A method for improving the therapeutic effect of CAR-NK cells based on the PRF1 gene

Abstract

The present invention belongs to the field of biomedicine technology, and discloses a method for improving the therapeutic effect of CAR-NK cells based on the PRF1 gene. Specifically disclosed is the application of the directed mutation PRF1 gene in enhancing the activity of NK cells, and the nucleotide sequence of the PRF1 gene is shown in SEQ ID NO: 5. The present invention is based on the directed modification of the PRF1 gene to improve the killing activity of CAR-NK cells, thereby enhancing the efficacy of CAR-NK cell therapy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a method for improving the therapeutic effect of CAR-NK cells based on the PRF1 gene. Background Art

[0002] Chimeric antigen receptor (CAR)-modified T cells have revolutionized the field of cell therapy for cancer treatment and are one of the most important breakthroughs in tumor treatment in recent years. At present, a number of CAR-T products have been approved for marketing, bringing significant clinical benefits to tumor patients. Although this strategy has been shown to have a very significant clinical effect on B-cell malignancies, its application still has certain limitations: on the one hand, it produces cytokine release syndrome (CRS) and immune effector cell-related neurotoxicity syndrome; on the other hand, allogeneic T cells (even if HLA matching) may lead to the risk of graft-versus-host disease (GVHD). In addition, the relatively long preparation cycle also restricts the further widespread application of CAR-T cells. Corresponding to T cells, NK cells account for 5% to 10% of peripheral blood lymphocytes and are an important part of the innate immune system. They play a key role in the first-line defense against pathogens and cancer cells. Current studies have shown that CAR-modified NK cells may overcome the above-mentioned shortcomings of CAR-T cells, show significant anti-tumor effects, and have the potential to be prepared as "off-the-shelf" products. Therefore, CAR-NK cells show broad prospects in tumor immunotherapy.

[0003] NK cells have a specific killing effect on transformed or other abnormal cells in the body. In order to recognize and protect healthy cells, NK cells mainly rely on inhibitory receptors (such as killer cell immunoglobulin-like receptors KIRs and NKG2A) to bind to the class I molecules of the tissue compatibility complex (MHC) expressed on normal cells, and act as a safety switch to inhibit NK cell toxicity. In clinical trials, NK cells do not induce GVHD like T cells, which has opened up new avenues for their widespread use in allogeneic environments and the production of ready-made cell therapy products. Compared with CAR-T cells, CAR-NK cells hardly cause CRS and neurotoxicity. Moreover, CAR-NK cells used in clinical practice are rich in sources and can be produced from peripheral blood (PB), umbilical cord blood (CB), human embryonic stem cells (HESC), induced pluripotent stem cells (IPSC), and NK-92 cell lines.

[0004] The basic structure of the functional CAR molecule expressed on NK cells includes an antigen recognition domain composed of a single-chain variable fragment (scFv), an extracellular hinge domain, a transmembrane domain, and an intracellular activation domain. The scFv consists of heavy and light chains bound to a linker, which determines the specificity of the CAR. The hinge region connects the tumor antigen binding domain to the transmembrane region, ensuring the stability of the CAR and providing flexibility for easy access to the target protein. The transmembrane region connects the extracellular and intracellular CAR domains, docks the CAR to the cell membrane and transduces the activation signal into an intracellular activation signal. The number of intracellular activation domains determines the generation of CAR, and various combinations of activation domains are used to produce anti-tumor responses. Depending on the intracellular region, CAR-NK has developed to the fourth generation. The first generation of CARs consists of a basic structure with a signaling region; the second generation of CARs contains additional co-stimulatory domains, such as CD28 or 4-1BB; the third generation of CARs has multiple co-stimulatory domains, including members of the immunoglobulin superfamily (CD28 and ICOS), members of the TNF receptor superfamily (4-1BB, CD27, OX40 and CD40), and others such as CD40L and TLRs. These CAR-NK modifications are aimed at improving the proliferation, persistence and anti-tumor ability of CAR-NK cells. So far, the role of CAR modification in improving the efficacy of CAR-NK still needs the support of large-scale clinical trials.

[0005] CAR-NK cells have good clinical safety, but there are still some obstacles in their clinical application. (1) NK cells lack persistence in vivo. Although the addition of exogenous cytokines can enhance the proliferation and persistence of NK cells, it can also cause individual adverse toxicity and immunosuppression of other immune groups. (2) Currently, CAR-NK has achieved good therapeutic effects in the treatment of hematological tumors, but due to the immunosuppression of the tumor microenvironment, the effect is poor in solid tumors. Some studies have attempted to combine CAR engineering with checkpoint deletion as an effective method to enhance the anti-tumor activity of NK cells. (3) Rapid homing to the tumor bed is crucial to the efficacy of adoptive cell therapy, which is regulated by the complex interaction between chemokines secreted by NK cells and chemokines secreted by tumor cells. At present, some studies have tested some new strategies to increase the migration of NK cells to tumor sites in mouse models, but they still need to be verified in clinical trials. (4) The freezing and thawing process changes the survival rate of NK cells and significantly reduces cytotoxicity. In general, the killing efficiency of various modified CAR-NK against tumors is generally not high (see Table 1 for details). Significantly improving the tumor killing activity of CAR-NK is the key to breaking through the existing bottleneck and realizing its widespread application.

[0006] Table 1 Summary of CAR-NK tumor killing activity in existing studies

[0007]

[0008] Note: E: effector cell; T: target cell; E: ratio of T effector cells to target cells.

[0009] Compared with CAR-T cells, CAR-NK cells have their own unique advantages and are currently a key hotspot in the field of tumor cell therapy, but they also face challenges. The key to breaking the current bottleneck is to significantly improve their anti-tumor activity. Due to the complexity of the NK cell regulatory network, it is difficult to obtain a stable ideal phenotype by relying solely on rational design. It is urgent to introduce new research theories and systems to develop a "new generation" of CAR-NK cell products on this basis, thereby bringing new breakthroughs in tumor treatment. Summary of the invention

[0010] The purpose of the first aspect of the present invention is to provide the use of targeted mutation of PRF1 gene in enhancing the activity of NK cells.

[0011] The second aspect of the present invention aims to provide a method for enhancing the killing activity of NK cells.

[0012] The third aspect of the present invention aims to provide a PRF1 mutant.

[0013] The fourth aspect of the present invention aims to provide an immune cell.

[0014] The purpose of the fifth aspect of the present invention is to provide the use of the PRF1 mutant of the third aspect of the present invention or the immune cell of the fourth aspect of the present invention in the preparation of anti-tumor products or products with enhanced tumor cell killing effects.

[0015] The sixth aspect of the present invention aims to provide a product.

[0016] In order to achieve the above object, the technical solution adopted by the present invention is:

[0017] In a first aspect of the present invention, a method for enhancing NK cell activity by directed mutation of a PRF1 gene is provided, wherein the nucleotide sequence of the PRF1 gene is shown in SEQ ID NO: 5.

[0018] In some embodiments of the present invention, the directed mutagenesis comprises:

[0019] 1) Compared with SEQ ID NO: 5, the 92nd base C is mutated to A; or

[0020] 2) compared with SEQ ID NO: 5, the 134th base G is mutated to T; or

[0021] 3) compared with SEQ ID NO: 5, the 212th base G is mutated to T; or

[0022] 4) Compared with SEQ ID NO: 5, the 226th base T is mutated to A.

[0023] In some embodiments of the present invention, the PRF1 gene sequence after targeted mutation is shown in SEQ ID NO:1 to SEQ ID NO:4.

[0024] A second aspect of the present invention provides a method for enhancing the killing activity of NK cells, comprising the step of directed mutation of the PRF1 gene in NK cells, wherein the directed mutation comprises:

[0025] 1) Compared with SEQ ID NO: 5, the 92nd base C is mutated to A; or

[0026] 2) compared with SEQ ID NO: 5, the 134th base G is mutated to T; or

[0027] 3) compared with SEQ ID NO: 5, the 212th base G is mutated to T; or

[0028] 4) Compared with SEQ ID NO: 5, the 226th base T is mutated to A.

[0029] In some embodiments of the present invention, the PRF1 gene sequence after targeted mutation is shown in SEQ ID NO:1 to SEQ ID NO:4.

[0030] In some embodiments of the present invention, the NK cells include CAR-NK cells.

[0031] In some embodiments of the present invention, the NK cells include CAR-NK-92 cells.

[0032] According to a third aspect of the present invention, a PRF1 mutant is provided, wherein the nucleotide sequence of the PRF1 mutant is shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4.

[0033] In some embodiments of the present invention, conservative substitutions can be made based on the presence of PRF1 mutations in the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 4. Substitution of a nucleotide of one class by another nucleotide of the same class falls within the scope of the disclosed variants, as long as the substitution does not substantially change the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art.

[0034] A fourth aspect of the present invention provides an immune cell, wherein the immune cell carries a gene of a PRF1 mutant shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4.

[0035] In some embodiments of the present invention, the immune cells include T cells and / or NK cells.

[0036] In some embodiments of the present invention, the immune cells are NK cells.

[0037] In some embodiments of the present invention, the immune cells include CAR-NK cells.

[0038] The fifth aspect of the present invention provides the use of the PRF1 mutant of the third aspect of the present invention or the immune cell of the fourth aspect of the present invention in the preparation of anti-tumor products or products with enhanced tumor cell killing effects.

[0039] In some embodiments of the present invention, the products include but are not limited to reagents, kits and drugs.

[0040] In some embodiments of the present invention, the product is a drug.

[0041] In some embodiments of the present invention, the drug also includes other drugs and pharmaceutically acceptable carriers, such as excipients or diluents, and the carrier may include non-naturally occurring carriers. Examples of carriers, excipients and diluents include lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, ethylparaben, propylparaben, talc, magnesium stearate and mineral oil.

[0042] In some embodiments of the present invention, the drug is in the form of pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, transdermal absorbers, gels, lotions, ointments, creams, patches, cataplasms, pastes, sprays, skin emulsions, skin suspensions, transdermal delivery patches, medicated bandages or suppositories according to commonly used methods. Specifically, when formulated, the drug can be prepared using a diluent or excipient, such as a commonly used filler, weight agent, adhesive, wetting agent, disintegrant and surfactant. Orally administered solid materials include tablets, pills, powders, granules, capsules, but are not limited thereto. Such solid materials can be prepared by mixing at least one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. In addition to liquids and liquid paraffin for oral administration, various excipients such as wetting agents, sweeteners, flavors, preservatives, etc. can be added. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used as non-aqueous solvents and suspending agents. WITEPSOL, MACROGOL, TWEEN 61, cocoa butter, lauryl alcohol, glycerin gelatin, etc. can be used as bases for suppositories.

[0043] In some embodiments of the present invention, the tumor includes but is not limited to brain cancer, breast cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, kidney cancer, lung cancer, non-small cell lung cancer, melanoma, mesothelioma, ovarian cancer, sarcoma, gastric cancer, uterine cancer and medulloblastoma.

[0044] The sixth aspect of the present invention provides a product, which is the PRF1 mutant of the third aspect of the present invention or the immune cell of the fourth aspect of the present invention.

[0045] In some embodiments of the present invention, the products include but are not limited to reagents, kits and drugs.

[0046] The beneficial effects of the present invention are:

[0047] The present invention is based on the targeted modification of the PRF1 gene to improve the killing activity of CAR-NK cells, thereby enhancing the efficacy of CAR-NK cell therapy. Specifically, the present invention constructs four PRF1 mutant immune cells (CAR-CD19-NK-92-NC, CAR-CD19-NK-92-PRF1 WT 、CAR-CD19-NK-92-PRF1 C31Y 、CAR-CD19-NK-92-PRF1 G45V 、CAR-CD19-NK-92-PRF1G71V 、CAR-CD19-NK-92-PRF1 C76S ), and the killing activity was measured. The results showed that the modification of the PRF1 gene can significantly increase the target cell killing effect of CAR-NK cells. The use of PRF1 mutant immune cells to prepare a pharmaceutical composition can be used for the treatment of cancer and has excellent application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The modification based on PRF1 gene can significantly increase the target cell killing effect of CAR-NK cells. In the figure, * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.005, and **** indicates P<0.001.

[0049] Figure 2 This is the CAR-CD19-GFP virus packaging result.

[0050] Figure 3 Schematic diagram of gradient dilution in lentivirus titer detection.

[0051] Figure 4 The titer test results of CAR-CD19-GFP virus transfected 293T.

[0052] Figure 5 The results of CAR-CD19-GFP virus transfection in 293T cells.

[0053] Figure 6 The results are shown for NK92 cells transfected with CAR-CD19-GFP virus.

[0054] Figure 7 This is the screening result of CAR-CD19-GFP-NK92 stable strain.

[0055] Figure 8 Schematic diagram of the structure of PRF1-related vectors. DETAILED DESCRIPTION

[0056] The present invention will now be described in detail with reference to specific embodiments, but the scope of the present invention is not limited thereto.

[0057] Unless otherwise specified, the materials and reagents used in this example were obtained from commercial sources.

[0058] Example 1

[0059] The inventors found in previous studies that the perforin 1 gene (PRF1) in CAR-NK cells with strong killing activity has accumulated multiple mutations of independent origin, suggesting that targeted modification of the PRF1 gene may improve the killing activity of CAR-NK cells, thereby enhancing the efficacy of CAR-NK cell therapy. The present invention further verifies whether PRF1 gene modification can significantly enhance CAR-NK activity.

[0060] Different CAR-NK cells are obtained based on the targeted modification of the PRF1 gene:

[0061] Empty vector, wild-type PRF1 (full-length sequence as shown in SEQ ID NO: 5), and mutant PRF1 (C31Y, G45V, G71V, and C76S mutations, respectively) were highly expressed in CAR-CD19-NK-92 cells, and stable strains were selected, namely CAR-CD19-NK-92-NC, CAR-CD19-NK-92-PRF1 WT 、CAR-CD19-NK-92-PRF1 C31Y 、CAR-CD19-NK-92-PRF1 G45V 、CAR-CD19-NK-92-PRF1 G71V 、CAR-CD19-NK-92-PRF1 C76S The specific process is as follows:

[0062] (I) Construction of CAR-NK——Car-CD19-GFP virus packaging

[0063] Experimental Materials:

[0064] Cells: 293T cells (DMEM+10% FBS+1% P / S).

[0065] Reagent:Lipo3000.

[0066] Plasmids: pRSV-Rev (Fenghui Biotechnology), pMDLg / pRRE (Fenghui Biotechnology), pMD2.G (Fenghui Biotechnology) and pLV[CAR]-EGFP-SV40>CD8-leader / CD19-scFV / CD8-hinge / CD8-TM / 4-1BB-CD3zeta (Yunzhou Biotechnology) (subsequent abbreviation: CAR-CD19-GFP plasmid).

[0067] Operation process:

[0068] 1. Day 0 (one day before transfection):

[0069] 1). Poly-l-lysine (Sigma) can be used to pretreat the surface of the 10 cm dish to enhance the adhesion between 293T cells and the culture dish: add 10 mL of poly-l-lysine (diluted with PBS, the working concentration is 0.001%) to each 10 cm dish, incubate in a 37°C incubator for 1 hour, and then recover the poly-l-lysine into a 15 mL centrifuge tube (poly-l-lysine can be reused).

[0070] 2). 6×10 6 The 293T cells were seeded in a 10 cm dish, the dish was shaken back and forth and incubated in a 37°C, 5% CO2 incubator overnight.

[0071] 2.Day 1:

[0072] 1). Observe the culture dish on the day of transfection. When the cell confluence reaches 90% to 95%, transfection can be prepared (at this time, there is still room for 1 to 2 cell divisions between cells).

[0073] 2). Remove the culture medium 1 hour before transfection and replace it with 10mL Opti-MEM medium.

[0074] 3). Prepare the transfection complex, i.e., CAR-CD19-GFP plasmid transfected into 10cm dish of 293T cells, as follows:

[0075] A) Opti-MEM 500μL, Lipo3000 105μL;

[0076] B) Opti-MEM 500μL, pRSV-Rev (Transfer vector) 6.6μg, pMDLg / pRRE (Packagingplasmids) 6.6μg, pMD2.G (Envelope vector) 6.6 μg, pLV[CAR]-EGFP-SV40>CD8-leader / CD19-scFV / CD8-hinge / CD8-TM / 4-1BB-CD3zeta (destination plasmid) 15 μg and Lipo3000 70 μL.

[0077] 4). Prepare two sterile 1.5mL EP tubes named A and B, add the 3-packaging plasmid system, target plasmid and Lipo3000 into 500μL Opti-MEM in sequence, tap EP tube B lightly, and let stand at room temperature for 5 minutes.

[0078] 5). Add 105 μL of lipo3000 to 500 μL of Opti-MEM, tap EP tube A, and let stand for 5 minutes.

[0079] 6). Gently add the reagent in EP tube A to B, flick the EP tube, and let it stand at room temperature for 20 minutes. Then add the transfection complex drop by drop into the culture dish and mix gently.

[0080] 3.Day 2:

[0081] 16 h after transfection, the culture medium was removed and replaced with 10 mL of complete medium containing DMEM+10% FBS+1% P / S without antibiotics.

[0082] 4.Day 3:

[0083] 24 h after transfection, the fluorescent cells were observed under a fluorescence microscope and photographed ( Figure 2 ).

[0084] 5.Day 4:

[0085] 1). 48h after transfection, collect the virus supernatant into a 15mL centrifuge tube, centrifuge at 2000rpm for 5min to precipitate the cell debris, and further filter the cell debris in the virus supernatant with a 0.45μm filter membrane.

[0086] 2). Add 8 μg / mL polybrene to the filtered virus supernatant, divide into cryopreservation tubes and place in a -80℃ refrigerator.

[0087] 6.Day 5:

[0088] Collect the virus supernatant 72 hours after transfection, and perform the same operation as step 5.

[0089] (II) Lentivirus titer detection

[0090] Day 1: 2×10 4 The 293T cells were seeded into 96-well plates and incubated overnight in a 37°C, 5% CO2 incubator.

[0091] Day 2: Make 10-fold serial dilutions in EP tubes ( Figure 3 ), prepare 6 1.5mL EP tubes, add 90μL DMEM complete medium to each tube, add 10μL virus stock solution to the first tube, mix well, then pipette 10μL into the second EP tube and mix well. And so on. Add the virus solution to the cells and incubate overnight.

[0092] Day 3: Discard the supernatant and add 100 μL of DMEM + 10% FBS + 1% P / S complete culture medium to each well.

[0093] Day 4: Observe fluorescence under a microscope.

[0094] Day 5: Observe the fluorescence under a fluorescence microscope, take photos and record them, and calculate the titer.

[0095] Titer (TU / mL) = number of cells × fluorescence percentage × 10 3 / Volume of virus stock solution (μL).

[0096] After calculation, the titer of CAR-CD19-GFP virus transfected 293T was 2×10 6 TU / mL( Figure 4 ).

[0097] (III) CAR-CD19-GFP virus transfection 293T

[0098] 1. Day 0: 3×10 5 The 293T cells were seeded in a 6-well plate, the well plate was shaken back and forth and left and right, and incubated in a 37°C, 5% CO2 incubator overnight.

[0099] 2.Day 1:

[0100] 1). When the cells reach 30% to 50% confluence, prepare for transfection. 2 hours before transfection, remove the old culture medium and replace it with 2 mL of serum-free DMEM medium.

[0101] 2). After replacing the serum-free medium for 2 hours, prepare 1 mL of virus solution containing 8 ug / ml polybrene, add it to one well of a six-well plate, and transfect 293T.

[0102] 3). 2 hours after transfection, add 1mL DMEM+10% FBS+1% P / S complete medium to the well of the six-well plate for transfection, and observe the fluorescent cells after 48 hours. Transfection results are shown in Figure 5 .

[0103] (IV) CAR-CD19-GFP virus transfection of NK92

[0104] 1). Prepare a six-well plate and 1 mL of virus solution containing 8 μg / mL polybrene, and add 1 mL of CAR-CD19-GFP virus solution into one well of the six-well plate.

[0105] 2) Centrifuge the NK92 cells cultured in a T25 flask at 1000 rpm for 5 min, remove the supernatant, resuspend in 1 mL VIVO + IL-2 (200 U / mL) + 1% P / S complete medium, count the cells, and take 6×10 5The total volume of the cell suspension was supplemented to 200 μL with VIVO+IL-2 (200 U / mL)+1% P / S complete medium, added to the wells containing the virus solution, and the well plate was gently mixed. At this time, the total volume of the liquid in the well plate was 1.2 mL.

[0106] 3). Pay attention to the cell status (whether there are many dead cells) and fluorescence expression at 24h, 48h, and 72h. At 48h, add 500μL VIVO+IL-2 (200U / mL)+1% P / S complete medium. Transfection results are shown in Figure 6 .

[0107] (V) Screening of stable CAR-CD19-GFP-NK92 strains

[0108] 1). After CAR-CD19-GFP-NK92 cells with GFP are observed under a fluorescence microscope, they are expanded in time, and then a flow cytometry instrument is reserved for GFP+ cell sorting. Before sorting, 1 / 2 of the cells in a T25 bottle are reserved as a backup to prevent the sorted cells from being contaminated and leaving no available cells.

[0109] 2). When performing flow cytometry sorting, prepare two groups, untreated NK92 and CAR-CD19-GFP-NK92. Use untreated NK92 as a negative control, set gate P3, and P2 of CAR-CD19-GFP-NK92 is used as the positively screened cells. The screening results are shown in Figure 7 , where the yellow line segment sets the negative gate P3, and the blue line segment sets the positive gate P2.

[0110] (VI) The process of high expression of empty vector, wild-type PRF1, and mutant PRF1 in CAR-NK-92 cells is as follows:

[0111] (1) Plasmid construction: The design diagram of PRF1-related vectors is shown in the figure below. Figure 8 (The empty vector control plasmid does not contain the hPRF1 gene region).

[0112] Among them, the full-length sequence of the wild-type PRF1 is:

[0113] ATGGCAGCCCGTCTGCTCCTCCTGGGCATCCTTCTCCTGCTGCTGCCCCTGCCCGTCCCTGCCCCGTGCCACACAGCCGCACGCTCAGAGTGCAAGCGCAGCCACAAGTTCGTGCCTGGTGCATGGCTGGCCGGGGAGGGTGTGGACGTGACCAGCCTCCGCCGCTCGGGCTCCTTCCCAGTGGACACACAAAGGTTCCTGCGGCCCGACGGCACCTGCACCCTCTGTGAAAATGCCCTACAGGAGGGCACCCTCCAGCGCCTGCCTCTGGCGCTCACCAACTGGCGGGCCCAGGGCTCTGGCTGCCAGCGCCATGTAACCAGGGCCAAAGTCAGCTCCACTGAAGCTGTGGCCCGGGATGCGGCTCGTAGCATCCGCAACGACTGGAAGGTCGGGCTGGACGTGACTCCTAAGCCCACCAGCAATGTGCATGTGTCTGTGGCCGGCTCACACTCACAGGCAGCCAACTTTGCAGCCCAGAAGACCCACCAGGACCAGTACAGCTTCAGCACTGACACGGTGGAGTGCCGCTTCTACAGTTTCCATGTGGTACACACTCCCCCGCTGCACCCTGACTTCAAGAGGGCCCTCGGGGACCTGCCCCACCACTTCAACGCCTCCACCCAGCCCGCCTACCTCAGGCTTATCTCCAACTACGGCACCCACTTCATCCGGGCTGTGGAGCTGGGTGGCCGCATATCGGCCCTCACTGCCCTGCGCACCTGCGAGCTGGCCCTGGAAGGGCTCACGGACAACGAGGTGGAGGACTGCCTGACTGTCGAGGCCCAGGTCAACATAGGCATCCACGGCAGCATCTCTGCCGAAGCCAAGGCCTGTGAGGAGAAGAAGAAGAAGCACAAGATGACGGCCTCCTTCCACCAAACCTACCGGGAGCGCCACTCGGAAGTGGTTGGCGGCCATCACACCTCCATTAACGACCTGCTGTTCGGGATCCAGGCCGGGCCCGAGCAGTACTCAGCCTGGGTAAACTCGCTGCCCGGCAGCCCTGGCCTGGTGGACTACACCCTGGAACCCCTGCACGTGCTGCTGGACAGCCAGGACCCGCGGCGGGAGGCACTGAGGAGGGCCCTGAGTCAGTACCTGACGGACAGGGCTCGCTGGAGGGACTGCAGCCGGCCGTGCCCACCAGGGCGGCAGAAGAGCCCCCGAGACCCATGCCAGTGTGTGTGCCATGGCTCAGCGGTCACCACCCAGGACTGCTGCCCTCGGCAGAGGGGCCTGGCCCAGCTGGAGGTGACCTTCATCCAAGCATGGGGCCTGTGGGGGGACTGGTTCACTGCCACGGATGCCTATGTGAAGCTCTTCTTTGGTGGCCAGGAGCTGAGGACGAGCACCGTGTGGGACAATAACAACCCCATCTGGTCAGTGCGGCTGGATTTTGGGGATGTGCTCCTGGCCACAGGGGGGCCCCTGAGGTTGCAGGTCTGGGATCAGGACTCTGGCAGGGACGATGACCTCCTTGGCACCTGTGATCAGGCTCCCAAGTCTGGTTCCCATGAGGTGAGATGCAACCTGAATCATGGCCACCTAAAATTCCGCTATCATGCCAGGTGCTTGCCCCACCTGGGAGGAGGCACCTGCCTGGACTATGTCCCCCAAATGCTTCTGGGGGAGCCTCCAGGAAACCGGAGTGGGGCCGTGTGGTGA(SEQ ID No:5, NCBI accession number: NM_005041.6).

[0114] The full-length sequences of the PRF1 mutants are as follows:

[0115] C31Y mutant (PRF1_C31Y, TGC→TAC):

[0116] ATGGCAGCCCGTCTGCTCCTCCTGGGCATCCTTCTCCTGCTGCTGCCCCTGCCCGTCCCTGCCCCGTGCCACACAGCCGCACGCTCAGAGTACAAGCGCAGCCACAAGTTCGTGCCTGGTGCATGGCTGGCCGGGGAGGGTGTGGACGTGACCAGCCTCCGCCGCTCGGGCTCCTTCCCAGTGGACACACAAAGGTTCCTGCGGCCCGACGGCACCTGCACCCTCTGTGAAAATGCCCTACAGGAGGGCACCCTCCAGCGCCTGCCTCTGGCGCTCACCAACTGGCGGGCCCAGGGCTCTGGCTGCCAGCGCCATGTAACCAGGGCCAAAGTCAGCTCCACTGAAGCTGTGGCCCGGGATGCGGCTCGTAGCATCCGCAACGACTGGAAGGTCGGGCTGGACGTGACTCCTAAGCCCACCAGCAATGTGCATGTGTCTGTGGCCGGCTCACACTCACAGGCAGCCAACTTTGCAGCCCAGAAGACCCACCAGGACCAGTACAGCTTCAGCACTGACACGGTGGAGTGCCGCTTCTACAGTTTCCATGTGGTACACACTCCCCCGCTGCACCCTGACTTCAAGAGGGCCCTCGGGGACCTGCCCCACCACTTCAACGCCTCCACCCAGCCCGCCTACCTCAGGCTTATCTCCAACTACGGCACCCACTTCATCCGGGCTGTGGAGCTGGGTGGCCGCATATCGGCCCTCACTGCCCTGCGCACCTGCGAGCTGGCCCTGGAAGGGCTCACGGACAACGAGGTGGAGGACTGCCTGACTGTCGAGGCCCAGGTCAACATAGGCATCCACGGCAGCATCTCTGCCGAAGCCAAGGCCTGTGAGGAGAAGAAGAAGAAGCACAAGATGACGGCCTCCTTCCACCAAACCTACCGGGAGCGCCACTCGGAAGTGGTTGGCGGCCATCACACCTCCATTAACGACCTGCTGTTCGGGATCCAGGCCGGGCCCGAGCAGTACTCAGCCTGGGTAAACTCGCTGCCCGGCAGCCCTGGCCTGGTGGACTACACCCTGGAACCCCTGCACGTGCTGCTGGACAGCCAGGACCCGCGGCGGGAGGCACTGAGGAGGGCCCTGAGTCAGTACCTGACGGACAGGGCTCGCTGGAGGGACTGCAGCCGGCCGTGCCCACCAGGGCGGCAGAAGAGCCCCCGAGACCCATGCCAGTGTGTGTGCCATGGCTCAGCGGTCACCACCCAGGACTGCTGCCCTCGGCAGAGGGGCCTGGCCCAGCTGGAGGTGACCTTCATCCAAGCATGGGGCCTGTGGGGGGACTGGTTCACTGCCACGGATGCCTATGTGAAGCTCTTCTTTGGTGGCCAGGAGCTGAGGACGAGCACCGTGTGGGACAATAACAACCCCATCTGGTCAGTGCGGCTGGATTTTGGGGATGTGCTCCTGGCCACAGGGGGGCCCCTGAGGTTGCAGGTCTGGGATCAGGACTCTGGCAGGGACGATGACCTCCTTGGCACCTGTGATCAGGCTCCCAAGTCTGGTTCCCATGAGGTGAGATGCAACCTGAATCATGGCCACCTAAAATTCCGCTATCATGCCAGGTGCTTGCCCCACCTGGGAGGAGGCACCTGCCTGGACTATGTCCCCCAAATGCTTCTGGGGGAGCCTCCAGGAAACCGGAGTGGGGCCGTGTGGTGA(SEQ ID NO:1).

[0117] G45V mutant (PRF1_G45V, GGG→GTG):

[0118]

[0119] G71V mutant (PRF1_G71V, GGC→GTC):

[0120]

[0121] C76S mutant (PRF1_C76S, TGT→AGT):

[0122]

[0123] The bold font in the sequence indicates the mutation site.

[0124] (2) Lentivirus transfection. The same strategy as above (such as steps (iii) to (iv)) was used to package PRF1-related lentivirus, and the PRF1-related lentivirus was used to infect CAR-CD19-NK-92 cells (cells screened in step (v)). Puromycin was used to screen CAR-CD19-NK-92 cells stably transfected with PRF1 (empty, wild type, mutant), that is, CAR-CD19-NK-92-NC, CAR-CD19-NK-92-PRF1, and CAR-CD19-NK-92-PRF1 were obtained. WT 、CAR-CD19-NK-92-PRF1 C31Y 、CAR-CD19-NK-92-PRF1 G45V 、CAR-CD19-NK-92-PRF1 G71V 、CAR-CD19-NK-92-PRF1 C76S .

[0125] Example 2

[0126] This example is used to analyze the cells obtained in Example 1 (i.e., CAR-NK-92-NC, CAR-NK-92-PRF1 WT 、CAR-NK-92-PRF1 C31Y 、CAR-NK-92-PRF1 G45V 、CAR-NK-92-PRF1 G71V 、CAR-NK-92-PRF1 C76S ) has a killing effect on target cells, and the specific process is as follows:

[0127] Preparation for killing experiment (using Raji cells as an example of target cells):

[0128] Experimental material preparation: 96-well U-shaped plate.

[0129] Experimental cell preparation: Prepare 3×10 cells 15-16 hours before the killing experiment. 6 cells' NK92.

[0130] Gate adjustment compensation group:

[0131] 1) Raji tubes treated with Raji+apoptosis inducers

[0132] 2) Raji+ apoptosis inducer-treated Raji+ single-stained APC tube

[0133] 3) Raji+ apoptosis inducer treated Raji+ single stain 7-AAD tube

[0134] 4) Raji+APC+7-AAD tube treated with Raji+apoptosis inducer

[0135] Experimental process:

[0136] 1. Collection of target cells and cell trace violet staining

[0137] 1) Collect Raji cells from one T25 flask, centrifuge at 1000 rpm for 5 min, and remove the supernatant.

[0138] 2) Take 1 mL of PBS to resuspend Raji and centrifuge at 1000 rpm for 5 min.

[0139] 3) Prepare violet staining solution in a dark place: 1 mL PBS + 1 μL staining solution (5 mM).

[0140] 4) After centrifugation, the Raji cells were resuspended in 1 mL of staining solution and incubated at 37°C in the dark for 30 min.

[0141] 5) After 30 minutes: add 5 times the volume of 1640 + 10% FBS + 1% P / S complete medium to resuspend, incubate at 37°C in the dark for 5 minutes, centrifuge at 1000 rpm for 5 minutes after incubation, add 1 mL VIVO + IL-2 (200 U / mL) + 1% P / S medium to resuspend, transfer to a 1.5 mL EP tube, and count the cells.

[0142] 20uL cell suspension + 20uL trypan blue (i.e. 2-fold dilution), count twice.

[0143] 2. Effector Cell Collection

[0144] 1. Mix the cells in the T25 flask at Day 0, collect 5 mL of NK92 into a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 min, and remove the supernatant.

[0145] 2. Add 1 mL of VIVO+IL-2 (200 U / mL)+1% P / S culture medium to resuspend the cells, transfer the cell suspension to a 1.5 mL EP tube, and then count the cells.

[0146] 20 μL cell suspension + 20 μL trypan blue (i.e. 2-fold dilution), count twice.

[0147] 3. Take 10 5 Target / 10 5 Effector cells Calculate the amount of effector cells and target cells added.

[0148] 4. First add target cells to a well, then add effector cells, and finally add the amount of VIVO medium. The total system is as follows. The amount of each well in a 96-well U-shaped plate: total volume 200 μL, total number of cells 2×10 5 , the effector-target ratio (E:T) was 1:1, and the number of effector cells was 1×10 5 , target cell number 1×10 5 . After calculating the required volume of each cell, write the sequential volume on a sticky note / A4 paper and stick it on the top of the clean bench. Take a 96U well plate, mark the cell name (make a sample addition diagram, that is, mark the volume of effector cells, target cells, and culture medium to be added in each well), first add 100μL VIVO + (200U / mL) IL-2 + 1% P / S complete culture medium to all the required wells, and then add the cells. Adjust the required scale of the gun in advance, add Raji cells first, gently blow the cell suspension evenly (up and down 5 times), and then add the cells to the wells in sequence, and then add NK92 (gently blow the cell suspension evenly (up and down 5 times) and then add it to the wells in sequence). After adding, blow five times with a 200μL gun tip and a 150μL scale, replace each well with a new gun tip, record the date and co-culture time after the suspension is completed, and put it in the incubator.

[0149] 5. Preparation of apoptosis control

[0150] (1) Preparation of Raji cells for apoptosis induction:

[0151] 1) Divide the cell suspension in one EP tube into two EP tubes A and B, and put tube A into the incubator.

[0152] 2) Centrifuge tube B at 1500 rpm for 5 min, discard the supernatant, aspirate the remaining culture medium with a 200 μL pipette, add 200 μL apoptosis inducer to resuspend, place on ice for 30 min, and resuspend in 1 mL PBS after 30 min.

[0153] 3) Take out tube A from the incubator, centrifuge both EP tubes A and B at 1500 rpm for 5 min, add 1 mL 1× binding buffer to each, and divide equally into 4 EP tubes. These four EP tubes are:

[0154] Raji tubes treated with Raji+apoptosis inducers,

[0155] Raji+ apoptosis inducer treated Raji+ single stained APC tube,

[0156] Raji+ apoptosis inducer treated Raji+ single stained 7-AAD tube,

[0157] Raji+Raji+APC+7-AAD tube treated with apoptosis inducer

[0158] Used for gating target cells and effector cells.

[0159] 4) Prepare NK92 to regulate compensation.

[0160] (2) Collect samples and perform flow cytometric analysis after apoptosis staining:

[0161] After 4h / 8h / 24h of co-culture, collect samples, use the 150μL scale of the 200μL gun to gently blow the culture medium, and aspirate the cells into a new marked EP tube with the 200μL gun. Aspirate 200μL PBS to wash the well plate and recover the cells into the EP tube.

[0162] The following operation was performed in a dark environment.

[0163] 1) After the co-culture time is up, use a 200 μL pipette to gently blow the sample in the well 2-3 times to collect the cells into the corresponding 1.5 mL EP tube, and add 200 μL PBS to collect all the remaining cells in the well into the corresponding 1.5 mL EP tube;

[0164] 2) 2000 rpm, 7 min;

[0165] 3) Carefully aspirate the supernatant (leave a small amount), add 500 μL of the prepared 1× binding buffer + APC + 7-AAD mixture, and gently mix 3 to 5 times with the pipette tip;

[0166] During centrifugation, prepare the 1× binding buffer+APC+7-AAD mixture required for all samples and place it on ice;

[0167] For example, for 10 samples, that is, 1×binding buffer 500μL×10=5mL, APC 5μL×10=50μL, 7-AAD 5μL×10=50μL;

[0168] 4) Incubate on ice for about 15 minutes;

[0169] Step 2: Mix the dye mixture and place it on ice, then trigger the flow cytometry machine. The machine takes about 5 minutes to run and 10 minutes to start.

[0170] 5) Streaming analysis.

[0171] The six genotypes of CAR-NK-92 cells were constructed (empty (high expression of pLVX-Puro in CAR-NK-92), PRF1 wild type (high expression of pLVX-PRF1-Puro in CAR-NK-92), PRF1 mutant C31Y (high expression of pLVX-PRF1 in CAR-NK-92), C31Y-Puro), PRF1 mutant G45V (highly expressed in CAR-NK-92 pLVX-PRF1 G45V -Puro), PRF1 mutant G71V (highly expressed in CAR-NK-92 pLVX-PRF1 G71V -Puro), and PRF1 mutant C76S (highly expressed in CAR-NK-92 pLVX-PRF1 C76S -Puro)) and target cells (Raji cells, https: / / www.atcc.org / products / ccl-86) were co-cultured at a 1:1 ratio, and the cell apoptosis detection kit (Annexin V-FITC / PI double staining kit) was used to detect the killing effect of these six cells on target cells after 4 hours. The results showed that compared with the empty vector, high expression of the PRF1 gene can significantly enhance the killing effect of CAR-NK-92; more importantly, several mutant forms of PRF1 (C31Y, G45V, G71V, C76S) have a stronger effect on the killing effect of CAR-NK-92 on target cells than the wild type ( Figure 1 ).

[0172] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of directed mutation of PRF1 gene in enhancing NK cell activity, wherein the nucleotide sequence of the PRF1 gene is shown in SEQ ID NO: 5; The directed mutation is: 1) Compared with SEQ ID NO:5, the 92nd base G is mutated to A; or 2) Compared with SEQ ID NO:5, the 134th base G is mutated to T; or 3) Compared with SEQ ID NO:5, the G at position 212 is mutated to T; or 4) Compared with SEQ ID NO:5, the T at position 226 is mutated to A; The NK cells are CAR-NK cells.

2. A method for enhancing the killing activity of NK cells, comprising the step of directed mutation of the PRF1 gene in NK cells, wherein the directed mutation is: 1) Compared with SEQ ID NO:5, the 92nd base G is mutated to A; or 2) Compared with SEQ ID NO:5, the 134th base G is mutated to T; or 3) Compared with SEQ ID NO:5, the G at position 212 is mutated to T; or 4) Compared with SEQ ID NO:5, the T at position 226 is mutated to A; The NK cells are CAR-NK cells.

3. The method according to claim 2, characterized in that The PRF1 gene sequence after the directed mutation is shown in SEQ ID NO: 1 to SEQ ID NO:

4.

4. A PRF1 mutant, characterized in that The nucleotide sequence of the PRF1 mutant is shown in any one of SEQ ID NO: 1 to SEQ ID NO:

4.

5. An immune cell, characterized in that: The immune cell carries a gene of a PRF1 mutant shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4, and the immune cell is a CAR-NK cell.

6. Use of the immune cells according to claim 5 in the preparation of anti-tumor products or products that enhance the killing effect on tumor cells.

7. A product comprising the PRF1 mutant of claim 4 or the immune cell of claim 5.

Images