the target sequence and the subsequent continuous genomic sequence.

[0012] The peg sgRNA1 is located on one strand of the target sequence; the peg sgRNA2 is located on the other strand, which is complementary to the target sequence.

[0013] Preferably, the nucleotide sequence of the upstream primer used to synthesize the peg sgRNA1 in vitro transcription template is shown in SEQ ID NO.4 or SEQ ID NO.10; the nucleotide sequence of the downstream primer used to synthesize the peg sgRNA1 in vitro transcription template is shown in SEQ ID NO.5 or SEQ ID NO.11.

[0014] The nucleotide sequences of the upstream primers used to synthesize the peg sgRNA2 in vitro transcription template are shown in SEQ ID NO. 6 or SEQ ID NO. 12; the nucleotide sequences of the downstream primers used to synthesize the peg sgRNA2 in vitro transcription template are shown in SEQ ID NO. 7 or SEQ ID NO. 13.

[0015] Preferably, the nucleotide sequences used to synthesize the peg sgRNA1 and peg sgRNA2 in vitro transcription templates are as shown in combination 1) or combination 2):

[0016] The nucleotide sequences of the upstream primer for synthesizing the in vitro transcription template of peg sgRNA1, the downstream primer for synthesizing the in vitro transcription template of peg sgRNA1, the upstream primer for synthesizing the in vitro transcription template of peg sgRNA2, and the downstream primer for synthesizing the in vitro transcription template of peg sgRNA2 are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively.

[0017] The nucleotide sequences of the upstream primer for synthesizing the peg sgRNA1 in vitro transcription template, the downstream primer for synthesizing the peg sgRNA1 in vitro transcription template, the upstream primer for synthesizing the peg sgRNA2 in vitro transcription template, and the downstream primer for synthesizing the peg sgRNA2 in vitro transcription template are shown in SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

[0018] This invention provides the application of the PE-NRGEER mRNA in vitro transcription template plasmid or the PE base editor described above in the targeted modification of fish.

[0019] Preferably, the fish include zebrafish and / or goldfish.

[0020] Preferably, the modified genes of the zebrafish include the Slc45a2 gene;

[0021] The modified genes in the goldfish include the Mitfa gene.

[0022] This invention provides a method for targeted modification of fish embryos, comprising the following steps:

[0023] Based on the sequence of the gene to be modified, in vitro transcription templates for peg sgRNA1 and peg sgRNA2 were synthesized respectively.

[0024] The peg sgRNA1 in vitro transcription template, peg sgRNA2 in vitro transcription template, and PE-NRGEER mRNA in vitro transcription template plasmid were transcribed in vitro to obtain peg sgRNA1, peg sgRNA2, and PE-NRGEER mRNA, respectively.

[0025] The peg sgRNA1, peg sgRNA2 and PE-NRGEER mRNA were mixed and injected into the embryos of the fish to be modified, and cultured to obtain the directed modified embryos.

[0026] Preferably, the peg sgRNA1, peg sgRNA2 and PE-NRGEER mRNA are mixed with water as a solvent, and the final concentration of peg sgRNA1 in the mixture is 100~300 ng / μL;

[0027] The final concentration of peg sgRNA2 in the mixture was 100-300 ng / μL;

[0028] The final concentration of PE-NRGEER mRNA in the mixture was 50~200 ng / μL.

[0029] Beneficial effects:

[0030] This invention provides a PE-NRGEER mRNA in vitro transcription template plasmid, the sequence of which is shown in SEQ ID No. 1. This in vitro transcription template plasmid has been optimized for zebrafish codon bias, resulting in low toxicity; it also integrates the RecO protein, which can specifically improve the efficiency of RNA template gene editing, thus achieving high efficiency.

[0031] Based on the above technical advantages, the present invention also provides a PE base editor, which includes PE-NRGEER mRNA, peg sgRNA1, and peg sgRNA2; the PE-NRGEER mRNA is obtained by in vitro transcription from the PE-NRGEER mRNA in vitro transcription template plasmid described in the above technical solution; the peg sgRNA1 is obtained by in vitro transcription from the peg sgRNA1 in vitro transcription template; the peg sgRNA2 is obtained by in vitro transcription from the peg sgRNA2 in vitro transcription template; the peg sgRNA1 in vitro transcription template and the peg sgRNA2 in vitro transcription template each include: a T7 promoter sequence, a PAM target recognition sequence, a reverse transcriptase recognition sequence (primer-bindingsite, PBS) partially complementary to the 5' end of the target sequence, and a reverse complementary sequence to the 3' end of the target sequence and the subsequent continuous genomic sequence; the peg sgRNA1 is located on one strand of the target sequence; the peg sgRNA2 is located on the other strand complementary to the target sequence. By mixing PE-NRGEER mRNA with dual pegRNA, the efficiency of gene editing was greatly improved.

[0032] This invention also provides the application of the PE-NRGEER mRNA in vitro transcription template plasmid or the PE base editor described in the above-mentioned technical solution in the targeted modification of fish. Experiments have shown that using the technical solution provided by this invention significantly improves gene editing efficiency by more than 10 times, enabling efficient point mutations, knockouts, and knock-ins of short nucleic acid sequences in the zebrafish genome. Therefore, the technical solution provided by this invention can achieve targeted modification of fish. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0034] Figure 1 This is a schematic diagram of the dual pegRNA design in Example 3;

[0035] Figure 2 Design a universal template and synthesis method for peg sgRNA;

[0036] Figure 3 This is an electrophoresis image showing the positive identification of the pSP64-PE-NRGEER plasmid in Example 1;

[0037] Figure 4 The editing efficiency of the double pegRNA at the slc45a2 site in zebrafish embryos in Example 3;

[0038] Figure 5 The editing efficiency of the dual pegRNA at the Mitfa c.56 TCC site in goldfish embryos in Example 4;

[0039] Figure 6 The editing efficiency of double pegRNA at the slc45a2 site in zebrafish embryos in Example 3, Comparative Example 2, and Comparative Example 3 is shown.

[0040] Figure 7 The flowcharts are for the targeted modification of fish genes in Examples 3 and 4. Detailed Implementation

[0041] AAAAAAAAAAAAAAAAAAAAAAAAAAA

[0042] This invention provides a PE base editor, comprising PE-NRGEER mRNA, pegsgRNA1, and pegsgRNA2; the PE-NRGEER mRNA is obtained by in vitro transcription from the PE-NRGEER mRNA in vitro transcription template plasmid described in the above-mentioned technical solution; the pegsgRNA1 is obtained by in vitro transcription from the pegsgRNA1 in vitro transcription template; and the pegsgRNA2 is obtained by in vitro transcription from the pegsgRNA2 in vitro transcription template.

[0043] The peg sgRNA1 and peg sgRNA2 in vitro transcription templates are respectively obtained by sequentially linking the T7 promoter sequence, the PAM target recognition sequence, the PBS with a reverse transcriptase recognition sequence that is partially complementary to the 5' end of the target sequence, and the reverse complementary sequence to the 3' end of the target sequence and the subsequent continuous genomic sequence.

[0044] The PE-NRGEER mRNA described in this invention is obtained by in vitro transcription of the PE-NRGEER mRNA in vitro transcription template plasmid. There are no special requirements for the transcription method of the PE-NRGEER mRNA in vitro transcription template plasmid; techniques well-known in the art can be used. In a specific embodiment of this invention, the transcription is performed using the mMESSAGE mMACHINETM SP6 transcription kit.

[0045] The peg sgRNA1 in vitro transcription template of this invention is obtained by sequentially linking the T7 promoter sequence, the PAM target recognition sequence, PBS containing a reverse transcriptase recognition sequence partially complementary to the 5' end of the target sequence, and the reverse complementary sequence to the 3' end of the target sequence and the subsequent contiguous genomic sequence; the partially complementary sequence preferably includes an 8-13 bp sequence at the 5' end of the nick; the 3' end and the subsequent contiguous genomic sequence preferably includes a 3-10 bp sequence from the nick to the end of the target sequence; the peg sgRNA1 is located on one strand of the target sequence (e.g., Figure 2 (As shown).

[0046] The ligation method of the peg sgRNA2 in vitro transcription template sequence described in this invention is the same as that of the peg sgRNA2 in vitro transcription template sequence described above, and will not be repeated here; the peg sgRNA2 is located on another strand complementary to the target sequence of peg sgRNA1 (e.g., Figure 2(As shown); there are no special requirements for the transcription methods of the peg sgRNA1 and peg sgRNA2 in vitro transcription templates; techniques well known in the art can be used. In a specific embodiment of the present invention, the transcription is performed using the MEGAshortscript T7 Transcription Kit.

[0047] In this invention, when the gene to be modified is Slc45a2 When synthesizing the peg sgRNA1 in vitro transcription template, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.4, specifically: 5'-GAAATTAATACGACTCACTATAGGCTGACACTGTGCTGTGTGTTGTTTTAGTACTCTGGAAGCAGAATC-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5, specifically: 5'-AAAAAACACGACACACAAAACTCAGTACTCTCGACATCAAGATGCCGAGATAAACACGGCATTTTGCCTTTTAGTAGATTCTGCTTCCAGAGTA-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6, specifically: 5'-GAAATTAATACGACTCACTATAGGTGGGATGGTGTAGAGAGTGCGTTTTAGTACTCTGGAAGCAGAATCTACTAAAAGGCAAAATGCCGTGTTTATCTC-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6, specifically: 5'-GAAATTAATACGACTCACTATAGGTGGGATGGTGTAGAGAGTGCGTTTTAGTACTCTGGAAGCAGAATCTACTAAAAGGCAAAATGCCGTGTTTATCTC-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6, specifically: 5'-GAAATTAATACGACTCACTATAGGTGGGATGGTGTAGAGAGTGCGTTTTAGTACTCTGGAAGCAGAATCTACTAAAAGGCAAAATGCCGTGTTTATCTC-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4 ... The nucleotide sequence of the downstream primer for the sgRNA2 in vitro transcription template is shown in SEQ ID NO.7, specifically 5'-AAAAAACATCTCTCACGACCTGTACTGAGTTTTGTGTGTCTCTCGACATCAAGATGCCGAGATAAACACGGCATTT-3'; This technical approach is beneficial for achieving [the desired transcription outcome] in fish. Slc45a2 Targeted modification of genes.

[0048] In this invention, when the gene to be modified is a goldfish... MitfaWhen synthesizing the peg sgRNA1 in vitro transcription template, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.10, specifically 5'-GAAATTAATACGACTCACTATAGGGACTCAGGTGCAGACCCACCGTTTTAGTACTCTGGAAGCAGAATCTACTAAAAGGCAAAATGCCGTGTTTATCTC-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.11, specifically 5'-AAAAAACTGGATGTGGTACTTTTATGGGCTCTCCAGGTGGGTCTGCACCTGTCTCGACATCAAGATGCCGAGATAAACACGGCATTT-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.11. As shown in SEQ ID NO.12, the specific nucleotide sequence is 5'-GAAATTAATACGACTCACTATAGGTCCTGCTGCCTCTGGGTCTGCGTTTTAGTACTCTGGAAGCAGAATCTACTAAAAGGCAAAATGCCGTGTTTATCT-3'; the nucleotide sequence of the downstream primer used to synthesize the peg sgRNA2 in vitro transcription template is shown in SEQ ID NO.13, specifically 5'-AAAAAACCACATAAAGCAGACCCAGAGGCAGTCTCGACATCAAGATGCCGAGATAAACACGGCATTTT-3'. Using the above technical solution is beneficial for achieving [the desired results] in fish [cells / organizations]. Mitfa Targeted modification of genes.

[0049] This invention provides the application of the PE-NRGEER mRNA in vitro transcription template plasmid or the PE base editor described above in the targeted modification of fish. In this invention, the fish preferably includes zebrafish and / or goldfish, more preferably zebrafish or goldfish; the modified gene in the zebrafish preferably includes... Slc45a2 Genes; the modified genes of the goldfish preferably include Mitfa Genes. Used to detect the aforementioned Slc45a2 The PCR primers for gene-directed modification preferably include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.8, specifically 5'-AAAGGCCATTGTTACAGCCCGC-3'; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.9, specifically 5'-TTCTGCCTTGTGGTACTCCGAG-3'; used for detection MitfaThe PCR primers for gene-directed modification preferably include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.14, specifically 5'-TTAGTCTCATGCACAAATAACATACAG-3'; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.15, specifically 5'-TCACAGTTGAGGGTGAGAAGGGCC-3'. Using the above-mentioned forward and reverse primers is beneficial for achieving positive identification of the modified gene.

[0050] This invention provides a method for targeted modification of fish embryos, comprising the following steps: synthesizing peg sgRNA1 and peg sgRNA2 in vitro transcription templates according to the sequences of the genes to be modified; performing in vitro transcription on the peg sgRNA1, peg sgRNA2, and PE-NRGEER mRNA in vitro transcription template plasmids to obtain peg sgRNA1, peg sgRNA2, and PE-NRGEER mRNA; mixing the peg sgRNA1, peg sgRNA2, and PE-NRGEER mRNA and injecting the mixture into the embryos of the fish to be modified for culture to obtain the targeted modified embryos. The synthesis and transcription methods described in this invention have been described in detail above and will not be repeated here.

[0051] After obtaining peg sgRNA1, peg sgRNA2 and PE-NRGEER mRNA, the present invention mixes the peg sgRNA1, peg sgRNA2 and PE-NRGEER mRNA and injects them into the embryos of fish to be modified and cultured to obtain directed modified embryos. This invention uses water as a solvent to mix peg sgRNA1, peg sgRNA2, and PE-NRGEER mRNA; the water is preferably nuclease-free water; the final concentration of peg sgRNA1 in the mixture is 100-300 ng / μL, preferably 200 ng / μL; the final concentration of peg sgRNA2 in the mixture is 100-300 ng / μL, preferably 200 ng / μL; the final concentration of PE-NRGEER mRNA in the mixture is 50-200 ng / μL, preferably 100 ng / μL; the injection method has no special requirements and can use techniques well known in the art; the culture temperature is preferably 26-29℃, more preferably 28.5℃; the culture time is preferably 20-40 hpf, more preferably 24 hpf. This method is beneficial for the targeted modification of genes in experimental fish.

[0052] Experiments have shown that the technical solution provided by this invention significantly improves gene editing efficiency by more than 10 times, and can efficiently achieve point mutations in the zebrafish genome, as well as the knockout and knock-in of short nucleic acid sequences.

[0053] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a PE-NRGEER mRNA in vitro transcription template plasmid, a PE base editor, and their applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1

[0055] Transformation and extraction of pSP64-PE-NRGEER plasmid

[0056] (1) The nucleotide sequence information of the pSP64-PE-NRGEER plasmid template is shown in SEQ ID NO.1. This nucleotide sequence contains the SP6 promoter sequence upstream, followed by the zebrafish-preferred kozak sequence (GCAAACATGG), the PE-NRGEER coding sequence (CDS), and a 30nt multi-A sequence at the end. The pSP64-PE-NRGEER plasmid was transformed into Trans-1T1 competent cells and plated on a substrate containing 50 μg / mL ampicillin (Ampicillin). + On LB agar plates containing resistant bacteria, single colonies were picked and cultured by shaking (37°C, 6-8 h). The cultured bacterial suspension was then subjected to positive identification.

[0057] Primers used for identification:

[0058] Forward primer: 5'-TTCTCACCAGTGGTACACAGTG-3' (SEQ ID NO.2);

[0059] Reverse primer: 5'-TAGCCCAGGTACTTCACCTGCT-3' (SEQ ID NO.3); amplification length of 390 bp, reaction system and procedure are shown in Table 1:

[0060] Table 1. Reaction system and procedure for positive identification

[0061]

[0062] (2) Subsequently, plasmids were extracted from the bacterial cultures that tested positive, and the extracted plasmids were subjected to agarose gel electrophoresis (see results). Figure 3 ,exist Figure 3The images in the image (from left to right represent the reference band, non-positive band, positive band, and negative band) and concentration determination were used to digest the extracted plasmids using the following system (using EcoRI, which was purchased from NEB) to obtain the digested products.

[0063] The enzyme digestion system is as follows: reaction buffer: 10 μL, plasmid: 10 μg and EcoRI: 10 U, total volume: 100 μL

[0064] After digestion at 37℃ for 2 hours, 2 μL of the digested product was subjected to agarose gel electrophoresis. After confirming complete digestion, two volumes (200 μL) of anhydrous ethanol were added, followed by centrifugation at 12000 rpm for 5 minutes. The supernatant was discarded. The product was then washed once with 1 mL of 75% nuclease-free ethanol, followed by centrifugation at 7500 rpm for 5 minutes, followed by discarding the supernatant and air drying. 12 μL of nuclease-free water was added, and 1 μL of the target fragment was then subjected to agarose gel electrophoresis. The concentration of the target fragment was determined to be 500-800 ng / μL.

[0065] Example 2

[0066] In vitro transcription of PE-NRGEER mRNA

[0067] (1) The DNA fragment (target fragment) recovered in Example 1 was used as a template (the concentration of the template was 200 ng / μL). Capped mRNA was obtained using the Invitrogen mMESSAGE mMACHINETM SP6 transcription kit (purchased from Invitrogen, product model AM1340). The specific reaction system is as follows:

[0068] 10×Reaction Buffer: 2 μL, 2×NTP / Cap: 10 μL, Sp6 Enzyme Mix: 2 μL, Template DNA (1 μg): 5.5 μL, and RNase inhibitor: 0.5 μL, Total volume: 20 μL

[0069] The above reaction system was placed in a PCR instrument and reacted at 37°C for 4 hours. The temperature of the PCR instrument lid was set to 70°C to obtain capped mRNA. Then, 1 μL of DNase from the kit was added to the reaction solution, and the mixture was placed in a PCR instrument and reacted at 37°C for 30 minutes to achieve the purpose of DNA digestion.

[0070] (2) After transcription, add H2O (RNase-free) to the reaction solution to a final volume of 200 μL, then add 1 / 10 (i.e., 20 μL) of Ammonium Acetate Stop Solution to terminate the reaction, obtaining the terminated reaction solution, and purify it according to the following steps:

[0071] a. Add 200 μL of a mixture containing phenol, chloroform and isoamyl alcohol (the volume ratio of phenol:chloroform:isoamyl alcohol in the mixture is 25:24:1) to the above reaction solution and mix by inverting the mixture. Then place it in a refrigerated centrifuge at 4°C and centrifuge at 12000 rpm for 5 min.

[0072] b. Take the supernatant from a into a new EP tube, add an equal volume (about 200 μL) of a mixture containing chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1), mix by inverting the tube, and then centrifuge at 12000 rpm for 5 min in a refrigerated centrifuge at 4℃.

[0073] c. RNA precipitation: After centrifugation, the upper aqueous phase was transferred to a new EP tube, 200 μL of isopropanol was added, the tube was inverted, and then placed in a -80℃ freezer for 8 min, followed by centrifugation at 15000 rpm for 5 min.

[0074] d. Discard the supernatant, add 1 mL of 75% ethanol, wash, and then centrifuge at 1500 rpm for 5 min in a refrigerated centrifuge at 4℃.

[0075] e. Discard the supernatant and repeat step d;

[0076] f. Discard the supernatant and centrifuge again at 15000 rpm for 5 min in a 4℃ refrigerated centrifuge;

[0077] g. Use a gun to absorb the remaining liquid, and air dry in a clean bench for 5 minutes;

[0078] h. Add 20~35μL of RNase-free H2O (usually 33μL), incubate at 55℃ for 30s, take out 0.5μL of RNA, add 1μL of RNA loading buffer, and wait for gel running;

[0079] Take 1 μL for agarose gel electrophoresis, determine the concentration, and then aliquot (the concentration of Capped PE-NRGEER mRNA was determined to be 800~1500 ng / μL), and store at -80℃ for later use.

[0080] Comparative Example 1

[0081]

[0082] Example 3

[0083] Construction of zebrafish Slc45a2 c.1381G>T point mutant strains, see the detailed flowchart below. Figure 7 (i.e., Fish-NRGEER: its full name is Nickase and dual RNA templates based Gene Editing Enhanced by RecO for Fish).

[0084] 3.1 Design and primer synthesis of zebrafish Slc45a2 c.1381G>T point mutant pegRNA

[0085] Genome bioinformatics analysis revealed the upstream and downstream sequences of the zebrafish Slc45a2 gene c.1381G, as shown in SEQ ID NO.16 and SEQ ID NO.17.

[0086] The nucleotide sequence of the sense strand is as follows:

[0087] 5'-AAACATCGTGGCCACACTGACACTGTGCTGTGTGTTTGGAGTCATGTCCAGCACTCTCTACACCATCCCATTCAACCTCATCTCGGAGTACCACAAGGCA-3' (SEQ ID NO. 16);

[0088] The nucleotide sequence of the antisense strand is as follows:

[0089] 3'-TTTGTAGCACCGGTGTGACTGTGACACGACACACAAACCTCAGTACAGGTCGTGAGAGATGTGGTAGGGTAAGTTGGAGTAGAGCCTCATGGTGTTCCGT-5' (SEQ ID NO. 17);

[0090] Near the desired mutation site (bolded position: G / C), a suitable PAM site is selected. Based on the PAM site, a reverse transcriptase binding primer sequence (primer-binding site, PBS) is designed to confirm the pegRNA sequence. A dual pegRNA design is then performed (see the schematic diagram of the dual pegRNA design). Figure 1 ,exist Figure 1 The yellow lines represent pegRNA1 and pegRNA2, respectively, and show the approximate structure of pegRNA1 and pegRNA2 relative to the genome. The corresponding primer sequences were synthesized as follows:

[0091] zSlc45a2-pegRNA1-F: SEQ ID NO.4, zSlc45a2-pegRNA1-R: SEQ ID NO.5;

[0092] zSlc45a2-pegRNA2-F: SEQ ID NO.6, zSlc45a2-pegRNA2-R: SEQ ID NO.7.

[0093] 3.2 Template preparation and in vitro transcription of zebrafish Slc45a2 c.1381G>T point mutant pegRNA

[0094] (1) Using the primers synthesized in section 3.1 above as templates, the DNA template of pegRNA1 was obtained by amplification using Takara's PrimerSTAR high-fidelity enzyme. The reaction system is as follows:

[0095] 2×PrimerSTAR MIX: 25 μL, pegRNA-F1 (100 μM): 0.8 μL, pegRNA-R1 (100 μM): 0.8 μL, and ddH2O: 23.4 μL, total volume: 50 μL

[0096] After amplification in a PCR instrument, 2 μL of the sample was run on a gel to confirm that the amplified band was single. The sample was then recovered using the Tiangen PCR product recovery kit to obtain the target DNA template.

[0097] (2) The target DNA from step (1) was transcribed using the MEGAshortscript T7 Transcription Kit (purchased from Invitrogen, product model AM1354). The reaction system is as follows:

[0098] 10×T7 Reaction Buffer: 2μL, ATP: 2μL, CTP: 2μL, GTP: 2μL, UTP: 2μL, RNase inhibitor: 0.5μL, template DNA (1000ng): 2μL, T7 Enzyme Mix: 2μL, H2O (RNase-free): 5.5μL, total volume: 20 μL.

[0099] The mixture was placed in a PCR instrument and reacted at 37°C for 2 hours, with the instrument lid temperature set to 70°C, to obtain pegRNA1. Then, 1 μL of DNase from the kit was added to the reaction solution, and the mixture was placed in the PCR instrument and reacted at 37°C for 30 minutes to digest the DNA.

[0100] (3) Purify pegRNA1. The specific purification method is the same as the method for purifying Capped PE-NRGEER mRNA in step (2) of Example 2.

[0101] Take 1 μL for agarose gel electrophoresis, determine the concentration, and then aliquot. The concentration of pegRNA1 was determined to be 1000~2000 ng / µL. Store at -80℃ for later use.

[0102] (4) Using the same method as steps (1) to (3) of the above 3.2 scheme, the purified pegRNA2 was obtained. The concentration of pegRNA2 was measured to be 1000~2000 ng / µL. It was then frozen at -80℃ for later use.

[0103] 3.3 Preparation and microinjection of zebrafish Slc45a2 c.1381G>T point mutant components

[0104] (1) The experimental component formulation for zebrafish Slc45a2 c.1381G>T point mutation includes: 100 ng / µL Capped PE-NRGEER mRNA prepared in Example 2, 200 ng / µL pegRNA1 prepared in the 3.2 protocol, and 200 ng / µL pegRNA2 prepared in the 3.2 protocol. The three are mixed to obtain the zebrafish Slc45a2 c.1381G>T point mutation component, denoted as PE-NRGEER+dual pegRNAs;

[0105] The control mutant component formulation contains: 100 ng / µL of PE mRNA prepared in Comparative Example 1, 200 ng / µL of pegRNA1 prepared in Protocol 3.2, and 200 ng / µL of pegRNA2 prepared in Protocol 3.2. The three are mixed to obtain the zebrafish Slc45a2 c.1381G>T point mutant component, denoted as PE+dual pegRNAs;

[0106] (2) Wild-type AB strain zebrafish embryos were collected and microinjected at the single-cell stage using a microinjector (the microinjector was purchased from Eppendorf, model FemtoJet 4i). Each embryo was injected with approximately 2 nL of the zebrafish Slc45a2 c.1381G>T point mutation component from step (1), and then the embryos were cultured at 28.5℃.

[0107] 3.4 Positive identification of the Slc45a2 c.1381G>T point mutation in zebrafish

[0108] (1) Primers capable of amplifying a 250-350 bp fragment were designed based on the upstream and downstream sequences of the zebrafish Slc45a2 gene c.1381G. The mutation site was required to be in the middle 100-250 bp range. The primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers were prepared into a 100 μM stock solution and stored at -20℃ for later use. Specific primer information is shown in Table 2:

[0109] Table 2. Positive identification primer sequences for the zebrafish Slc45a2 c.1381G>T point mutation.

[0110]

[0111] (2) The embryos cultured in step (2) of protocol 3.3 were cultured at 28.5℃ for 24 hpf. One copy of the genome was extracted from each embryo for PCR amplification. The PCR amplification system and procedure are shown in Table 3:

[0112] Table 3 PCR amplification system and procedure

[0113]

[0114] After electrophoresis, the PCR products were excised and recovered from the gel. Different embryo samples were numbered according to different barcodes and then subjected to next-generation deep sequencing. Gene editing efficiency was analyzed using CRISPResso2 (http: / / crispresso.pinellolab.org / ).

[0115] 3.5 Zebrafish Slc45a2 c.1381G>T point mutation efficiency

[0116] By analyzing the results of next-generation sequencing, and using the read ratio as an efficiency analysis, the results of the experimental group (PE-NRGEER + dual pegRNAs) and the control group (PE + dual pegRNAs) are shown in Table 4 and [Table 4 is missing in the original text]. Figure 4 (exist Figure 4 In the diagram, A represents the second-generation deep sequencing process, and B represents the mutation efficiency of different treatments.

[0117] Table 4 Mutation efficiency of different treatments

[0118]

[0119] From Table 5 and Figure 4 It can be seen that after adopting the technical solution provided by the present invention, PE-NRGEER significantly improves PE efficiency by more than 3 times.

[0120] Example 4

[0121] Construction of the goldfish (Ranchu variety) Mitfa c.56 TCC>TAA point mutation strain, see the detailed flowchart below. Figure 7 (i.e., Fish-NRGEER: its full name is Nickase and dual RNA templates based Gene Editing Enhanced by RecO for Fish).

[0122] 4.1 Design and primer synthesis of the goldfish Mitfa c.56 TCC>TAA point mutation pegENA

[0123] Genomic bioinformatics analysis revealed the upstream and downstream sequences of the goldfish Mitfa gene c.56 TCC>TAA, as shown in SEQ ID NO.18 and SEQ ID NO.19.

[0124] The nucleotide sequence of the sense strand is as follows:

[0125] 5'-TCTCTGTTTGTGACTCAGGTGCAGACCCACCTGGAGAGCCATCCAAGTACCACATCCAGCAGACCCAGAGGCAGCAGGTGAAGCATTACCTGTCCAGTG-3' (SEQ ID NO. 18);

[0126] The nucleotide sequence of the antisense strand is as follows:

[0127] 3'-AGAGACAAACACTGAGTCCACGTCTGGGTGGACCTCTCGGGTAGGTTCATGGTGTAGGTCGTCTGGGTCTCCGTCGTCCACTTCGTAATGGACAGGTCAC-5' (SEQ ID NO. 19);

[0128] Near the desired mutation site (bolded sequence position: TCC / AGG), a suitable PAM site is selected. Based on the PAM site, a reverse transcriptase binding primer sequence (primer-binding site, PBS) is designed to confirm the pegRNA sequence. Dual pegRNAs are then designed, and the corresponding primer sequences are synthesized, as detailed below:

[0129] gMitfa-pegRNA1-F: SEQ ID NO.10, gMitfa-pegRNA1-R: SEQ ID NO.11;

[0130] gMitfa-pegRNA2-F: SEQ ID NO.12, gMitfa-pegRNA2-R: SEQ ID NO.13

[0131] 4.2 Template preparation and in vitro transcription of goldfish Mitfa c.56 TCC>TAA point mutant pegRNA

[0132] Using the primers synthesized in Scheme 4.1 above as templates, the purified pegRNA1 and pegRNA2 were obtained by adopting the method in Scheme 3.2 of Example 3. The concentrations of pegRNA1 and pegRNA2 were measured to be 1000~2000 ng / µL, and stored at -80℃ for later use.

[0133] 4.3 Preparation and microinjection of the goldfish Mitfa c.56 TCC>TAA point mutation component

[0134] (1) The experimental mutant component formulation of goldfish Mitfa c.56 TCC>TAA point mutation includes: 100 ng / µL Capped PE-NRGEER mRNA prepared in Example 2, 200 ng / µL pegRNA1 prepared in the 4.2 protocol, and 200 ng / µL pegRNA2 prepared in the 4.2 protocol. The three are mixed to obtain the goldfish Mitfa c.56 TCC>TAA point mutation component, denoted as PE-NRGEER+dual pegRNAs;

[0135] The control mutant component formulation contains: PE-mRNA prepared in Comparative Example 1 at 100 ng / µL, pegRNA1 prepared in Protocol 4.2 at 200 ng / µL, and pegRNA2 prepared in Protocol 4.2 at 200 ng / µL. The three are mixed to obtain the goldfish Mitfa c.56 TCC>TAA point mutation component, denoted as PE+dual pegRNAs;

[0136] (2) Collect goldfish (Ranchu variety) embryos and perform single-cell microinjection using a microinjector (the microinjector was purchased from Eppendorf, model FemtoJet 4i). Each embryo is injected with approximately 2 nL of the goldfish Mitfa c.56 TCC>TAA point mutation component from step (1), and then the embryos are cultured at 28.5℃.

[0137] 4.4 Positive identification of Mitfa c.56 TCC>TAA point mutation in goldfish

[0138] Primers capable of amplifying a 250-350 bp fragment were designed based on the upstream and downstream sequences of the goldfish Mitfa gene c.56 TCC>TAA. The mutation site was required to be in the middle 100-250 bp range. Primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the primers were prepared as a 100 μM stock solution and stored at -20℃ for later use. Primer information is shown in Table 5.

[0139] Table 5. Positive identification primer sequences for the Mitfa c.56 TCC>TAA point mutation in goldfish.

[0140]

[0141] (2) The embryos cultured in step (2) of protocol 4.3 were cultured at 28.5℃ for 24 hpf. One copy of the genome was extracted from each embryo for PCR amplification. The PCR amplification system and procedure are shown in Table 6.

[0142] Table 6 PCR amplification system and procedure

[0143]

[0144] After electrophoresis, the PCR products were excised and recovered from the gel. Different embryo samples were numbered according to different barcodes and then subjected to next-generation deep sequencing. Gene editing efficiency was analyzed using CRISPResso2 (http: / / crispresso.pinellolab.org / ).

[0145] 4.5 goldfish Mitfa c.56 TCC>TAA point mutation efficiency

[0146] By analyzing the results of next-generation sequencing, and using the read ratio as an efficiency analysis, the results of the experimental group (PE-NRGEER + dual pegRNAs) and the control group (PE + dual pegRNAs) are shown in Table 7 and [Table 7 is missing in the original text]. Figure 5 .

[0147] Table 7 Mutation efficiency of different treatments

[0148]

[0149] From Table 7 and Figure 5 It can be seen that after adopting the technical solution provided by the present invention, PE-NRGEER significantly improves PE efficiency by more than 3 times.

[0150] Comparative Example 2

[0151] The only difference from Example 3 is that step (1) of the 3.3 scheme contains: 100 ng / µL of Capped PE-NRGEER mRNA prepared in Example 2 and 200 ng / µL of pegRNA1 prepared in the 3.2 scheme. The two are mixed to obtain the goldfish Mitfa c.56 TCC>TAA point mutation component.

[0152] Comparative Example 3

[0153] The only difference from Example 3 is that step (1) of the 3.3 scheme contains: 100 ng / µL of Capped PE-NRGEER mRNA prepared in Example 2 and 200 ng / µL of pegRNA2 prepared in the 3.2 scheme. The two are mixed to obtain the goldfish Mitfa c.56 TCC>TAA point mutation component.

[0154] Statistical analysis was performed on the mutation efficiency of zebrafish Slc45a2 c.1381G>T in Example 3, Comparative Example 1, and Comparative Example 2, respectively. The results are shown in Table 8. Figure 6 .

[0155] Table 8 Mutation efficiency of different treatments

[0156]

[0157] From Table 8 and Figure 6 It can be seen that by adopting the technical solution provided by the present invention, dual pegRNA significantly improves PE efficiency by more than 3 times.

[0158] In summary, the technical solution provided by this invention significantly improves gene editing efficiency by more than 10 times, and can efficiently achieve point mutations in the zebrafish genome, as well as the knockout and knock-in of short nucleic acid sequences.

[0159] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A PE-NRGEER mRNA in vitro transcription template plasmid, characterized in that, The nucleotide sequence of the PE-NRGEER mRNA in vitro transcription template plasmid is shown in SEQ ID No.

1.

2. A PE base editor, characterized in that, The PE base editor includes PE-NRGEER mRNA, pegsgRNA1, and pegsgRNA2; The PE-NRGEER mRNA is obtained by in vitro transcription from the PE-NRGEER mRNA in vitro transcription template plasmid as described in claim 1; the peg sgRNA1 is obtained by in vitro transcription from the peg sgRNA1 in vitro transcription template; the peg sgRNA2 is obtained by in vitro transcription from the peg sgRNA2 in vitro transcription template. The peg sgRNA1 in vitro transcription template and the peg sgRNA2 in vitro transcription template each comprise a sequence obtained by sequentially linking the T7 promoter sequence, the PAM target recognition sequence, the PBS containing the reverse transcriptase recognition sequence that is partially complementary to the 5' end of the target sequence, and the reverse complementary sequence to the 3' end of the target sequence and the subsequent continuous genomic sequence. The peg sgRNA1 is located on one strand of the target sequence; the peg sgRNA2 is located on the other strand, which is complementary to the target sequence.

3. The PE base editor according to claim 2, characterized in that, The nucleotide sequences of the upstream primers used to synthesize the peg sgRNA1 in vitro transcription template are shown in SEQ ID NO.4 or SEQ ID NO.10; the nucleotide sequences of the downstream primers used to synthesize the peg sgRNA1 in vitro transcription template are shown in SEQ ID NO.5 or SEQ ID NO.

11. The nucleotide sequences of the upstream primers used to synthesize the peg sgRNA2 in vitro transcription template are shown in SEQ ID NO.6 or SEQ ID NO.12; the nucleotide sequences of the downstream primers used to synthesize the peg sgRNA2 in vitro transcription template are shown in SEQ ID NO.7 or SEQ ID NO.

13.

4. The PE base editor according to claim 3, characterized in that, The nucleotide sequences used to synthesize the peg sgRNA1 and peg sgRNA2 in vitro transcription templates are shown in combination 1) or combination 2): The nucleotide sequences of the upstream primer for synthesizing the in vitro transcription template of peg sgRNA1, the downstream primer for synthesizing the in vitro transcription template of peg sgRNA1, the upstream primer for synthesizing the in vitro transcription template of peg sgRNA2, and the downstream primer for synthesizing the in vitro transcription template of peg sgRNA2 are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively. The nucleotide sequences of the upstream primer for synthesizing the peg sgRNA1 in vitro transcription template, the downstream primer for synthesizing the peg sgRNA1 in vitro transcription template, the upstream primer for synthesizing the peg sgRNA2 in vitro transcription template, and the downstream primer for synthesizing the peg sgRNA2 in vitro transcription template are shown in SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

5. The application of the PE-NRGEER mRNA in vitro transcription template plasmid of claim 1 or the PE base editor of any one of claims 2 to 4 in the targeted modification of fish; wherein the fish are zebrafish and / or goldfish.

6. The application according to claim 5, characterized in that, The modified genes in the zebrafish include the Slc45a2 gene; The modified genes in the goldfish include the Mitfa gene.

7. A method for directionally modifying fish embryos using the PE base editor according to any one of claims 2 to 4, characterized in that, Includes the following steps: Based on the sequence of the gene to be modified, in vitro transcription templates for peg sgRNA1 and peg sgRNA2 were synthesized respectively. The peg sgRNA1 in vitro transcription template, peg sgRNA2 in vitro transcription template, and PE-NRGEER mRNA in vitro transcription template plasmid were transcribed in vitro to obtain peg sgRNA1, peg sgRNA2, and PE-NRGEER mRNA, respectively. The peg sgRNA1, peg sgRNA2 and PE-NRGEER mRNA were mixed and injected into the embryos of the fish to be modified and cultured to obtain the directed modified embryos; the fish were zebrafish and / or goldfish.

8. The method according to claim 7, characterized in that, The pegsgRNA1, pegsgRNA2, and PE-NRGEER mRNA were mixed in water as a solvent. The final concentration of pegsgRNA1 in the mixture was 100-300 ng / μL; the final concentration of pegsgRNA2 in the mixture was 100-300 ng / μL; and the final concentration of PE-NRGEER mRNA in the mixture was 50-200 ng / μL.

Images