Herpes zoster mRNA vaccine and its preparation method and application

Abstract

The present invention belongs to the technical field of mRNA vaccines, and in particular to herpes zoster mRNA vaccines and preparation methods and applications thereof. The herpes zoster mRNA vaccine provided by the present invention contains RNA encoding varicella-zoster virus gE glycoprotein or its variants. The vaccine can prevent herpes zoster infection and its complications.

Description

Technical Field

[0001] The present disclosure belongs to the technical field of mRNA vaccines, and specifically relates to a herpes zoster mRNA vaccine and a preparation method and application thereof. Background Art

[0002] Herpes zoster (shingles) is an infectious skin disease caused by reactivation of the varicella-zoster virus (VZV), which has long been dormant in the dorsal root ganglia of the spinal cord or cranial nerve ganglia. Shingles is a common dermatological disease that, in addition to skin lesions, is often accompanied by neuropathic pain. It is more common in older individuals, those with immunosuppression, or those with immunodeficiency, and is more common in spring and autumn. The incidence rate increases significantly with age.

[0003] After the human body recovers from chickenpox, VZV is not completely eliminated, but remains dormant in the cranial nerve ganglia, dorsal root ganglia and autonomic ganglia of the entire neural axis and persists for life. After chickenpox is caused by VZV infection, the body will produce specific antibodies against VZV and T cell-mediated cellular immunity (such as CD4 + / CD8 + These two immune systems, including VZV and memory T cells, play a crucial role in maintaining VZV latent infection and preventing herpes zoster (shingles). With aging or when external or internal factors suppress the body's immune system occur, VZV can spontaneously reactivate, triggering herpes zoster (HZ).

[0004] Common triggers of herpes zoster include age (such as old age), cellular immune deficiencies, genetic susceptibility, trauma, systemic diseases (such as diabetes and kidney disease), excessive stress, and fatigue. Unlike chickenpox in children, herpes zoster in adults (elderly people) is prone to sequelae, the most common of which is postherpetic neuralgia (PHN), which can cause pain for up to three to 12 months after the recovery from herpes zoster.

[0005] Shingles and postherpetic neuralgia are both common and frequently occurring diseases. The chronic pain (postherpetic neuralgia) and other complications of shingles, commonly known as "snakes around the waist," "snakes around the waist," and "snakes," severely impact patients' quality of life, particularly the elderly and those with weakened immune systems. Because the pain mechanism remains unclear, postherpetic neuralgia remains a difficult-to-treat pain condition.

[0006] Shingles has two notable characteristics: its high rate of infection and the immense suffering it causes those who contract it. European and American survey data indicate that the annual incidence of shingles is generally between 2 and 6 per thousand cases. The incidence rate increases with age. Statistics show that the incidence rate for people aged 10 to 49 is approximately 4 per thousand, while it rises to 14 per thousand for those aged 75 and older. Furthermore, women are slightly more likely to develop shingles than men. The incidence of shingles is currently on the rise worldwide. Surveys from 1994 to 2018 show an annual increase of 3.1%, with a particularly significant increase in the incidence rate for people aged 20 to 49.

[0007] China does not classify herpes zoster as a notifiable Class A or Class B infectious disease, and epidemiological studies of the disease across the entire population are relatively limited. According to statistics, approximately 99.5% of adults aged 50 and over in China harbor VZV, with approximately 1.56 million new cases reported annually. The average annual incidence of herpes zoster in people aged 50 to 60 in my country is 2.66‰, and in people aged 80 and over, the average annual incidence is as high as 8.55‰. The incidence of postherpetic neuralgia (PHN) also increases with age. Studies have shown that the incidence of PHN in elderly patients with herpes zoster in my country is 18.8%, and in those aged 75 and over, it reaches 31.7%.

[0008] Vaccines are the most effective way to prevent herpes zoster. The main technologies involved in the development of herpes zoster vaccines include live attenuated vaccines, recombinant protein vaccines, adenovirus vector vaccines, and mRNA vaccines.

[0009] There are currently only four vaccines for the prevention of shingles worldwide, namely, Merck's live attenuated vaccine Zostavax and ® (discontinued), GlaxoSmithKline (GSK)'s recombinant vaccine Shingrix ® , SK Chemicals Co., Ltd.’s SkyZoster ® (sold only in South Korea), and the recently launched live attenuated vaccine from Biopharma in my country. ® Shingrix is ​​the world's first approved shingles vaccine. It was launched in the United States and Europe in 2006. However, due to its low protective efficacy (effectively reducing the occurrence of herpes by about 70%), it is not suitable for people with immunosuppression or immune system diseases. Its scope of application is greatly limited, and its production was discontinued in 2018. ®Launched in the US in 2017, in Europe in 2018, and with approval in China in 2019, the vaccine is expected to achieve global sales of $2.4 billion in 2021 and $3.2 billion in 2022, ranking among the world's top ten best-selling vaccines for several consecutive years. However, the vaccine is a protein subunit vaccine, and because it uses a special adjuvant from GSK, its price is high and production capacity is difficult to increase. More importantly, it has significant side effects, with a significantly higher incidence of adverse reactions than live attenuated vaccines.

[0010] mRNA vaccines represent a third-generation vaccine technology, surpassing traditional vaccines and protein subunit vaccines. After entering human cells through a specialized delivery system, mRNA vaccines utilize the body's own cells to translate mRNA into protein. The protein, expressed as a viral antigen, is recognized as a foreign antigen by antigen-presenting cells (APCs), driving the maturation of dendritic cells (DCs). This in turn activates B and T cells to generate a strong immune response, eliciting both humoral and cellular responses. mRNA vaccines break away from the immune activation model of traditional vaccines by innovatively utilizing the body's own cells to produce antigens, thereby activating dual-specific immunity, forming immune memory, and providing more durable specific immunity. The greatest advantage of mRNA vaccines is that once the pathogen's antigen gene sequence is known, mRNA vaccines can be rapidly developed. mRNA vaccine technology, due to its rapid design and construction, high adaptability to viral mutations, and efficient, universal, fully synthetic production process platforms, which facilitate standardized production, shortens the production and R&D cycle, and allows for relatively simple processes, enabling rapid mass production.

[0011] Compared with traditional vaccines, the herpes zoster mRNA vaccine has the following advantages: 1) It is a non-infectious, non-integrating reagent, and there is no risk of infection or insertion mutation; 2) mRNA vaccines activate the human body's specific immunity by expressing antigens in the body, which can produce more lasting and effective specific immunity; 3) mRNA vaccines can be stably delivered into the body and efficiently expressed in cells; 4) The production of mRNA vaccines can be subject to rigorous quality control.

[0012] gE is the primary target protein for herpes zoster vaccine development. It is one of the most abundant glycoproteins in VZV and plays a key role in viral replication and spread among ganglion cells. As a heavily glycosylated type I membrane protein, gE can be transported between the endoplasmic reticulum (ER), the trans-Golgi network (TGN), and endosomes.

[0013] Based on the above problems, in order to further reduce the risk of herpes zoster in people with weakened immunity, it is urgent to provide a new type of mRNA vaccine for preventing VZV, which can significantly enhance humoral immunity and cellular immunity after vaccination. Summary of the Invention

[0014] The present invention provides a herpes zoster mRNA vaccine that can safely direct the body's cellular machinery to produce virtually any protein of interest, from native proteins to antibodies and other entirely novel proteins that can have prophylactic activity inside and outside cells. The disclosed herpes zoster mRNA vaccine can be used to elicit a balanced immune response against VZV, encompassing both cellular and humoral immunity, without the many risks associated with vaccination with attenuated viruses.

[0015] RNA (e.g., mRNA) vaccines can be used in various situations depending on the prevalence of infection or the degree or level of unmet medical need. RNA (e.g., mRNA) vaccines can be used to prevent various genotypes, strains, and isolates of VZV. The advantage of RNA (e.g., mRNA) vaccines is that they produce much greater antibody titers and produce responses earlier than commercially available antiviral treatments. Although not wishing to be bound by theory, it is believed that like mRNA polynucleotides, RNA vaccines are better designed to produce the appropriate protein configuration through translation when the RNA vaccine engages the natural cellular machinery. Unlike traditional vaccines that are manufactured in vitro and can trigger adverse cellular responses, RNA (e.g., mRNA) vaccines are delivered to the cellular system in a more natural manner.

[0016] Based on the important structure and biological function of VZV gE protein, the present invention innovatively designed a series of mRNA vaccine candidate antigens and compared them with mRNA vaccines in the prior art (e.g., antigen YK-VZV-007, see CN108472309A; and the marketed recombinant subunit vaccine Shingrix ® ) conducted an immunogenicity comparison and successfully screened several shingles mRNA vaccine candidates with novel antigenic structures and superior immunogenicity, which provided a basis for the successful development of shingles mRNA vaccines.

[0017] Based on the wild-type VZV gE glycoprotein, the present application obtains a variety of RNA encoding VZV gE glycoprotein variants through specific combinations (including sequence truncation, site mutation and / or sequence deletion), and accordingly provides a new mRNA vaccine for preventing VZV. Experiments have shown that vaccination can significantly enhance humoral and cellular immunity, including: increasing the level of IgG antibodies against VZV gE protein, increasing the secretion of immune cells (including IFN-γ + and / or IL-2 + CD4 +and CD8 + ) and promote the secretion of cytokines (including IFN-γ + and IL-2 + )'s shingles mRNA vaccine.

[0018] An mRNA vaccine as provided herein may include an RNA polynucleotide of at least one VZV glycoprotein provided in the accompanying sequence listing, or a fragment, homolog (e.g., having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity) or variant or derivative thereof.

[0019] In some embodiments, the antigen encodes a VZV gE polypeptide.

[0020] In some embodiments, the VZV gE polypeptide (full length) comprises amino acids 1 to 623 (e.g., SEQ ID NOs: 3, 51, 55, 171, 135, 139, 143, 147, 19, 23, 151, 27, 31, 35, 39, 43, 47, 163, 167).

[0021] In some embodiments, the VZV gE polypeptide is a variant. In some embodiments, the VZV gE variant is a truncated polypeptide lacking the anchor domain (ER retention domain).

[0022] In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1 to 539 (eg, SEQ ID NO: 7).

[0023] In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1 to 573 (e.g., SEQ ID NOs: 15, 59, 63, 67, 71, 75, 79, 83, 87, 91).

[0024] In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1 to 568 (eg, SEQ ID NO: 11).

[0025] In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1 to 587 (e.g., SEQ ID NO: 95, 99, 103, 107, 111, 115, 119, 123, 127, 131).

[0026] In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1 to 601 (eg, SEQ ID NOs: 155, 159).

[0027] In some embodiments, the VZV gE variant is a full-length or truncated polypeptide. It also includes a mutation in one or more motifs associated with targeting to the Golgi apparatus or the trans Golgi network (TGN), which results in a reduction in the amount of VZV gE polypeptide targeted or localized to the Golgi apparatus or TGN. In particular, the inventors unexpectedly discovered that the motifs associated with the localization of the gE protein to the Golgi apparatus or the trans Golgi network include "A 568 Y 569 R 570 V 571 " motif (its specific mutant antigen sequence is such as YK-VZV-011 (SEQ ID NO: 35), especially A568D and / or Y569K mutations).

[0028] In addition, in some embodiments, the VZV gE variant may have a Y582A / G mutation, or a Y569K / A mutation, or a combination of Y582G and Y569A mutations. Other types of mutations also include phosphorylation of acidic motifs such as S 593 EST 596 DT 598 (SEQ ID NO: 182) site mutation.

[0029] In some embodiments, the variant VZV gE polypeptide is a full-length or truncated polypeptide, wherein the variant further comprises one or more motifs Y associated with VZV gE internalization or endocytosis. 582 AGL 585 (SEQ ID NO: 185) is mutated, which results in reduced endocytosis of the VZV gE polypeptide.

[0030] In some embodiments, the VZV gE variant is a full-length polypeptide having a Y569K mutation (SEQ ID NOs: 27, 31, 35, 39, 43, 47, 143, 147).

[0031] In some embodiments, the VZV gE variant is a full-length polypeptide having a Y582A mutation (SEQ ID NO: 23, 27, 31, 43, 47, 135, 139, 171).

[0032] In some embodiments, the VZV gE variant is a full-length polypeptide having Y582A and Y569K mutations (SEQ ID NOs: 27, 31, 43, 47).

[0033] In some embodiments, the VZV gE variant is a variant having A 593 EA 595 A 596 DA 598(SEQ ID NO: 183) sequence.

[0034] In some embodiments, the VZV gE variant is a variant having A 593 EA 595 A 596 DA 598 (SEQ ID NO: 183), and a full-length or truncated polypeptide having a Y582G mutation, or a Y569K mutation, or a combination of Y582G and Y569K mutations.

[0035] In some embodiments, the VZV gE variant comprises any one or more site mutations selected from the following group: A568D, Y569K, Y569A, R570E, V571K, Y582A, S593A, S595A, T596A, T598A; preferably A568D, Y569K, R570E, V571K.

[0036] In some embodiments, the site mutation is any one of the following combinations:

[0037] 1) A568D; Y569K; R570E; V571K; (YK-VZV-023, YK-VZV-011)

[0038] 2) A568D; Y569A; R570E; V571K; (YK-VZV-024)

[0039] 3) Y569K; R570E; V571K; (YK-VZV-025)

[0040] 4) A568D; Y569K; R570E; V571K; Y582A; (YK-VZV-030, YK-VZV-013)

[0041] 5) A568D; Y569K; R570E; V571K; Y582G; (YK-VZV-031, YK-VZV-038)

[0042] 6) A568D; Y582A; (YK-VZV-032)

[0043] 7) Y569K; Y582A; (YK-VZV-033, YK-VZV-009)

[0044] 8) R570E; Y582A; (YK-VZV-034)

[0045] 9) V571K; Y582A; (YK-VZV-035)

[0046] 10) S593A; S595A; T596A; T598A; (YK-VZV-016, YK-VZV-044)

[0047] 11) Y582A; S593A; S595A; T596A; T598A; (YK-VZV-037)

[0048] 12) A568D; Y569K; R570E; V571K; Y582G; S593A; S595A; T596A; T598A; (YK-VZV-039)

[0049] 13) A568D; Y569K; R570E; V571K; Y582A; S593A; S595A; T596A; T598A; (YK-VZV-014)

[0050] 14) Y582G; S593A; S595A; T596A; T598A; (YK-VZV-040)

[0051] 15) Y569K; Y582A; S593A; S595A; T596A; T598A; (YK-VZV-010)

[0052] 16) A568D; Y569K; R570E; V571K; S593A; S595A; T596A; T598A; (YK-VZV-012)

[0053] 17) Y582G; (YK-VZV-029)

[0054] 18) A568D; (YK-VZV-018)

[0055] 19) Y569K; (YK-VZV-020)

[0056] 20) R570E; (YK-VZV-021)

[0057] 21) V571K; (YK-VZV-022)

[0058] 22) Y582A; any one of (YK-VZV-028, YK-VZV-036).

[0059] In some embodiments, the VZV gE variant further comprises a sequence deletion, wherein the sequence deletion is selected from any one or more of the following groups:

[0060] 1) A 568 、

[0061] 2) Y569 RVDKSPYNQS 579 、

[0062] 3) Y 569 RVDKSPYNQSMYYAGLPV 587 .

[0063] The VZV gE antigen disclosed herein has multiple combinations of mutations, including truncation of amino acids at the C-terminus of the gE antigen, and deletion or substitution of key amino acid sites, which are further illustrated by specific examples below.

[0064] The present invention also provides a method for preparing the composition, comprising:

[0065] Providing a template for transcribing the VZV RNA;

[0066] Transcription is carried out using the template under conditions suitable for transcribing the RNA.

[0067] In some embodiments, the preparation method comprises the following steps:

[0068] The DNA sequence of VZV gE antigen was synthesized and homologously recombined into the PVAX1 vector;

[0069] The plasmid was obtained after transformation and culture of E. coli;

[0070] The plasmid was digested with enzymes to obtain a linearized plasmid;

[0071] Using T7 RNA polymerase and the linearized plasmid as a template, NTP raw materials are added, and after co-transcription and capping, RNA, preferably mRNA, is purified.

[0072] In some preferred embodiments, the purification method comprises one or a combination of the following: lithium chloride precipitation, affinity chromatography, ultrafiltration exchange, cellulose chromatography.

[0073] In some embodiments, the preparation method of the composition includes synthesizing a DNA sequence according to the antigen gene and inserting it into a plasmid DNA construct, the plasmid DNA is cut with a DNA restriction endonuclease to become a linearized template, and under the catalysis of T7 RNA polymerase, the linearized plasmid is used as a template, key raw materials such as NTP and cap analogs are added, and transcription is performed to prepare synthetic mRNA and RNA modification, and a cap is added to the 5' end. The modified mRNA is subjected to lithium chloride precipitation, affinity chromatography, and other methods to remove impurities such as contaminants, enzymes, and free nucleotides.

[0074] In a third aspect, the composition of the present invention is in the form of a vaccine, i.e., a herpes zoster vaccine. In addition to the composition, the vaccine further comprises a pharmaceutically acceptable carrier.

[0075] In some preferred embodiments, the pharmaceutically acceptable carrier comprises a lipid mixture, preferably lipid nanoparticles LNP.

[0076] In some preferred embodiments, the lipid nanoparticles comprise, for example, cationic lipids, neutral lipids, structured lipids, and polymer-conjugated lipids.

[0077] In a fourth aspect, the present application also provides a method for preparing the vaccine composition, comprising mixing the VZV RNA with the pharmaceutically acceptable carrier, for example, to encapsulate at least a portion of the RNA within lipid nanoparticles. In some embodiments, the preparation method comprises the steps of mixing the RNA, preferably mRNA, with lipid nanoparticles, encapsulating the RNA within the lipid nanoparticles, and removing unencapsulated components by purification.

[0078] In some more specific embodiments, the preparation method includes the following specific steps: formulating the mRNA in the lipid nanoparticles (LNP), that is, mixing the purified mRNA with the lipid mixture in a microfluidic chip, self-assembling to form lipid nanoparticles, the mRNA is encapsulated inside the liposomes, dialyzing or filtering the lipid nanoparticle solution to remove unencapsulated mRNA, non-aqueous solvent and bacteria, storing and packaging the filtered lipid nanoparticle solution into sterile vials, and completing the preparation and production of the mRNA vaccine.

[0079] This application discovered for the first time:

[0080] The present invention provides a novel mRNA vaccine for preventing VZV by combining the wild-type VZV gE glycoprotein in a specific manner (including sequence truncation, site mutation and / or sequence deletion) to obtain several RNAs encoding VZV gE glycoprotein variants. Experiments have shown that vaccination can significantly enhance humoral and cellular immunity, including increasing the level of IgG antibodies against VZV gE protein, increasing the secretion of immune cells (including IFN-γ + and / or IL-2 + CD4 + and CD8 + ) and promote the secretion of cytokines (including IFN-γ + and IL-2 + ) Herpes zoster mRNA vaccine. Specifically, this application includes the following findings and results:

[0081] 1. Western blot analysis of 43 designed VZV gE antigen variants Blot analysis showed that 39 antigen sequences had obvious protein expression, including YK-VZV-001, YK-VZV-003, YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-012, YK-VZV-013, YK-VZV-014, YK-VZV-015, YK-VZV-016, YK-VZV-017, YK-VZV-018, YK-VZV-019, YK-VZV-020, YK-VZV-021, YK-VZV-022, YK-VZV-023, YK-VZV-024, YK-VZV-025, YK-VZV-026, and YK-VZV-027. ZV-027, YK-VZV-028, YK-VZV-029, YK-VZV-030, YK-VZV-031, YK-VZV-032, YK-VZV-033, YK-VZV-034, YK-VZV-035, YK-VZV-036, YK-VZV-037, YK-VZV-038, YK-VZV-039, YK-VZV-040, YK-VZV-044, as well as YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) can be used as effective candidate antigens for the next step of immunogenicity screening and evaluation.

[0082] 2. Based on the above 39 sequences, the following 14 variants were extracted through the gE-specific antibody IgG titer results on day 42, including: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, YK-VZV-020, YK-VZV-030, YK-VZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028 and 4 control sequences YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4).

[0083] The above sequence is Shingrix ® The results are 3.3~5.3 times that of the positive control and 1.8~2.8 times that of the YK-VZV-007 (Comparative Example 4). ®, YK-VZV-007 (Comparative Example 4) and YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3).

[0084] 3. Measure the CD4 secretion of IFN-γ and IL-2 in mouse spleen + T and CD8 + The results of T cell percentage show that

[0085] ①Through CD4 + The T cell ratio was screened out: YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-038, YK-VZV-031. The above 9 sequences:

[0086] IFN-γ + CD4 + T cells and IL-2 + CD4 + Shingrix ® More than 2 times of the positive control, up to 7 times; about 1.8 to 5.3 times of YK-VZV-007 (Comparative Example 4);

[0087] IFN-γ + CD4 + The T cell ratio is 1.00~2.00%, which is Shingrix ® The activity of the positive control vaccine was more than 3 times, with the highest reaching 6.7 times; and it was about 2.2 to 4.4 times that of YK-VZV-007 (Comparative Example 4);

[0088] IL-2 + CD4 + The proportion of T cells is more than 1%, and Shingrix ® It was more than 3.7 times that of the positive control vaccine and more than 2.2 times that of YK-VZV-007;

[0089] ②And further through CD8 + The T cell ratio screened out 5 sequences: YK-VZV-010, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-011:

[0090] IFN-γ + CD8 + T cells and IL-2 + CD8 +The total T cell percentage is more than 4 to 7 times that of Shingrix® vaccine and about 3 to 5 times that of YK-VZV-007 (Comparative Example 4);

[0091] IFN-γ + CD8 + The best T cell ratio is more than 5.0%, which is Shingrix ® It was more than 4.5 to 7.0 times that of the positive control vaccine and about 2.5 to 4.5 times that of YK-VZV-007;

[0092] IL-2 + CD8 + The optimal percentage of T cells is 0.3-0.5%, which is Shingrix. ® It is more than 2.5 to 4.0 times that of the positive control vaccine and about 1.5 to 3.0 times that of YK-VZV-007;

[0093] And they are all significantly higher than the control examples (YK-VZV-004, YK-VZV-006, YK-VZV-045, YK-VZV-007).

[0094] 4. To verify the above results, based on the test results on day 42, the VZV binding-gE antibody IgG titer in the serum of immunized mice on day 56 was further measured for verification.

[0095] The results showed that on the 56th day after mice were immunized with YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-013, YK-VZV-020, YK-VZV-014, YK-VZV-012, YK-VZV-018, YK-VZV-021, YK-VZV-024, YK-VZV-028, YK-VZV-030, YK-VZV-031, and YK-VZV-038 vaccines, the gE-specific antibody IgG titers of the above mRNA vaccines were superior to those of Shingrix. ® Positive control, Shingrix ® About 1.8 to 5.0 times that of the vaccine;

[0096] Among them, the GMT of antibodies of YK-VZV-011, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-010 can reach 650×10 4 The above is Shingrix ®The efficacy of the vaccine was 4.0 to 5.0 times that of the YK-VZV-007 (Comparative Example 4) and more than 2 times that of the YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3).

[0097] 5. Five optimal antigen sequences (including YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018) were screened by comprehensive IgG and multi-parameter flow cytometry test results. ELISpot analysis was used for further validation, and the results are as follows:

[0098] ① The amount of IFN-γ secreted by T cells stimulated by mRNA vaccines was above 500 SFU, with the highest being close to 600 SFU, which is about the same as Shingrix ® The secretion of cytokines stimulated by the mRNA vaccines is 16 to 19 times that of the positive control and 2.5 to 3.0 times that of comparative example 4 (YK-VZV-007); and is significantly better than that of comparative example 1 (YK-VZV-004), comparative example 2 (YK-VZV-006) or comparative example 3 (YK-VZV-045).

[0099] Among them, the mRNA vaccine prepared by the YK-VZV-010 sequence reached a maximum of 598.8 SFU, which is Shingrix ® 18.7 times that of the positive control and nearly 3 times that of the YK-VZV-007 control.

[0100] The IFN-γ secretion levels from high to low are YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-020, and YK-VZV-013. There is no obvious difference between the groups, and the immune effects are good and significant.

[0101] ②The amount of IL-2 secreted by T cells stimulated by mRNA vaccines was above 400~600 SFU, which is Shingrix ® The secretion of cytokines stimulated by the mRNA vaccines is 10 to 16 times that of the positive control and 2.0 to 3.0 times that of the YK-VZV-007 control. It is also significantly better than the cytokines secreted by the mRNA vaccines corresponding to Comparative Example 1 (YK-VZV-004), Comparative Example 2 (YK-VZV-006) or Comparative Example 3 (YK-VZV-045).

[0102] Among them, the mRNA vaccine prepared by the YK-VZV-010 sequence reached a maximum of 614.5 SFU, which is Shingrix ® 16.0 times that of the positive control and more than 3 times that of the YK-VZV-007 control.

[0103] The IL-2 secretion levels from high to low are YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-013, and YK-VZV-020. There is no obvious difference between the groups, and the immune effects are good and significant.

[0104] 6. In addition, the antigen localization results of the above five sequences showed that they were localized in the Golgi apparatus, cell membrane or cytoplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0105] Figure 1 :The main functional domains of VZV gE protein and a series of deletion mutants;

[0106] Figure 2 : YK-VZV-001~YK-VZV-045 antigen expression;

[0107] Figure 3 : Cellular localization of VZV gE antigen in YK-VZV-010, YK-VZV-011, and YK-VZV-013;

[0108] Figure 4 : Cellular localization of VZV gE antigen of YK-VZV-018 and YK-VZV-020. Green indicates gE antigen, yellow and red indicate GM130 and TGN46, respectively. White arrows indicate cell membranes, and orange arrows indicate Golgi apparatus. DETAILED DESCRIPTION

[0109] The present invention is further illustrated by the following examples. It should be understood that the examples are provided for illustration only and are not intended to limit the present invention, and that simple modifications to the present invention based on the technical solution of the present invention fall within the scope of protection of the present invention.

[0110] Herein, the term "selected from" means to select any one or any combination of two or three or more of the listed objects or elements.

[0111] It should be understood that the term "a compound" used herein may include the compound, its N-oxide, its solvate, its pharmaceutically acceptable salt, its stereoisomer, and a mixture thereof.

[0112] Antigen Sequence Design: An antigen is a protein capable of inducing an immune response (e.g., causing the immune system to produce antibodies against the antigen). As used herein, the term "antigen" encompasses both immunogenic proteins and immunogenic fragments (immunogenic fragments that induce or are capable of inducing an immune response to varicella-zoster virus (e.g., VZV), unless otherwise indicated. It should be understood that the term "protein" encompasses peptides, and the term "antigen" encompasses antigenic fragments. Exemplary sequences of VZV antigens and RNA encoding such VZV antigens of the compositions of the present disclosure are provided in Table 1.

[0113] Nucleic acid: Nucleic acids comprise polymers of nucleotides (nucleotide monomers). The compositions of the present disclosure comprise RNA having an open reading frame (ORF) encoding a VZV antigen. In some embodiments, the RNA is messenger RNA (mRNA). In some embodiments, the RNA (e.g., mRNA) further comprises a 5′ UTR, a 3′ UTR, a poly(A) tail, and / or a 5′ cap analog.

[0114] Messenger RNA (mRNA): Any RNA that encodes (at least one) protein (a naturally occurring, non-naturally occurring, or modified amino acid polymer) and can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded protein. A skilled artisan will understand that, unless otherwise indicated, nucleic acid sequences set forth herein may list "T" in representative DNA sequences, but where the sequence represents RNA (e.g., mRNA), "T" will replace "U." Thus, any DNA disclosed and identified herein by a particular sequence identification number also discloses the corresponding RNA (e.g., mRNA) sequence complementary to the DNA, wherein each "T" in the DNA sequence is replaced by a "U."

[0115] Open Reading Frame (ORF): A continuous stretch of DNA or RNA that begins with a start codon (e.g., methionine (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG). An ORF typically encodes a protein. It should be understood that the sequences disclosed herein may also contain additional elements, such as 5' and 3' UTRs.

[0116] Variant RNA: An antigen variant or other polypeptide variant is a molecule whose amino acid sequence differs from that of a wild-type, native, or reference sequence. Antigen / polypeptide variants may have substitutions, deletions, and / or insertions at certain positions within the amino acid sequence compared to the native or reference sequence. Typically, a variant shares at least 50% identity with the wild-type, native, or reference sequence. In some embodiments, a variant shares at least 80% or at least 90% identity with the wild-type, native, or reference sequence.

[0117] In some embodiments, the composition comprises an RNA or RNA ORF comprising the nucleotide sequence of any one of the sequences provided herein (see, e.g., Sequence Listing and Table 1), or a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of any one of the sequences provided herein.

[0118] The term "identity" refers to the relationship between the sequences of two or more polypeptides (e.g., antigens) or polynucleotides (nucleic acids), as determined by comparing the sequences. Identity also refers to the degree of sequence relatedness between or among sequences, as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. Identity measures the percentage of identical matches between the smaller of two or more sequences with gapped alignments (if any), processed by a specific mathematical model or computer program (e.g., an "algorithm"). Identity between related antigens or nucleic acids can be readily calculated by known methods. "Percent identity (%)," when applied to polypeptide or polynucleotide sequences, is defined as the percentage of residues in a candidate amino acid or nucleic acid sequence that are identical to the residues (amino acid residues or nucleic acid residues) in the amino acid or nucleic acid sequence of a second sequence, after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percent identity. Methods and computer programs for alignment are well known in the art. It should be understood that identity is determined by calculating the percent identity, but the value of identity may vary due to gaps and penalties introduced in the calculation. Typically, variants of a particular polynucleotide or polypeptide (e.g., an antigen) have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to the particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altsch et al. (1997), " Gapped BLAST and PSI-BLAST: a new generation of protein database search programs ", Nucleic Acids Res. 25: 3389-3402).

[0119] Therefore, polynucleotides encoding peptides or polypeptides containing substitutions, insertions and / or additions or deletions relative to a reference sequence, particularly an antigen sequence disclosed herein, are included within the scope of the present disclosure. Amino acid residues located in the carboxyl and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted to provide a truncated sequence. Depending on the structure and use of the sequence, the gE protein has some important domains related to its primary function (e.g., Figure 1 The gE protein has some important structural domains related to its main functions (such as Figure 3 ). (1) TM transmembrane domain, consisting of amino acids 539-559; (2) A568YRV571: mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN) and endosomes; (3) Y582AGL585: mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN) and endosomes; (4) S593ES595T596DT598: important glycosylation sites; mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN) and endosomes. In some embodiments, important structural sites can be removed and replaced with appropriate residues to change the transport and expression of the antigen to enhance the immunogenicity of the antigen. Such sequences can be easily identified by those skilled in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminus or C-terminus) that can be deleted, for example, before use in the preparation of RNA (e.g., mRNA) vaccines.

[0120] As will be appreciated by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of the target varicella-zoster virus antigen. For example, any protein fragment of a reference protein (meaning a polypeptide sequence that is at least one amino acid residue shorter than the reference antigen sequence but otherwise identical) is provided herein, provided that the fragment is immunogenic and confers a protective immune response against varicella-zoster virus. In addition to variants that are identical to the reference protein but truncated, in some embodiments, the antigen includes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more site mutations as shown in any sequence provided herein or referenced. The length of the antigen / antigenic polypeptide can range from about 4, 6, or 8 amino acids to the full-length protein.

[0121] VZV antigenic variants: The present invention includes variant VZV antigenic polypeptides. In some embodiments, the variant VZV antigenic polypeptide is a variant VZV gE polypeptide. The variant VZV gE polypeptide is designed to avoid ER / Golgi apparatus retention of the polypeptide, resulting in increased surface expression of the antigen. In some embodiments, the variant gE polypeptide is truncated to remove the ER-retained portion or the cytoplasmic tail of the polypeptide. In some embodiments, the variant VZV gE polypeptide is mutated to reduce localization of the VZV polypeptide to the ER / Golgi apparatus / TGN. Such modifications inhibit ER capture and thereby enhance trafficking to the cell membrane. Therefore, in some embodiments, the VZV glycoprotein is a variant gE polypeptide. VZV gE has a targeting sequence for the TGN at its C-terminus and is transported from the ER to the TGN in infected and gE-transfected cells. Most gE in the TGN appears to be captured from the plasma membrane by endocytosis and delivered from endosomes to the TGN, where it is then recycled to the plasma membrane. gE accumulates in the TGN along with other VZV proteins (e.g., envelope proteins) involved in the production of fully enveloped VZV virions. Thus, mutations that reduce TGN localization and endocytosis facilitate trafficking of gE to the cell membrane. Variant VZV gE polypeptides can be any truncated polypeptide lacking the anchor domain (ER retention domain). For example, variant VZV gE polypeptides can include truncated VZV gE polypeptides comprising at least amino acids 1 to 124, such as amino acids 1 to 124, 1 to 140, 1 to 160, 1 to 200, 1 to 250, 1 to 300, 1 to 350, 1 to 360, 1 to 400, 1 to 450, 1 to 500, 1 to 511, 1 to 550, and 1 to 561, as well as polypeptide fragments having a size within the recited size range. In some embodiments, the variant VZV gE polypeptide is a truncated polypeptide lacking the carboxy-terminal tail domain. Thus, in some embodiments, a truncated VZV gE polypeptide comprises amino acids 1 to 573 of SEQ ID NO: 59. In some embodiments, a variant VZV gE polypeptide comprises at least one mutation in one or more motifs associated with ER retention, wherein the mutation in one or more motifs results in reduced retention of the VZV gE polypeptide in the ER and / or in Golgi apparatus. In some embodiments, a variant VZV gE polypeptide comprises at least one mutation in one or more phosphorylated acidic motifs. For example, a variant VZV gE polypeptide can be a full-length VZV gE polypeptide having a Y582G mutation, a Y569K mutation, or both a Y582G mutation and a Y569K mutation. Alternatively, a variant VZV gE polypeptide can be an antigenic fragment comprising, for example, amino acids 1 to 573 of VZV gE and having a Y569K mutation. Alternatively, a variant VZV gE polypeptide can be an antigenic fragment having a mutation in an acidic phosphorylated motif, such as an SSTT motif.For example, the variant VZV gE polypeptide can be an antigenic fragment having the sequence AEAADA (SEQ ID NO: 183).

[0122] Naturally occurring eukaryotic mRNA molecules may contain stabilizing elements, including but not limited to untranslated regions (UTRs) at their 5' end (5'UTR) and / or at their 3' end (3'UTR), in addition to other structural features such as a 5'-cap structure or a 3'-poly (A) tail. Both the 5'UTR and the 3'UTR are typically transcribed from genomic DNA and are elements of pre-mature mRNA. Characteristic structural features of mature mRNA (e.g., 5'-cap and 3'-poly (A) tail) are typically added to the transcribed (pre-mature) mRNA during mRNA processing.

[0123] In some embodiments, the composition includes an RNA polynucleotide having an open reading frame encoding at least one antigenic polypeptide having at least one modification, at least one 5′ terminal cap, and is formulated within a lipid nanoparticle. 5′-capping of the polynucleotide can be accomplished simultaneously during an in vitro transcription reaction using a chemical RNA cap analog according to the manufacturer's protocol to produce a 5′-guanosine cap structure. In some cases, 5′-capping of the modified RNA can also be accomplished post-transcriptionally using a vaccinia virus capping enzyme to produce a “cap” structure. The Cap 1 structure can be generated using a vaccinia virus capping enzyme and a 2′-O methyltransferase to produce: m7G(5′)ppp(5′)G-2′-O-methyl. The Cap 2 structure can be generated from the Cap 1 structure, followed by 2′-O-methylation of the 5′-third-to-last nucleotide using a 2′-O methyltransferase. The Cap 3 structure can be generated from the Cap 2 structure, followed by 2′-O-methylation of the 5′-fourth-to-last nucleotide using a 2′-O methyltransferase. The enzyme can be derived from a recombinant source. The 3′-poly(A) tail is typically a stretch of adenine nucleotides added to the 3′ end of a transcribed mRNA. In some cases, it can contain up to approximately 400 adenine nucleotides. In some embodiments, the length of the 3′-poly(A) tail may be essential for the stability of a particular mRNA.

[0124] Chemical Modifications: In some embodiments, the compositions of the present disclosure comprise RNA having an open reading frame encoding a VZV antigen, wherein the nucleic acid comprises nucleotides and / or nucleosides that may be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides may be naturally occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications may include those modifications recognized in the art to the sugar, backbone, or nucleobase moieties of the nucleotides and / or nucleosides.

[0125] In some embodiments, the naturally occurring modified nucleotides or nucleosides of the present disclosure are nucleotides or nucleosides that are generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleosides can be found in the widely recognized MODOMICS database.

[0126] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of the present disclosure are generally known or generally recognized nucleotides or nucleosides in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides are particularly found in disclosed U.S. application numbers PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367, which are incorporated herein by reference.

[0127] Thus, the nucleic acids of the disclosure (eg, DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

[0128] In some embodiments, nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) comprise multiple (more than one) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a specific region of a nucleic acid contains one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0129] In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid) introduced into a cell or organism exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0130] In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid) introduced into a cell or organism can exhibit reduced immunogenicity in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0131] In some embodiments, nucleic acids (e.g., RNA nucleic acids, e.g., mRNA nucleic acids) comprise non-naturally modified nucleotides that are introduced during or after the synthesis of the nucleic acid to achieve a desired function or property. Modifications may be present in internucleotide linkages, purine or pyrimidine bases, or sugars. Modifications may be introduced chemically or by polymerase at the ends of the chain or anywhere else in the chain. Any region of the nucleic acid may be chemically modified.

[0132] The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids, e.g., mRNA nucleic acids). "Nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or its derivatives in combination with an organic base (e.g., purine or pyrimidine) or its derivatives (also referred to herein as "nucleobase"). "Nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized by any useful method, such as chemical, enzymatic, or recombinant methods, to include one or more modified or non-natural nucleosides. Nucleic acids can include one or more regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid will include regions of nucleotides.

[0133] Modified nucleotide base pairing not only encompasses standard adenosine-thymine, adenosine-uracil or guanosine-cytosine base pairs, but also includes base pairs formed between nucleotides and / or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonds between non-standard bases and standard bases or between two complementary non-standard base structures, such as in those nucleic acids with at least one chemical modification. An example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of bases / sugars or linkers may be incorporated into the nucleic acids of the present disclosure.

[0134] In some embodiments, the modified nucleobase in a nucleic acid (e.g., an RNA nucleic acid, e.g., an mRNA nucleic acid) comprises 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, the modified nucleobase in a nucleic acid (e.g., an RNA nucleic acid, e.g., an mRNA nucleic acid) comprises 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, the polyribonucleotide comprises a combination of at least two (e.g., 2, 3, 4, or more) of any of the modified nucleobases mentioned above, including but not limited to chemical modifications.

[0135] In some embodiments, the mRNA of the present disclosure comprises a 1-methyl-pseudouridine (m1ψ) substitution at one or more or all uridine positions of the nucleic acid.

[0136] In some embodiments, an mRNA of the present disclosure comprises a 1-methyl-pseudouridine (mlψ) substitution at one or more or all uridine positions of the nucleic acid and a 5-methylcytidine substitution at one or more or all cytidine positions of the nucleic acid.

[0137] In some embodiments, the mRNA of the present disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0138] In some embodiments, for a particular modification, the mRNA is uniformly modified (e.g., completely modified, modified throughout the entire sequence). For example, a nucleic acid can be uniformly modified with 1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacing it with a modified residue (e.g., those described above).

[0139] The nucleic acid may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any intervening percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 10 ... % to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It is understood that the presence of unmodified A, G, U, or C accounts for any remaining percentage.

[0140] The mRNA may contain a minimum of 1% and a maximum of 100% modified nucleotides or any intermediate percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acid may contain modified pyrimidines, such as modified uracils or cytosines. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are replaced by modified uracils (e.g., 5-substituted uracils). The modified uracils may be replaced by compounds having a single unique structure, or may be replaced by multiple compounds having different structures (e.g., 2, 3, 4, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the nucleic acid are replaced by modified cytosines (e.g., 5-substituted cytosines). The modified cytosines can be replaced by a compound having a single unique structure, or can be replaced by multiple compounds having different structures (e.g., 2, 3, 4, or more unique structures).

[0141] Untranslated Regions (UTRs): The mRNAs disclosed herein may contain one or more regions or portions that function as or are used as untranslated regions. When the mRNA is designed to encode at least one target antigen, the nucleic acid may contain one or more of these untranslated regions (UTRs). The wild-type untranslated region of a nucleic acid is transcribed but not translated. In an mRNA, the 5′ UTR begins at the transcription start site and continues up to, but not including, the start codon; whereas the 3′ UTR begins immediately after the stop codon and continues to the transcription termination signal. There is growing evidence that UTRs play a regulatory role in the stability and translation of nucleic acid molecules. Regulatory features of UTRs may be incorporated into the polynucleotides disclosed herein to, among other things, enhance the stability of the molecule. Specific features may also be incorporated to ensure controlled downregulation of transcripts in the event that transcripts are misdirected to undesirable organ sites. A variety of 5′ UTR and 3′ UTR sequences are known and available in the art.

[0142] In some embodiments of the present disclosure, the 5'UTR is a heterologous UTR, i.e., a UTR that is found in nature and is associated with a different ORF. In another embodiment, the 5'UTR is a synthetic UTR, i.e., one that does not occur in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties, e.g., to increase gene expression, as well as completely synthetic UTRs. Exemplary 5'UTRs include Xenopus or human α-globin or β-globin (8278063; 9012219), human cytochrome b-245a polypeptide and hydroxysteroid (17b) dehydrogenase, and tobacco etch virus (US 8278063, 9012219).

[0143] In some embodiments, the 5′UTR of the present disclosure comprises a sequence selected from SEQ ID NOs: 173-174.

[0144] In some preferred embodiments, the 5'UTR of the present disclosure comprises a sequence selected from SEQ ID NO:174.

[0145] The 3′ UTR is the region of an mRNA immediately downstream (3′) of the stop codon (the codon that signals the end of translation of an mRNA transcript). The 3′ UTR does not encode protein (it is non-coding). Natural, or wild-type, 3′ UTRs are known to have stretches of adenosine (A) and uridine (U) embedded within them. These AU-rich marks are particularly prevalent in genes with high turnover rates.

[0146] The introduction, removal, or modification of 3′ UTR AU-rich elements (AREs) can be used to modulate the stability of nucleic acids (e.g., RNA) disclosed herein. When engineering a particular nucleic acid, one or more copies of an ARE can be introduced to render the disclosed nucleic acid less stable, thereby reducing translation and decreasing production of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase intracellular stability, thereby increasing translation and production of the resulting protein.

[0147] The 3'UTR may be heterologous or synthetic. Regarding 3'UTRs, globin UTRs (including the Xenopus β-globin UTR and the human β-globin UTR) are known in the art (8278063, 9012219, US20110086907). Nucleic acids (e.g., mRNAs) encoding modified β-globins with enhanced stability in some cell types have been developed by cloning two consecutive human β-globin 3'UTRs end-to-end, and are well known in the art (US2012 / 0195936, WO2014 / 071963).

[0148] In some embodiments, the 3'UTR of the present disclosure comprises a sequence selected from SEQ ID NO:175.

[0149] One of ordinary skill in the art will appreciate that a heterologous or synthetic 5'UTR can be used with any desired 3'UTR sequence. For example, a heterologous 5'UTR can be used with a synthetic 3'UTR or a heterologous 3'UTR.

[0150] It should be understood that any UTR from any gene can be incorporated into the region of the nucleic acid. In addition, multiple wild-type UTRs of any known gene can be utilized. Providing artificial UTRs that are not variants of the wild-type region is also within the scope of the present disclosure. These UTRs or portions thereof can be placed in the same orientation as in the transcript from which they are selected, or can be altered in orientation or position. Thus, a 5' or 3' UTR can be inverted, shortened, extended, or prepared together with one or more other 5' or 3' UTRs. As used herein, the term "altered" when referring to a UTR sequence means that the UTR has been altered in some way relative to a reference sequence. For example, a 3' or 5' UTR can be altered relative to a wild-type or native UTR by a change in orientation or position as taught above, or by including additional nucleotides, deletion of nucleotides, exchange of nucleotides, or transposition. Any of these alterations that produce an "altered" UTR (whether 3' or 5') comprises a variant UTR.

[0151] RNA in vitro transcription: cDNA encoding the polynucleotides described herein can be transcribed using an in vitro transcription (IVT) system. In some embodiments, the RNA transcripts are produced in an in vitro transcription reaction using a non-amplified, linearized DNA template to produce RNA transcripts. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by enzymatic digestion of circular plasmid DNA. In some embodiments, cells, such as bacterial cells, such as Escherichia coli, such as DH-1 cells, are transfected with the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, and the plasmid DNA is then isolated and purified. In some embodiments, the DNA template includes an RNA polymerase promoter, such as a T7 promoter located 5′ to and operably linked to the gene of interest.

[0152] In some embodiments, the in vitro transcription template encodes a 5′ untranslated (UTR) region, contains an open reading frame, and encodes a 3′ UTR and a poly(A) tail. The specific nucleic acid sequence composition and length of the in vitro transcription template will depend on the mRNA encoded by the template.

[0153] A "5' untranslated region" (UTR) refers to a region of an mRNA that is located immediately upstream (i.e., 5') of the start codon (i.e., the first codon of an mRNA transcript translated by the ribosome) and does not encode a polypeptide. When an RNA transcript is produced, the 5' UTR may contain a promoter sequence. Such promoter sequences are known in the art. It is understood that such promoter sequences will not be present in the vaccines of the present disclosure.

[0154] A "3' untranslated region" (UTR) refers to the region of an mRNA that does not encode a polypeptide and is located immediately downstream (ie, 3') of the stop codon (ie, the codon of the mRNA transcript that signals the termination of translation).

[0155] An "open reading frame" is a continuous stretch of DNA that begins with a start codon (eg, methionine (ATG)) and ends with a stop codon (eg, TAA, TAG, or TGA) and encodes a polypeptide.

[0156] A "poly(A) tail" is a region of an mRNA located downstream, for example, immediately downstream (i.e., 3'), of the 3' UTR containing multiple consecutive adenosine monophosphates. The poly(A) tail may contain 10 to 300 adenosine monophosphates. For example, the poly(A) tail may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, the poly(A) tail contains 50 to 250 adenosine monophosphates. In relevant biological settings (eg, in cells, in vivo), the poly(A) tail serves to protect mRNA from enzymatic degradation, eg, in the cytoplasm, and aids in transcription termination, and / or mRNA export from the nucleus and translation.

[0157] In some embodiments, the nucleic acid includes 200 to 3,000 nucleotides. For example, the nucleic acid can include 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides).

[0158] In vitro transcription systems typically contain transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, inorganic pyrophosphate, and a polymerase.

[0159] The NTPs can be made in-house, can be selected from a supplier, or can be synthesized as described herein. The NTPs can be selected from, but are not limited to, those described herein, including natural and non-natural (modified) NTPs.

[0160] Any number of RNA polymerases or variants can be used in the methods of the present disclosure. The polymerase can be selected from, but is not limited to, bacteriophage RNA polymerases, such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or mutant polymerases, such as, but not limited to, polymerases capable of incorporating modified nucleic acids and / or modified nucleotides (including chemically modified nucleic acids and / or nucleotides). Some embodiments exclude the use of DNA enzymes.

[0161] In some embodiments, the RNA transcript can be capped by enzymatic capping or a co-transcriptional capping reaction. In some embodiments, the RNA comprises a 5' terminal cap, eg, 7mG(5')ppp(5')NlmpNp.

[0162] Purification of mRNA: Purification of nucleic acids described herein may include, but is not limited to, nucleic acid cleanup, quality assurance, and quality control. Purification can be performed by methods known in the art, such as, but not limited to, lithium chloride precipitation, beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNAT™ oligo-T capture probes (Beckman Coulter, Vedbaek, Denmark), or HPLC-based purification methods, such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified," when used with respect to nucleic acids, such as "purified nucleic acid," refers to nucleic acids that have been separated from at least one contaminant. A "contaminant" is any substance that renders another substance unsuitable, impure, or inferior. Thus, purified nucleic acids (e.g., DNA and RNA) are present in a form or environment different from that in which they are found in nature, or in a form or environment different from that in which they existed prior to treatment or purification methods.

[0163] Quality assurance and / or quality control checks may be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0164] Quantification: In some embodiments, nucleic acids can be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is a Spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acids can be analyzed to determine whether the nucleic acids are of the appropriate size and to verify that the nucleic acids have not been degraded. Nucleic acid degradation can be checked by methods such as, but not limited to, agarose gel electrophoresis; HPLC-based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC); liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0165] Lipid Nanoparticles (LNPs): In some embodiments, the RNA (e.g., mRNA) disclosed herein is formulated in lipid nanoparticles (LNPs). Lipid nanoparticles typically contain ionizable cationic lipids, non-cationic lipids, sterols, and PEG lipid components, as well as a target nucleic acid cargo. The lipid nanoparticles of the present disclosure can be produced using components, compositions and methods generally known in the art, see, for example, CN116535381B, TW202340136A, CN116178193B, CN116178193B, CN115784921B, CN115745820B, CN115677518B, CN114957027B, CN114044741B, CN116854754A, CN116785265A, CN116789764A, CN116396178A, CN116375592A, CN116082275A, all of which are incorporated herein by reference in their entirety.

[0166] As used herein, the term "cationic lipid" refers to a lipid that is positively charged at a selected pH. Cationic liposomes readily bind to negatively charged nucleic acids, interacting with the negatively charged phosphate groups present in nucleic acids through electrostatic forces to form lipid nanoparticles (LNPs). LNPs are currently one of the most popular delivery vehicles.

[0167] In this article, the term "neutral lipid" refers to lipids that are uncharged or exist as zwitterions at a selected pH value. These neutral lipids may regulate nanoparticle fluidity by promoting lipid phase transition to a lipid bilayer structure and improve efficiency, while also potentially influencing target organ specificity.

[0168] In this article, "structured lipid" refers to a lipid that enhances the stability of nanoparticles by filling the gaps between the lipids. The structured lipid can be selected from, but is not limited to, the group consisting of: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatine, ursolic acid, alpha-tocopherol, corticosteroids, and mixtures thereof. In some embodiments, the structured lipid is cholesterol. In some embodiments, the structured lipid includes cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) or any combination thereof.

[0169] In some embodiments, the molar ratio of the cationic lipid to the structural lipid is about 1:1 to 5:1, for example, about 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2.0:1.

[0170] In some embodiments, the molar ratio of the cationic lipid to the neutral lipid is about (1-10):1, for example, about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1.

[0171] In some embodiments, the molar ratio of the cationic lipid to the structural lipid is about (1-5):1, for example, about 1:1, 2:1, 3:1, 4:1 or 5:1.

[0172] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65): (5-25): (25-45): (0.5-5). For example, in some embodiments, based on the proportion (relative molar number), the cationic lipid is 25 parts, 30 parts, 35 parts, 40 parts, 45 parts, 50 parts, 55 parts, 60 parts, or 65 parts, the neutral lipid is 5 parts, 10 parts, 15 parts, 20 parts, or 25 parts, the structural lipid is 25 parts, 30 parts, 35 parts, 40 parts, or 45 parts, and the polymer-conjugated lipid is 0.5 parts, 1 part, 1.5 parts, 2 parts, 2.5 parts, 3.0 parts, 3.5 parts, 4.0 parts, 4.5 parts, or 5.0 parts.

[0173] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (49-50):10:(38.5-39.5):1. For example, in some embodiments, based on the ratio (relative molar number), the cationic lipid is 49 parts or 50 parts, the neutral lipid is 10 parts, the structural lipid is 38.5 parts, 39.0 parts, or 39.5 parts, and the polymer-conjugated lipid is 1 part; for example, it is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0174] As used herein, the term "polymer-conjugated lipid" refers to a lipid modified with polyethylene glycol (PEG). Hydrophilic PEG stabilizes LNPs, regulates nanoparticle size by limiting lipid fusion, and increases nanoparticle half-life by reducing nonspecific interactions with macrophages. In some embodiments, the polymer-conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol. PEG-modified PEG typically has a molecular weight of 350-5000 Da. For example, the polymer-conjugated lipid is selected from one or more of the following: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG2000), and methoxypolyethylene glycol ditetradecanoyl acetamide (ALC-0159).

[0175] In one embodiment of the composition / vector of the present disclosure, the polymer-conjugated lipid is DMG-PEG2000.

[0176] In one embodiment of the composition / vector of the present disclosure, the vector comprises a neutral lipid, a structural lipid and a polymer-conjugated lipid, and the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is (25-65):(5-25):(25-45):(0.5-5), for example (45-55):(9-11):(34-43):(0.5-2.5).

[0177] In one embodiment of the composition / vector of the present disclosure, the vector comprises a neutral lipid, a structural lipid and a polymer-conjugated lipid, and the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is 50:10:38.5:1.5.

[0178] As used herein, the term "alkyl" refers to a monovalent saturated aliphatic hydrocarbon group, including both branched and straight chains, having the specified number of carbon atoms. The term "alkylene" refers to a divalent saturated aliphatic hydrocarbon group, including both branched and straight chains, having the specified number of carbon atoms. n~m It refers to a group having n to m carbon atoms. For example, C 2~5 Alkylene includes C2 alkylene, C3 alkylene, C4 alkylene, and C5 alkylene. 2~8 Alkylene includes C2 alkylene, C3 alkylene, C4 alkylene, C5 alkylene, C6 alkylene, C7 alkylene, and C8 alkylene. 1~6 Alkylene includes C1 alkylene, C2 alkylene, C3 alkylene, C4 alkylene, C5 alkylene, and C6 alkylene. 1~3 Alkylene includes C1 alkylene, C2 alkylene, and C3 alkylene. 6～15 The straight chain alkyl group includes a straight chain alkyl group having a carbon number of 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15. 12～25 Branched chain alkyl groups include those with carbon numbers of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. The alkyl (or alkylene) group can be unsubstituted, or the alkyl (or alkylene) group can be substituted where at least one hydrogen is replaced with another chemical group.

[0179] As used herein, a "therapeutically effective amount" is an amount of a therapeutic agent that, when administered to a patient, ameliorates a disease or symptom. A "prophylactically effective amount" is an amount of a prophylactic agent that, when administered to a subject, prevents a disease or symptom. The amount of a therapeutic agent that constitutes a "therapeutically effective amount" or the amount of a prophylactic agent that constitutes a "prophylactically effective amount" will vary depending on the therapeutic agent / prophylactic agent, the disease state and its severity, the age and weight of the patient / subject to be treated / prevented, etc. A person of ordinary skill in the art can routinely determine a therapeutically effective amount and a prophylactically effective amount based on their knowledge and the present disclosure.

[0180] In some embodiments, the composition can be used to induce a protective immune response against VZV in a subject in need thereof, wherein the protective immune response comprises, for example, the production of neutralizing antibodies. In some embodiments, the subject is immunocompromised. The subject is over 10 years old, such as 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 years old.

[0181] The vaccines of the present disclosure are typically formulated in lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0182] In some preferred embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structured lipids, and polymer-conjugated lipids.

[0183] In some preferred embodiments, the cationic lipid is a compound of formula I, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1～6 Alkylene G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C 6～15 Straight chain alkyl; L2 is C 12～25 Branched alkyl, for example, YK-009 of formula II (see patent CN114044741B).

[0184]

[0185] In some preferred embodiments, the cationic lipid is a compound of formula II, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight or branched alkyl; R2 is C 6~25 Straight-chain or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 with formula II-I and YK-402 with formula II-II (see patent CN115784921B).

[0186]

[0187] In some preferred embodiments, the cationic lipid is a compound of formula III, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight or branched alkyl; R2 is C 12~25Branched alkyl group; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2)-, (HO(CH2)2)2N(CH2)2)-, CH3O(CH2)2N(CH3)(CH2)2), (CH3)2N(CH2)3SC(O)O(CH2)2)-, (CH3)2N(CH2)3SC(O))-, CH3NH(CH2)2N(CH3)(CH2)2), or CH3CH2NH(CH2)2-. For example, YK-201 of formula III-I and YK-202 of formula III-II (see patent CN115677518B).

[0188]

[0189] In some preferred embodiments, the cationic lipid is a compound of formula IV, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight or branched alkyl; R2 is C 12~25 Straight-chain or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, where R3 is -CH3, -CH2CH3, or -CH2CH2OH. For example, YK-305 of formula IV-I and YK-310 of formula IV-II (see patent CN115745820B).

[0190]

[0191] In some preferred embodiments, the cationic lipid is a compound of formula V, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G 1 and G 2 Each independently is an unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 Alkenyl; R 3 OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or –NR 5 C(=O)R 4 ; R 4C1-C 12 hydrocarbon group; and R 5 is H or a C1-C6 hydrocarbon group; for example, ALC0315 of formula VI (see patent CN108368028B);

[0192] .

[0193] In some preferred embodiments, the cationic lipid is a compound of formula VI, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein R4 is selected from -(-(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) n N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycle; n is 1, 2 or 3; for example, SM102 of formula VI-I structure (see patent CN110520409A).

[0194]

[0195] In some preferred embodiments, the cationic lipid is a compound of formula VII, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0196]

[0197] In some more preferred embodiments, the cationic lipids include YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0198] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:(1-10):1.

[0199] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is (1-5):1.

[0200] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is (25-75): (5-25): (15-65): (0.5-10).

[0201] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is (35-49): (7.5-15): (35-55): (1-5), for example, 49:10:43.5:1.5.

[0202] In some preferred embodiments, the neutral lipids include one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol and derivatives thereof.

[0203] In some more preferred embodiments, the neutral lipid is selected from one or more of the following: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1-,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-oic acid choline, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16 .0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl Phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

[0204] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0205] In some preferred embodiments, the structured lipid is selected from one or more of the following: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, and corticosteroids.

[0206] In some more preferred embodiments, the structured lipid is cholesterol.

[0207] In some preferred embodiments, the polymer-conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.

[0208] In some more preferred embodiments, the polymer-conjugated lipid is selected from one or more of the following: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000) and methoxy polyethylene glycol ditetradecanoyl acetamide (ALC-0159).

[0209] Pharmaceutical Formulations: Provided herein are compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for preventing or treating varicella-zoster virus, for example, in humans and other mammals. The compositions provided herein can be used as therapeutic or prophylactic agents. They can be used in medicine to prevent and / or treat herpes zoster.

[0210] In some embodiments, a shingles vaccine containing an RNA as described herein can be administered to a subject (eg, a mammalian subject, such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide (antigen).

[0211] An "effective amount" of a composition (e.g., comprising RNA) is based, at least in part, on the target tissue, target cell type, mode of administration, physical characteristics of the RNA (e.g., length, nucleotide composition, and / or degree of modified nucleosides), other components of the vaccine, and other determinants, such as the age, weight, height, sex, and general health of the subject. Generally, an effective amount of a composition provides an induced or enhanced immune response that varies with antigen production in the subject's cells. In some embodiments, an effective amount of a composition comprising an RNA polynucleotide having at least one chemical modification is more effective than a composition comprising a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production can be demonstrated by increased cell transfection (percentage of cells transfected with the RNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleic acid degradation (e.g., as evidenced by an increase in the duration of protein translation from the modified polynucleotide), or altered antigen-specific immune responses in host cells.

[0212] The term "pharmaceutical composition" refers to the combination of an active agent and an inert or active carrier, such that the composition is particularly suitable for in vivo or ex vivo diagnostic or therapeutic use. A "pharmaceutically acceptable carrier" does not cause undesirable physiological effects upon or upon administration to a subject. The carrier in a pharmaceutical composition must also be "acceptable" in the sense that it is compatible with and capable of stabilizing the active ingredient. One or more solubilizing agents may be used as pharmaceutical carriers for the delivery of the active agent.

[0213] In some embodiments, compositions according to the present disclosure (comprising polynucleotides and polypeptides encoded thereby) can be used to treat or prevent herpes zoster. The compositions can be administered prophylactically or therapeutically to healthy individuals as part of an active immunization regimen or early in the course of infection, either during the incubation period or during active infection after symptom onset. In some embodiments, the amount of RNA provided to a cell, tissue, or subject can be an amount effective for immunoprophylaxis.

[0214] In some embodiments, the composition may be administered by intramuscular injection.

[0215] Depending on the prevalence of infection or the extent or level of unmet medical need, the compositions can be used in a variety of settings. As a non-limiting example, RNA vaccines can be used to treat and / or prevent a variety of infectious diseases. RNA vaccines have superior properties because they produce much greater antibody titers, better neutralizing immunity, more durable immune responses, and / or earlier responses than commercially available vaccines.

[0216] Provided herein are pharmaceutical compositions comprising RNA and / or complexes, optionally in combination with one or more pharmaceutically acceptable excipients. In addition to conventional excipients (e.g., any and all solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surfactants, isotonicity agents, thickeners or emulsifiers, preservatives), excipients may include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipid complexes, core-shell nanoparticles, peptides, proteins, cells transfected with RNA (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

[0217] The RNA may be formulated or administered alone, or in combination with one or more other components. For example, the immunogenic composition may comprise other components, including but not limited to adjuvants.

[0218] The relative amounts of the active ingredient, pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical compositions according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated and further depending on the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 100%, such as between 0.5% and 50%, between 1% and 30%, between 5% and 80%, or at least 80% (w / w) of the active ingredient.

[0219] In some embodiments, RNA is formulated with one or more excipients to increase mRNA stability, increase cell transfection efficiency and protein translation efficiency, alter the biodistribution of mRNA to target it to specific tissues or cell types, and other functions.

[0220] Administration: Provided herein are immunogenic compositions (e.g., RNA vaccines), methods, kits, and reagents for preventing varicella-zoster virus infection in humans and other mammals. The immunogenic compositions can be used as therapeutic or prophylactic agents. In some embodiments, the immunogenic compositions are used to provide prophylactic protection against herpes zoster.

[0221] The subject can be any mammal, including non-human primates and human subjects.

[0222] In some embodiments, an immunogenic composition (e.g., an mRNA vaccine) is administered to a subject (e.g., a mammalian subject, such as a human subject) in an amount effective to induce an antigen-specific immune response. The RNA encoding the VZV gE antigen is expressed and translated in vivo to produce the antigen, which then stimulates an immune response in the subject.

[0223] Following administration of the immunogenic compositions of the present disclosure (e.g., mRNA vaccines), prophylactic protection against herpes zoster can be achieved. The immunogenic compositions can be administered one, two, three, four, or more times, but it is possible that a single administration of the vaccine may be sufficient (optionally followed by a single booster).

[0224] In aspects of the present disclosure, methods are provided for eliciting an immune response in a subject against a varicella-zoster virus antigen (or antigens). In some embodiments, the methods comprise administering to a subject an immunogenic composition comprising RNA (e.g., mRNA) having an open reading frame encoding a VZV gE glycoprotein, thereby inducing an immune response in the subject specific for the varicella-zoster virus antigen, wherein the anti-antigen antibody titer in the subject is increased following vaccination relative to the anti-antigen antibody titer in subjects vaccinated with conventional vaccines (e.g., GSK's recombinant subunit vaccine). "Anti-antigen antibodies" are serum antibodies that specifically bind to the antigen.

[0225] A prophylactically effective dose is an effective dose that prevents viral infection at a clinically acceptable level. In some embodiments, the effective dose is the dose listed in the instructions or package insert for the vaccine. As used herein, traditional vaccines refer to vaccines other than the mRNA vaccines of the present disclosure. For example, traditional vaccines include (but are not limited to) live microbial vaccines, killed microbial vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, virus-like particle (VLP) vaccines, etc. In exemplary embodiments, traditional vaccines are vaccines that have been approved by regulatory authorities and / or registered with national drug regulatory agencies (e.g., the U.S. Food and Drug Administration (FDA) or the European Medicines Agency (EMA)).

[0226] In other aspects of the present disclosure, methods for eliciting an immune response against varicella-zoster virus in a subject are provided. The method comprises administering to the subject an immunogenic composition (e.g., an RNA vaccine) comprising an RNA polynucleotide comprising an open reading frame encoding a VZV gE antigen, thereby inducing an immune response specific for varicella-zoster virus in the subject.

[0227] In other embodiments, the immune response is assessed by measuring protein (antibody titer) in the subject. In other embodiments, serum or antibodies from immunized subjects are tested for their ability to neutralize viral uptake or reduce varicella-zoster virus transformation of human B lymphocytes. In other embodiments, the ability to promote robust T cell responses is measured using techniques recognized in the art.

[0228] Also provided herein are methods of eliciting an immune response against varicella-zoster virus in a subject by administering to the subject an RNA having an open reading frame encoding a first antigen, wherein the RNA does not include a stabilization element, and wherein an adjuvant is not co-formulated or co-administered with the vaccine.

[0229] Immunizing compositions (e.g., RNA vaccines) can be administered by any route that produces a therapeutically effective result. These routes include, but are not limited to, intradermal, intramuscular, or subcutaneous administration. The present disclosure provides methods comprising administering RNA vaccines to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the specific composition, its mode of administration, its mode of activity, and the like. RNA is typically formulated in dosage unit form for ease of administration and uniformity of dosage. However, it should be understood that the total daily dosage of RNA can be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the condition being treated and the severity of the condition; the activity of the specific compound employed; the specific composition employed; the patient's age, weight, general health, sex, and diet; the time of administration, route of administration, and excretion rate of the specific compound employed; the duration of treatment; drugs used in combination with or concomitantly with the specific compound employed; and similar factors well known in the medical art.

[0230] As provided herein, the effective amount of RNA can be as low as 5 μg, for example, administered in a single dose or two 2.5 μg doses. In some embodiments, the effective amount is a total dose of 5 μg to 200 μg. For example, the effective amount can be 5 μg, 10 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg or a total dose of 200 μg. In some embodiments, the effective amount is a total dose of 5 μg to 200 μg. In some embodiments, the effective amount is a total dose of 10 μg. In some embodiments, the effective amount is a total dose of 20 μg. In some embodiments, the effective amount is a total dose of 75 μg. In some embodiments, the effective amount is a total dose of 150 μg. In some embodiments, the effective amount is a total dose of 200 μg.

[0231] Vaccine efficacy

[0232] Some aspects of the present disclosure provide formulations of immunogenic compositions (e.g., RNA vaccines) in which RNA is formulated in an effective amount to generate an antigen-specific immune response in a subject (e.g., to generate antibodies specific for a varicella-zoster virus antigen). An "effective amount" is a dose of RNA effective to generate an antigen-specific immune response. Also provided herein are methods of inducing an antigen-specific immune response in a subject.

[0233] As used herein, an immune response to a vaccine or LNP of the present disclosure is the generation in a subject of a humoral and / or cellular immune response to the varicella-zoster virus protein(s) present in the vaccine. For the purposes of this disclosure, a "humoral" immune response refers to an immune response mediated by antibody molecules, including, for example, secretory (IgA) or IgG molecules, while a "cellular" immune response is an immune response mediated by T lymphocytes (e.g., CD4+ helper cells and / or CD8+ T cells (e.g., CTLs) and / or other white blood cells. An important aspect of cellular immunity includes antigen-specific responses elicited by cytolytic T cells (CTLs). CTLs are specific for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the cell surface. CTLs help induce and promote the destruction of intracellular microorganisms or the lysis of cells infected with such microorganisms. Another aspect of cellular immunity includes antigen-specific responses elicited by helper T cells. Helper T cells serve to help stimulate the function and focus the activity of nonspecific effector cells on cells displaying peptide antigens associated with MHC molecules on their surfaces. Cellular immune responses also result in the production of cytokines (e.g., IFN-γ, IL-2, TNF-β), chemokines, and other such molecules produced by activated T cells and / or other white blood cells.

[0234] In some embodiments, an antigen-specific immune response is characterized by measuring the titer of antibodies against varicella-zoster virus antigens produced in a subject administered an immunocomposition as provided herein. Antibody titer is a measurement of the amount of antibodies in a subject (e.g., antibodies specific for a particular antigen (e.g., anti-VZV gE glycoprotein) or an epitope of an antigen). Antibody titer is typically expressed as the reciprocal of the highest dilution that provides a positive result. For example, the enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titer.

[0235] In some embodiments, antibody titers are used to assess whether a subject has been infected or to determine whether immunization is necessary. In some embodiments, antibody titers are used to determine the magnitude of an autoimmune response, determine the need for booster immunization, determine whether a previous vaccine was effective, and identify any recent or previous infection. According to the present disclosure, antibody titers can be used to determine the magnitude of an immune response induced in a subject by an immune composition (e.g., an RNA vaccine).

[0236] In some embodiments, the anti-VZV gE antigen antibody titer produced in a subject is increased by at least 1 log relative to a control (unvaccinated subject). For example, the anti-VZV gE antigen antibody titer produced in a subject may be increased by at least 1.5, at least 2, at least 2.5, at least 3 logs, at least 3.5 logs, or at least 4 logs relative to a control. In some embodiments, the anti-VZV gE antigen antibody titer produced in a subject is increased by 1, 1.5, 2, 2.5, or 3 logs relative to a control. In some embodiments, the anti-VZV gE antigen antibody titer produced in a subject is increased by 1 to 4 logs relative to a control. For example, the anti-VZV gE antigen antibody titer produced in a subject may be increased by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 4 logs relative to a control.

[0237] In some embodiments, the titer of anti-VZV gE antigen antibodies produced in a subject is relative to that of a control (vaccinated with conventional vaccine GSK Shingrix ® For example, the titer of anti-VZV gE antigen antibodies produced in the subject can be increased by at least 1-fold, at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, or at least 3.5-fold relative to the control GSK.

[0238] In some embodiments, the control is the titer of anti-varicella-zoster virus antigen antibodies produced in a subject not administered an immune composition (e.g., RNA vaccine). In some embodiments, the control is the titer of anti-varicella-zoster virus antibodies produced in a subject administered a recombinant subunit vaccine, Shingrix ® The titer of antibodies against varicella-zoster virus antigens produced in subjects.

[0239] In some embodiments, the ability of an immune composition (e.g., an RNA vaccine) to be effective is measured in a murine model. For example, the immune composition can be administered to a murine model and the induction of neutralizing antibody titers in the murine model can be measured. Viral challenge studies can also be used to evaluate the efficacy of the vaccines of the present disclosure. For example, the immune composition can be administered to a murine model, the murine model can be challenged with a virus, and the survival and / or immune response (e.g., T cell response (e.g., cytokine response)) of the murine model can be measured.

[0240] The present invention also relates to the following embodiments:

[0241] 1. An immunogenic composition comprising varicella-zoster virus (VZV) ribonucleic acid (RNA), said RNA encoding a wild-type VZV gE glycoprotein or a variant thereof;

[0242] The sequence of the wild-type VZV gE glycoprotein is SEQ ID NO: 3.

[0243] 2. The composition of embodiment 1, wherein the VZV gE glycoprotein variant comprises one or more of the following mutations relative to wild-type VZV gE glycoprotein: sequence truncation, site mutation, and sequence deletion.

[0244] 3. A composition as described in embodiment 1 or 2, wherein the sequence truncation includes the lack of a carboxy-terminal tail domain.

[0245] 4. The composition of any one of embodiments 1 to 3, wherein the sequence truncation is selected from any one of the following groups:

[0246] 1) Truncate the gE protein C-terminus at amino acids 540-623; i.e., retain amino acids 1-539 of the VZV gE protein;

[0247] 2) truncating amino acids 569-623 of the gE protein C-terminus; i.e., retaining amino acids 1-568 of the VZV gE protein;

[0248] 3) truncating amino acids 574-623 of the gE protein C-terminus; i.e., retaining amino acids 1-573 of the VZV gE protein;

[0249] 4) truncating amino acids 588-623 of the gE protein C-terminus; i.e., retaining amino acids 1-587 of the VZV gE protein;

[0250] 5) Truncate the C-terminal amino acids 602-623 of the gE protein; that is, retain amino acids 1-601 of the VZV gE protein.

[0251] 5. The composition of any one of embodiments 2 to 4, wherein the VZV gE glycoprotein variant comprises a site mutation selected from the group consisting of: a mutation in a motif associated with ER retention, endocytosis, and / or localization to the Golgi apparatus or trans-Golgi network of the gE protein; and at least one site mutation in a gE C-terminal phosphorylation acidic motif.

[0252] Among them, the motifs related to gE protein ER retention and endocytosis include "Y 582 A583 G 584 L 585 " motif (such as motif Y 582 A 583 G 584 L 585 Mutations can prevent the endocytosis of gE protein and reduce the localization of gE antigen to the trans-Galaxyl network, such as mutation site Y582A, YK-VZV-013 (SEQ ID NO: 43);

[0253] The motifs related to the localization of gE protein to the Golgi apparatus or the trans-Golgi network include "A 568 Y 569 R 570 V 571 ” motif (such as “A 568 Y 569 R 570 V 571 " motif, specific mutant antigen sequences such as YK-VZV-011 (SEQ ID NO: 35);

[0254] The gE C-terminal phosphorylation acidic motif includes "S 593 E 594 S 595 T 596 D 597 T 598 ” motif (such as “S 593 E 594 S 595 T 596 D 597 T 598 " motif mutated to "A 593 E 594 A 595 A 596 D 597 A 598 " motif) can reduce the localization of gE antigen to the trans-Galvan network. The specific mutant antigen sequence is: YK-VZV-010 (SEQ ID NO: 31).

[0255] 6. The composition of any one of embodiments 2 to 5, wherein the VZV gE glycoprotein variant comprises a site mutation selected from the group consisting of: A568D, Y569K, Y569A, R570E, V571K, Y582A, S593A, S595A, T596A, and T598A; for example, selected from the group consisting of: A568D, Y569K, R570E, and V571K; for example, selected from the group consisting of: A568D and Y569K.

[0256] 7. The composition of any one of embodiments 2 to 6, wherein the variant of the VZV gE glycoprotein comprises a site mutation selected from the group consisting of:

[0257] 1) A568D; Y569K; R570E; V571K; (YK-VZV-023, YK-VZV-011)

[0258] 2) A568D; Y569A; R570E; V571K; (YK-VZV-024)

[0259] 3) Y569K; R570E; V571K; (YK-VZV-025)

[0260] 4) A568D; Y569K; R570E; V571K; Y582A; (YK-VZV-030, YK-VZV-013)

[0261] 5) A568D; Y569K; R570E; V571K; Y582G; (YK-VZV-031, YK-VZV-038)

[0262] 6) A568D; Y582A; (YK-VZV-032)

[0263] 7) Y569K; Y582A; (YK-VZV-033, YK-VZV-009)

[0264] 8) R570E; Y582A; (YK-VZV-034)

[0265] 9) V571K; Y582A; (YK-VZV-035)

[0266] 10) S593A; S595A; T596A; T598A; (YK-VZV-016, YK-VZV-044)

[0267] 11) Y582A; S593A; S595A; T596A; T598A; (YK-VZV-037)

[0268] 12) A568D; Y569K; R570E; V571K; Y582G; S593A; S595A; T596A; T598A; (YK-VZV-039)

[0269] 13) A568D; Y569K; R570E; V571K; Y582A; S593A; S595A; T596A; T598A; (YK-VZV-014)

[0270] 14) Y582G; S593A; S595A; T596A; T598A; (YK-VZV-040)

[0271] 15) Y569K; Y582A; S593A; S595A; T596A; T598A; (YK-VZV-010)

[0272] 16) A568D; Y569K; R570E; V571K; S593A; S595A; T596A; T598A; (YK-VZV-012)

[0273] 17) Y582G; (YK-VZV-029)

[0274] 18) A568D; (YK-VZV-018)

[0275] 19) Y569K; (YK-VZV-020)

[0276] 20) R570E; (YK-VZV-021)

[0277] 21) V571K; and (YK-VZV-022)

[0278] 22) Y582A; (YK-VZV-028, YK-VZV-036).

[0279] 8. The composition of any one of embodiments 2 to 7, wherein the variant of the VZV gE glycoprotein comprises a site mutation selected from the group consisting of:

[0280] 1) A568D; Y569K; R570E; V571K; (YK-VZV-011)

[0281] 2) A568D; Y569A; R570E; V571K; (YK-VZV-024)

[0282] 4) A568D; Y569K; R570E; V571K; Y582A; (YK-VZV-030, YK-VZV-013)

[0283] 5) A568D; Y569K; R570E; V571K; Y582G; (YK-VZV-031, YK-VZV-038)

[0284] 7) Y569K; Y582A; (YK-VZV-009)

[0285] 13) A568D; Y569K; R570E; V571K; Y582A; S593A; S595A; T596A; T598A; (YK-VZV-014);

[0286] 15) Y569K; Y582A; S593A; S595A; T596A; T598A; (YK-VZV-010)

[0287] 16) A568D; Y569K; R570E; V571K; S593A; S595A; T596A; T598A; (YK-VZV-012)

[0288] 18) A568D; (YK-VZV-018)

[0289] 19) Y569K; (YK-VZV-020)

[0290] 20) R570E; (YK-VZV-021) and

[0291] 22) Y582A (YK-VZV-028).

[0292] 9. The composition of any one of embodiments to 8, wherein the variant of the VZV gE glycoprotein comprises a sequence deletion selected from the group consisting of:

[0293] 1) A 568 ;

[0294] 2) Y 569 RVDKSPYNQS 579 ;and

[0295] 3) Y 569 RVDKSPYNQSMYYAGLPV 587 .

[0296] 10. The composition of any one of embodiments 1 to 9, wherein the variant of the VZV gE glycoprotein comprises a combination of site mutations, sequence truncations, and sequence deletions selected from the group consisting of:

[0297]

[0298] .

[0299] 11. The composition of any one of embodiments 1 to 10, wherein the variant of the VZV gE glycoprotein comprises a combination of site mutations, sequence truncations and / or sequence deletions selected from the group consisting of:

[0300] .

[0301] 12. The composition of any one of embodiments 1 to 11, wherein the variant of the VZV gE glycoprotein comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 27, 31, 35, 39, 43, 47, 63, 71, 75, 87, 103, 111, 115 or 143.

[0302] 13. The composition of any one of embodiments 1 to 12, wherein the variant of the VZV gE glycoprotein comprises SEQ ID NO: 31, 35, 43, 63, or 71.

[0303] 14. The composition of any one of embodiments 1 to 13, wherein the VZV RNA has an open reading frame (ORF) encoding a VZV gE glycoprotein or a variant thereof, the sequence of the open reading frame being at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 26, 30, 34, 38, 42, 46, 62, 70, 74, 86, 102, 110, 114 or 142.

[0304] 15. The composition of embodiment 14, wherein the sequence of the open reading frame is SEQ ID NO: 30, 34, 42, 62 or 70.

[0305] 16. The composition of any one of embodiments 1 to 15, wherein the RNA of VZV further comprises a 5′ untranslated region (UTR).

[0306] 17. The composition of embodiment 16, wherein the 5'UTR has a sequence as shown in SEQ ID NO: 173, 174, 175, 176 or 177.

[0307] 18. The composition of embodiment 17, wherein the 5'UTR has the sequence shown in SEQ ID NO: 174.

[0308] 19. The composition of any one of embodiments 1 to 18, wherein the RNA of VZV further comprises a 3′ untranslated region (UTR).

[0309] 20. The composition of embodiment 19, wherein the 3' UTR has a sequence as shown in SEQ ID NO: 178, 179, 180 or 181.

[0310] 21. The composition of embodiment 20, wherein the 3' UTR has the sequence shown in SEQ ID NO: 178.

[0311] 22. The composition of any one of embodiments 1 to 21, wherein the VZV RNA further comprises a poly(A) tail.

[0312] 23. The composition of embodiment 22, wherein the Ploy(A) tail has a length of 50 to 150 nucleotides.

[0313] 24. The composition of any one of embodiments 1 to 23, wherein the VZV RNA further comprises a 5′ terminal cap.

[0314] 25. The composition of embodiment 24, wherein the 5′ end cap is 7mG(5′)ppp(5′)NlmpNp.

[0315] 26. The composition of any one of embodiments 14 to 25, wherein the sequence of the open reading frame is codon-optimized.

[0316] 27. The composition of embodiment 26, wherein the sequence of the open reading frame comprises at least one base modification.

[0317] 28. The composition of embodiment 27, wherein the base modification is selected from one or more of the following: pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine.

[0318] 29. The composition of embodiment 28, wherein the base modification is replacement of uracil with pseudouridine and / or N1-methylpseudouridine.

[0319] 30. A composition as described in embodiment 27, 28 or 29, wherein the base modification is 1 to 100% base modification, for example, 1% base modification, 2% base modification, 3% base modification, 4% base modification, 5% base modification, 6% base modification, 7% base modification, 8% base modification, 9% base modification, 10% base modification, 15% base modification, 20% base modification, 25% base modification, 30% base modification, 35% base modification, 40% base modification, 45% base modification, 50% base modification, 55% base modification, 60% base modification, 65% base modification, 70% base modification, 75% base modification, 80% base modification, 85% base modification, 90% base modification, 95% base modification and 100% base modification; and ranges with any of the above values ​​as endpoints.

[0320] 31. The composition of any one of embodiments 1 to 30, wherein the sequence of the RNA of VZV is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 28, 32, 36, 40, 44, 48, 64, 72, 76, 88, 104, 112, 116, or 144.

[0321] 32. The composition of embodiment 31, wherein the VZV RNA has the sequence shown in SEQ ID NO: 32, 36, 44, 64 or 72.

[0322] 33. The composition of any one of embodiments 1 to 32, wherein the RNA of VZV is mRNA.

[0323] 34. The composition of any one of embodiments 1 to 33, wherein the RNA encoding the VZV gE glycoprotein comprises an RNA sequence corresponding to a DNA sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 25, 29, 33, 37, 41, 45, 61, 69, 73, 85, 101, 109, 113 or 141.

[0324] 35. The composition of embodiment 34, wherein the RNA encoding the VZV gE glycoprotein has an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO: 29, 33, 41, 61 or 69.

[0325] 36. A method for preparing a composition according to any one of embodiments 1 to 35, comprising:

[0326] Providing a template for transcribing the VZV RNA;

[0327] Transcription is carried out using the template under conditions suitable for transcribing the RNA.

[0328] 37. The method according to embodiment 36, further comprising a purification step selected from the group consisting of lithium chloride precipitation, affinity chromatography, ultrafiltration exchange, and cellulose chromatography.

[0329] 38. The composition of any one of embodiments 1 to 35, which is a vaccine, further comprising a pharmaceutically acceptable carrier.

[0330] 39. The composition of embodiment 38, wherein the carrier comprises a lipid mixture, e.g., a lipid nanoparticle (LNP).

[0331] 40. The composition of embodiment 38 or 39, wherein the vaccine is an mRNA vaccine.

[0332] 41. The composition of embodiment 39 or 40, wherein the lipid mixture is a lipid nanoparticle (LNP), for example comprising cationic lipids, neutral lipids, structured lipids, and polymer-conjugated lipids.

[0333] 42. A composition as described in embodiment 41, wherein the cationic lipid is a compound of the structure of Formula I, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1～6 Alkylene; G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C 6～15 Straight chain alkyl; L2 is C 12～25 Branched alkyl; for example, the cationic lipid is YK-009 of formula II

[0334] .

[0335] 43. A composition as described in embodiment 41, wherein the cationic lipid is a compound of formula II, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25Straight or branched alkyl; R2 is C 6~25 Straight or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-; for example, the cationic lipid is YK-401 of formula II-I or YK-402 of formula II-II

[0336] .

[0337] 44. A composition as described in embodiment 41 above, wherein the cationic lipid is a compound of formula III, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight or branched alkyl; R2 is C 12~25 Branched alkyl group; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2- or CH3CH2NH(CH2)2-; for example, YK-201 of formula III-I, YK-202 of formula III-II

[0338] .

[0339] 45. A composition as described in embodiment 41 above, wherein the cationic lipid is a compound of formula IV, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight or branched alkyl; R2 is C 12~25 Straight or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3 or -CH2CH3 or -CH2CH2OH For example, YK-305 of formula IV-I structure, YK-310 of formula IV-II structure

[0340] .

[0341] 46. ​​A composition as described in embodiment 41 above, wherein the cationic lipid is a compound of formula V, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G 1 and G 2 Each independently is an unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 Alkenyl; R 3 OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or –NR 5 C(=O)R 4 ; R 4 C1-C 12 hydrocarbon group; and R 5 is H or a C1-C6 hydrocarbon group; for example, ALC0315 of formula VI;

[0342] .

[0343] 47. A composition as described in embodiment 41 above, wherein the cationic lipid is a compound of formula VI, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein R4 is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) n N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(R)S(O)2R8 and heterocycle; n is 1, 2 or 3; for example, SM102 of structure VI-I

[0344] .

[0345] 48. A composition as described in embodiment 41, wherein the cationic lipid is a compound of formula VII, or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0346] .

[0347] 49. A composition as described in embodiment 41, wherein the cationic lipid is selected from YK-009, YK-401, YK-305, ALC0315, SM102 and DLIN-MC3-DMA.

[0348] 50. A composition as described in any one of embodiments 41 to 49, wherein the molar ratio of the cationic lipid to the neutral lipid is (1-10):1.

[0349] 51. The composition of any one of embodiments 41 to 50, wherein the molar ratio of the cationic lipid to the structural lipid is (1-5):1.

[0350] 52. A composition as described in any one of embodiments 41 to 51, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is (25-65): (5-25): (25-45): (0.5-5).

[0351] 53. A composition as described in embodiment 52, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is (49-50):10:(38.5-39.5):1.5, for example, 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0352] 54. The composition of any one of embodiments 41 to 53, wherein the neutral lipid is selected from phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol, derivatives thereof, and any combination thereof.

[0353] 55. A composition as described in any one of embodiments 41 to 54, wherein the neutral lipid is selected from the group consisting of: 1,2-Dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-Dicondecanoyl-sn-glycero-phosphocholine (DUPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-Di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1-,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-oic acid choline, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16 .0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl Phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

[0354] 56. The composition of any one of embodiments 41 to 55, wherein the neutral lipid is DOPE and / or DSPC.

[0355] 57. The composition of any one of embodiments 41 to 56, wherein the structured lipid is selected from the group consisting of sterols, cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, corticosteroids, and any combination thereof.

[0356] 58. The composition of embodiment 57, wherein the structured lipid comprises cholesterol, e.g., is cholesterol.

[0357] 59. The composition of any one of embodiments 41 to 56, wherein the polymer-conjugated lipid is selected from the group consisting of: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and any combination thereof.

[0358] 60. A composition as described in embodiment 59, wherein the polymer-conjugated lipid is selected from: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), methoxy polyethylene glycol ditetradecanoyl acetamide (ALC-0159) and any combination thereof.

[0359] 61. The composition of any one of embodiments 38 to 60, wherein the effective dose of VZV RNA is 25 μg to 200 μg; preferably 50 μg to 100 μg.

[0360] 62. The composition of any one of embodiments 38 to 60, wherein the vaccine is an injectable formulation, such as a liquid formulation or a lyophilized formulation.

[0361] 63. A method of preparing the composition of any one of embodiments 38 to 60, comprising: mixing the VZV RNA with the pharmaceutically acceptable carrier, for example to encapsulate at least a portion of the RNA within lipid nanoparticles.

[0362] 64. The method of embodiment 63, further comprising a purification step to remove unencapsulated components, such as dialysis and / or filtration.

[0363] 65. The method of embodiment 64, wherein the unencapsulated component is selected from the group consisting of: unencapsulated RNA, a non-aqueous solvent, and bacteria.

[0364] 66. Use of the composition of any one of embodiments 1 to 62 for the preparation of a medicament for inducing a protective immune response against VZV in a subject, eg, comprising the production of neutralizing antibodies.

[0365] 66a. The composition of any one of embodiments 1 to 62, for inducing a protective immune response against VZV in a subject in need thereof, wherein the protective immune response, for example, comprises the production of neutralizing antibodies.

[0366] 66b. A method of inducing a protective immune response against VZV in a subject in need thereof, comprising administering to the subject the composition of any one of embodiments 1 to 62, wherein the protective immune response, eg, comprises the production of neutralizing antibodies.

[0367] 67. The use, composition or method of embodiment 66, 66a or 66b, wherein the subject is immunocompromised.

[0368] 68. The use, composition or method of embodiment 66, 66a, 66b or 67, wherein the subject is 10 years of age or older, such as 50, 60, 70, 80 years of age or older.

[0369] 69. The use, composition or method of any one of embodiments 66 to 68, wherein the protective immune response further comprises a cellular immune response.

[0370] 70. The use, composition or method of any one of embodiments 66 to 69, wherein the induction of a protective immune response is for preventing VZV infection.

[0371] 71. The use, composition or method of any one of embodiments 66 to 69, wherein the inducing a protective immune response is for preventing VZV-associated pain.

[0372] Example 1: VZV gE mutant antigen design

[0373] As a highly glycosylated type I membrane protein, gE can be transported between the endoplasmic reticulum (ER), trans-Golgi network (TGN), and endosomes. The gE protein has several important domains related to its main functions.

[0374] (1) TM transmembrane domain, consisting of amino acids 539–559;

[0375] (2) A 568 YRV 571 Motif: mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN) and endosomes;

[0376] (3) Y 582 AGL 585 Motif: mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN) and endosomes;

[0377] (4) S 593 ES 595 T 596 DT 598 Motif: Important glycosylation site; mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN) and endosomes.

[0378] The intracellular carboxyl terminus of gE plays a decisive role in the intracellular transport of gE. Based on the important structural domains and functions of gE protein, a series of mRNA antigens targeting mutations in key structural and functional domains of gE and mutations in different truncated forms were designed (e.g. Figure 1 shown).

[0379] Using the wild-type sequence of the gE gene of VZV virus (reference NCBI virus strain sequence number QXN54923.1) as a reference, a series of 43 different gE variant mRNA sequences were designed:

[0380] Table 1 summarizes the mRNAs encoding variant gE antigens with different C-terminal sequences. In the table, YK-VZV-004, YK-VZV-006, YK-VZV-045, and YK-VZV-007 correspond to the corresponding mutations or mutation combination sequences in the published patents (US11643441B1, CN114081943A, US20230233671A1, and CN108472309A), respectively.

[0381]

[0382]

[0383] Example 2: Preparation of VZV gE antigen mRNA vaccine

[0384] Preparation of linearized plasmid for transcription template

[0385] All antigen gene fragments were artificially synthesized by GenScript Biotech Co., Ltd. and cloned into the pVAX vector (purchased from Thermo Fisher Scientific) to obtain a successfully constructed circular plasmid.

[0386] Template preparation was performed using BsaI restriction endonuclease (purchased from Shanghai Biyuntian Biotechnology Co., Ltd.) to linearize the plasmid. The enzyme digestion system consisted of the supercoiled plasmid containing the target gene from Example 1, 10× Digestion Buffer, BsaI restriction endonuclease, and RNase-free ddH2O. The digestion reaction temperature was 37°C and the digestion time was 3 h. The enzyme digestion system is shown in Table 2.

[0387]

[0388] After the enzyme digestion reaction was completed, the linearized product was recovered using a DNA product purification kit (purchased from Yisheng Biotechnology Co., Ltd.), the product concentration was determined using an ultra-micro UV spectrophotometer (Denovix), and the length and state of the linearized plasmid template were detected by agarose gel.

[0389] Preparation of mRNA stock solution

[0390] The in vitro co-transcriptional capping reaction is a process in which modified or natural nucleotide triphosphates (NTPs) are assembled according to the template base sequence to prepare mRNA polynucleic acid. The addition of Clean Cap in this process can generate mRNA containing Cap1 structure through a one-step transcription reaction. The conventional reaction process consists of the following system (all purchased from Suzhou Jinan Protein Technology Co., Ltd.):

[0391] .

[0392] After transcription was complete, 1 μl of DNase I (2 U / μl) was added, mixed, and incubated at 37°C for 20 min to remove the template DNA. The transcript was then purified using lithium chloride precipitation.

[0393] 1) To a 20 μl reaction mixture, add 30 μl of RNase-free H2O and 7.5 M lithium chloride (final lithium chloride concentration 2.8 M).

[0394] 2) After mixing thoroughly, incubate at -20°C for 2 hours, centrifuge at 12,000 rpm for 15 minutes, and discard the supernatant. Wash the RNA pellet with 500 μl of 70% ethanol and centrifuge at 12,000 rpm for 5 minutes. Repeat this step once to collect the precipitate.

[0395] 3) Allow to dry. Add 100 μl of enzyme-free water to dissolve the mRNA precipitate. Store the purified RNA solution at -80°C. Determine the mRNA concentration and integrity.

[0396] Preparation of mRNA-LNP (mRNA vaccine)

[0397] Accurately weigh 20 mg of cationic lipid, DSPC, cholesterol, and DMG-PEG2000 respectively, dissolve them in anhydrous ethanol to prepare a solution with a concentration of 10 mg / ml, and prepare a carrier mixed solution according to a molar ratio of 49:10:39.5:1.5 as the organic phase.

[0398] VZV mRNA was dissolved in 50 mM citrate buffer (pH 4.0) and diluted to a 0.15 mg / ml solution, which served as the aqueous phase. Using a BD (brand name, similarly referred to in Chinese as BD, hereinafter referred to as Bidi) 3 ml syringe, 2 ml of the organic phase and 7 ml of the aqueous phase were drawn with a BD 10 ml syringe. The left pump was used for the organic phase, and the right pump for the aqueous phase. The LNP intermediate solution was prepared in a microfluidic device.

[0399] The preparation volume was 9.0 ml; the organic phase flow rate was 5.0 ml / min; the aqueous phase flow rate was 15 ml / min; and the LNP intermediate solution was collected.

[0400] The above LNP intermediate solution was diluted with 9 times its volume of PBS solution, and ultrafiltration and concentration were carried out on a small-scale ultrafiltration device with an ultrafiltration membrane pore size of 50 KD. When it was concentrated to about 10 ml, it was diluted with 4 times its volume of PBS solution and concentrated on the ultrafiltration device. Ultrafiltration was stopped when the final concentrated volume was less than 5 ml.

[0401] Example 3: Western Blot Detection of Herpes Zoster mRNA Vaccine Antigen Expression

[0402] In order to verify whether the designed antigen mRNA sequence can be expressed in cells and the expression efficiency of different antigen sequences, the mRNA sequence was first transfected into cells, and the expression of antigen mRNA in cells was detected by Western Blot.

[0403] Experimental Materials

[0404]

[0405] Experimental procedures

[0406] Cell culture and transfection: 293T cells were cultured at 2.5 × 10 5 Calculate the volume of mRNA preparation required for 500 ng of mRNA and add the corresponding volume of mRNA preparation sample directly to the cells and mix thoroughly.

[0407] Experimental group: protein sample mixture obtained by lysis of cells transfected with the series of mRNA vaccines prepared in Example 2;

[0408] Negative control NC: RIPA lysis buffer;

[0409] Positive control PC: gE purified protein;

[0410] Internal reference protein loading control: glyceraldehyde-3-phosphate dehydrogenase GAPDH;

[0411] Protein sample preparation: ① Remove cells from the incubator 16 hours after transfection. Pipette repeatedly to lift all cells off the bottom of the dish. Transfer the cells to a 1.5 ml microcentrifuge tube and centrifuge at 1500 rpm for 3 minutes at 25°C. ② Discard the supernatant and add 1 ml of PBS to resuspend the cells by pipetting. Centrifuge at 1500 rpm for 3 minutes. ③ Repeat the previous step twice. ④ Add 50 μl of RIPA lysis buffer (add 0.5 μl of 100x protein inhibitor to RIPA lysis buffer before use) to each tube of cells. Incubate on ice for 30 minutes, vortexing the sample for 30 seconds every 5 minutes. ⑤ Use a pre-cooled centrifuge to fully lyse the cells. Centrifuge the sample at 12,000 rpm for 10 minutes at 4°C. Aspirate the supernatant and transfer it to a new 1.5 ml microcentrifuge tube to obtain the protein sample to be tested.

[0412] Development and Analysis: Protein sample concentration was quantified using a BCA kit. 200 μl of BCA working solution and 10 μl of the sample to be tested were added. 10 μg of protein sample was transferred to a 1.5 ml microcentrifuge tube, and water was added to make a 24 μl volume. 6 μl of 5× Loading Buffer was added, and the volume was brought to 30 μl with purified water. The total protein was denatured by boiling. 3 μg of sample (9 μl) and marker (4 μl) were applied to the sample and electrophoresed at 200 V for 30 min. Transfer was performed using a dry transfer apparatus. The gel was removed and a transfer sandwich was created. A negative plate was applied and the membrane was transferred at 21 V, 23 V, and 25 V for 1, 4, and 2 min, respectively. Blocking was then performed at room temperature for 1 h. Primary antibody incubation was performed at room temperature for 1 h. Antibody preparation (1:2000 dilution) was prepared by aspirating 7.5 μl of antibody and adding 15 ml of primary antibody (anti-VZV gE protein antibody, mouse mAb) diluent.

[0413] Membrane washing: Wash with 1× TBST buffer for 5 min three times. Secondary antibody incubation: Incubate at room temperature for 1 h. Antibody preparation (1:1000 dilution): Pipette 30 μl of antibody and add 30 ml of secondary antibody (Goat Anti-Mouse IgG) diluent. Membrane washing: Wash with 1× TBST buffer diluted in distilled water for 5 min three times. Color development: Mix 1 ml of developer and fixer in a 1:1 ratio and apply dropwise to the membrane for color development. Photograph.

[0414] Internal reference protein GAPDH: The relative intensity is consistent, indicating that the sample loading amount is the same between different samples. On this basis, the expression strengths of different samples are compared. Negative control NC: There is a corresponding band only in the internal reference part, and no corresponding band in the target protein area, which meets the negative control requirements; positive control PC (gE purified protein): There is a corresponding band in the target size range, and the internal reference has a corresponding band, which meets the positive control requirements. When the positive and negative settings are reasonable and the bands are clear, it is determined whether the experimental sample is expressed, and the relative expression level. The Western Blot results of the protein sample mixture obtained by lysis treatment after the series of mRNA vaccines prepared in Example 2 were transfected into cells are shown in the appendix of this manual. Figure 2 .

[0415] Example 4: Balb / c mouse immunization

[0416] Experimental Materials

[0417] Animals: Balb / c mice, female, 6-8 weeks old;

[0418] Test subjects: 1) mRNA vaccine corresponding to the expressed antigen in Example 3; 2) LNP sample (LNP sample without mRNA prepared in Example 2); 3) GSK recombinant subunit vaccine (Shingrix ® );

[0419] Grouping: Mice were randomly divided into groups according to body weight, with 5 mice in each group;

[0420] Animal immunization: On day 0 and day 28, mice were immunized with the vehicle or the test substance (liquid mRNA vaccine prepared in Example 2) by intramuscular injection into the gastrocnemius muscle. The volume and dose are shown in the table below.

[0421]

[0422]

[0423] Sample collection and pretreatment

[0424] About 0.2 ml of blood was collected from the orbital venous plexus of each animal, and the serum was separated (centrifuged at 4000 rpm / min for 10 min at 4°C) and stored in a 4°C refrigerator until processing.

[0425] Health Monitoring

[0426] Twice a day (once in the morning and once in the afternoon), including but not limited to death, morbidity, respiration, secretions, feces, and diet and drinking water.

[0427] Humane End

[0428] According to the IACUC protocol, any mouse that loses more than 20% of its body weight (before infection, the baseline weight is the weight on day 0; after infection, the baseline weight is the weight on the day of infection) or / and shows signs of moribundity during the experiment will be euthanized and recorded as a dead animal in the results.

[0429] Example 5: Detection of gE protein-specific IgG antibody titer in Balb / c mouse serum by enzyme-linked immunosorbent assay (ELISA)

[0430] Main experimental materials and sources

[0431] The varicella-zoster virus (VZV) IgG (human) titer ELISA detection kit (gE protein) was purchased from Beijing Biopsies Biotechnology Co., Ltd. The kit contains the following solutions: 1× washing buffer, positive control working solution, negative control working solution, dilution buffer, HRP-goat anti-mouse IgG, substrate solution, stop solution, and ELISA plate.

[0432] Experimental procedures

[0433] Prepare the working solution: Prepare 1× washing buffer: Take 50 ml of 10× washing buffer and dilute to 500 ml with ultrapure or deionized water. Prepare the positive control working solution and the negative control working solution.

[0434] Pre-treatment of the samples to be tested: a series of blood samples on the 42nd and 56th days obtained in Example 4.

[0435] Antibody titer detection: dilute the sample to be tested, positive control PC and negative control NC with Dilution buffer from 1:100 to 1:102400.

[0436] Numbering: Number the diluted samples according to the wells of the ELISA plate, and set PC working solution and NC working solution for each experiment.

[0437] Sample addition: Add 100 μl of diluted sample, positive control solution, and negative control solution to the corresponding wells. Vortex to mix thoroughly and incubate at 37°C for 1 h.

[0438] Wash the plate: discard the liquid in the wells, pat the ELISA plate dry, wash the plate with 1× washing buffer, 300 μl / well, soak for 30 seconds, pat the plate, wash the plate 3 times in total, and pat dry.

[0439] Add HRP enzyme conjugate: dilute HRP-Goat anti-Mouse IgG 1000-fold with dilution buffer, add 100 μl to each well, and incubate at 37°C for 1.0 h.

[0440] Wash the plate: Repeat step 6 for 3 times.

[0441] Color development: Add 100 μl of Substrate Solution to each well and incubate at 37°C in the dark for 20 min.

[0442] Stop: Add 50 μl Stop Solution to each well and shake the plate until mixed evenly.

[0443] Reading: Use a microplate reader to measure the OD of each well. 450 nm and OD 630 The absorbance value of the wavelength is measured at 630 nm, with 630 nm as the background, and the reading should be made within 3 minutes after termination.

[0444] Interpretation of test results: Antibody positive determination: OD 450 nm-OD 630 nm ≥ 0.1.

[0445] Example 6: Detection of CD4 T cells secreting IFN-γ and IL-2 in the spleen of Balb / c mice by multi-parameter flow cytometry (FCM) + T cells and CD8 + T cell ratio

[0446] Immune checkpoint inhibitors work by preventing T cell exhaustion. Immune cell function is assessed by measuring cytokine production in tumor samples. During inflammation or host immune defense, T cells and NK cells respond by producing interferon-γ (IFN-γ). Multiparameter flow cytometry (FCM) was used to analyze the number of CD8 T cells producing IFN-γ in the spleen of mice. + or CD4 + T cells were quantitatively analyzed.

[0447] Interferon-γ (IFN-γ) is a soluble dimeric cytokine and the only member of the type II interferon family. It is primarily secreted by natural killer (NK) cells and natural killer T cells (NKT) and plays a role in innate immunity. During antigen-specific immunity, it is secreted by CD4 Th1 and CD8 cytotoxic T cells. IFN-γ, or type II interferons, plays a crucial role in innate and adaptive immunity against viral, certain bacterial, and protozoal infections. IFN-γ is an important activator of macrophages and an inducer of major histocompatibility complex class II (MHC II) expression. Interleukin-2 (IL-2) is a cytokine in the chemokine family. It is a cytokine that has multiple cell sources (mainly produced by activated T cells) and has multidirectional effects (mainly promoting the growth, proliferation, and differentiation of lymphocytes); it plays an important role in the body's immune response and anti-viral infection, and can stimulate the proliferation of T cells that have been activated by specific antigens or mitogenic factors; it can activate T cells and promote cytokine production; it can stimulate NK cell proliferation, enhance NK killing activity and cytokine production, and induce the production of lymphokine-activated killer cells (LAK); it promotes B cell proliferation and antibody secretion; and it activates macrophages.

[0448] Detection method: FCM (multi-parameter flow cytometry).

[0449] Test sample: spleen removed on the 56th day in the immunized mouse model of Example 5.

[0450] Purpose of detection: To determine the secretion of IFN-γ and IL-2 by CD4 + T cells and CD8 + T cell ratio

[0451] Detection indicators:

[0452] CD4 + IFN-γ + ): All CD4 cells that produce IFN-γ + T cell count;

[0453] CD4 + (IL-2 + ): All IL-2-producing CD4 + T cell count;

[0454] CD4 + IFN-γ + IL-2 + ): CD4 that produces both IFN-γ and IL-2 + T cell count;

[0455] CD4 + IFN-γ+ or IL-2 + ): All CD4 cells that produce IFN-γ or IL-2 + T cell count;

[0456] CD8 + IFN-γ + ): All CD8 cells that produce IFN-γ + T cell count;

[0457] CD8 + (IL-2 + ): All IL-2-producing CD8 + T cell count;

[0458] CD8 + IFN-γ + IL-2 + ): CD8 that produces both IFN-γ and IL-2 + T cell count;

[0459] CD8 + IFN-γ + or IL-2 + ): All CD8 cells that produce IFN-γ or IL-2 + T cell count.

[0460] Experimental Materials

[0461] Main reagent sources

[0462]

[0463] Test solution preparation

[0464] Prepare each reagent according to the amount required for the experiment, and the preparation ratio of all reagents is volume ratio.

[0465] FBS inactivation: Thaw FBS stored at -20°C at 4°C, inactivate in a 56°C water bath for 30 minutes, filter through a 0.22 μm filter, and store at 2-8°C. The shelf life is 14 days.

[0466] Preparation of 1× RBC Lysis Buffer: Dilute 10× RBC Lysis Buffer (Mμlti-species) with sterile water to make 1× RBC Lysis Buffer, mix well and set aside.

[0467] Prepare complete culture medium containing 1% double antibody: the complete culture medium is prepared according to RPMI-1640: inactivated FBS = 9:1.

[0468] Prepare complete medium containing 1% double-antibody at a ratio of 99:1 (complete medium: penicillin-streptomycin). Mix thoroughly and store at 2-8°C. The shelf life is 14 days. Equilibrate to room temperature before use.

[0469] PMA / Ionomycin positive stimulator working solution: Prepare the positive stimulator working solution by adding 400 μl of PMA working solution and 80 μl of ionomycin (ION) to 19.520 ml of complete culture medium containing 1% double-stranded antibody. The final concentrations of PMA and ionomycin are 1 μg / ml and 2 μg / ml, respectively.

[0470] Negative control: complete culture medium containing 1% double antibody.

[0471] Prepare peptide working solution: Protein Transport Inhibitor working solution, dilute the stock solution 50 times with complete culture medium containing 1% double antibody.

[0472] Live / Dead Working Solution: Dilute Zombie Violet™ Fixable Viability Solution 1000-fold with 1× PBS.

[0473] Surface staining antibody: Prepare the surface staining antibody for one well according to the ratios in the table below. Mix thoroughly by pipetting. Store at 2°C–8°C in the dark until ready to use.

[0474]

[0475] 1× Perm / Wash Buffer: Dilute 10× Perm / Wash Buffer 10-fold with ultrapure water.

[0476] Intracellular staining antibody: Prepare the intracellular staining antibody according to the ratios in the table below, using the amount for one well as an example. Mix by pipetting. Store at 2°C to 8°C in the dark until ready to use.

[0477]

[0478] Prepare freezing solution: Prepare according to FBS:DMSO = 9:1, and use immediately.

[0479] Steps

[0480] Isolation of mouse spleen cells

[0481] Place a cell strainer in a 6-well plate containing 4 ml of complete culture medium supplemented with 1% anti-antibody-antibody. Place the spleen individually on the cell strainer. Using the end of a syringe plunger, gently mash or crush the spleen on the cell strainer. Pass the resulting cell suspension through the cell strainer into a 15 ml centrifuge tube. Rinse the 6-well plate with 1-2 ml of complete culture medium supplemented with 1% anti-antibody-antibody-antibody. Filter the resulting suspension into a 15 ml centrifuge tube. Centrifuge at 500 g for 5 minutes at 20°C. Discard the supernatant.

[0482] Resuspend the cells in 2 ml of 1× RBC Lysis Buffer and lyse for 5 ± 1 min. Centrifuge at 500 g for 5 min at 20°C. Discard the supernatant. Wash the cells with 5 ml of complete medium containing 1% double-antibody and centrifuge at 500 g for 5 min at 20°C. Discard the supernatant.

[0483] Resuspend the cells in 10 ml of complete culture medium containing 1% double antibody. After mixing, immediately take 100 μl of cell suspension into an EP tube. Then take 10 μl of cell suspension and 10 μl of fluorescent staining solution into the EP tube. After mixing, take 10 μl and count the total number of living cells and cell viability using a fluorescence counter.

[0484] Centrifuge the cells in a 15 ml centrifuge tube at 400 g for 5 min at 20°C, discard the supernatant, and resuspend the cells in fresh complete culture medium containing 1% double antibody. Adjust the viable cell concentration of each sample to 1×10 7 pcs / ml.

[0485] After the samples were plated, the remaining cells were centrifuged at 20°C, 400 g for 5 min, and the cell concentration was adjusted to (1-2) × 10 7 pcs / ml, dispense into pre-labeled cryovials at 1 ml / tube, place in a programmed cooling box, freeze in a refrigerator below -70ºC, and transfer to a liquid nitrogen tank for long-term storage after 12 to 24 hours.

[0486] Stimulate mouse spleen cells

[0487] Mouse spleen cell stimulation was performed in 96-well U-shaped plates, and the experimental date was indicated on the plates.

[0488] Set up positive, negative, and peptide wells based on the experimental setup. Add 100 μl / well of negative control to the negative wells, 100 μl / well of positive stimulator working solution to the positive wells, and 100 μl / well of peptide working solution to the peptide wells. Finally, add 100 μl / well of cell suspension to the positive, negative, and peptide wells.

[0489] Place the 96-well plate in a 37°C, 5% CO2 incubator for 2 h±5 min, then add 10 μl / well of Protein Transport Inhibitor working solution, mix well, and continue to place in a 37°C, 5% CO2 incubator.

[0490] Stimulation was continued in the incubator for 18 h ± 10 min, and then the round-bottom 96-well plate was taken out for flow cytometry staining.

[0491] Note: The experimental operations in this section must be performed in a biological safety cabinet, and all reagents are sterile.

[0492] Cell staining

[0493] Wash the stimulated samples: Remove the round-bottom 96-well plate and centrifuge at 500 g for 5 min at 4°C. Discard the supernatant. Add 200 μl of PBS to each well, resuspend and mix, centrifuge at 500 g for 5 min at 4°C, and discard the supernatant.

[0494] Live / Dead staining: Add 50 μl of prepared Live / Dead working solution to each well, resuspend and mix thoroughly, and stain for 30 min at 2°C to 8°C in the dark. After staining, add 150 μl of PBS to each well, centrifuge at 500 g at 4°C for 5 min, and discard the supernatant.

[0495] Surface staining: Add 50 μl of surface staining antibody to each well, resuspend and mix thoroughly, and stain for 30 min at 2°C to 8°C in the dark. Add 150 μl of Cell Staining Buffer per well to terminate staining. Centrifuge at 500 g at 4°C for 5 min and discard the supernatant.

[0496] Fix and permeabilize cells: Add 100 μl / well of Fixation and Permeabilization Solution, resuspend and mix, and incubate at 4°C in the dark for 20 min. Terminate the cell cycle by adding 100 μl / well of 1× Perm / Wash Buffer. Centrifuge at 500 g for 5 min at 4°C and discard the supernatant.

[0497] Intracellular staining: Add 50 μl of intracellular staining antibody to each well, resuspend and mix thoroughly, and incubate at 4°C in the dark for 50 min. Add 150 μl / well of 1× Perm / Wash Buffer to terminate staining. Centrifuge at 500 g for 5 min at 4°C and discard the supernatant. Add 200 μl / well of 1× Perm / Wash Buffer, resuspend and mix thoroughly, and centrifuge at 500 g for 5 min at 4°C and discard the supernatant.

[0498] Filtration: Add 200 μl of Cell Staining Buffer per well, resuspend and mix thoroughly, and filter the cell suspension through a 300-mesh nylon mesh into a fresh well plate. An example sample number is "01-P-1," where "01" represents the sample number, "P" represents the positive well, and the last "1" represents the well number.

[0499] On-machine testing

[0500] Instrument name: Flow cytometer (Cytoflex);

[0501] Instrument acquisition parameters: the acquisition flow rate was set to high speed, and the number of cells recorded was 100,000 cells collected under the lymphocyte gate;

[0502] Data processing

[0503] Data Analysis: Circle CD3 + cells, and then circle the CD4 + cells and CD8 + cells. From CD4 + Circle the CD4 + IFN-γ + ) subsets, CD4 + (IL-2 + ) subsets; from CD8 + Circle the CD8 + IFN-γ + ) subsets, CD8 + (IL-2 + ) subpopulation.

[0504] Data calculation formula: All values ​​in this test are calculated as percentages; effective value = mean value of peptide wells - mean value of negative wells. All values ​​are rounded to one decimal place.

[0505] Example 7: ELISPOT assay to detect IFN-γ and IL-2 cytokine secretion by spleen cells of Balb / c mice

[0506] The Enzyme-Linked Immunospot Assay (ELISPOT) is a highly sensitive assay in cellular immunology research. It can detect antibody-secreting cells (ASCs) and cytokine (CK)-secreting cells at the single-cell level. It offers higher sensitivity than ELISA and limiting dilution methods, capable of detecting only one protein-secreting cell in a population of 200,000–300,000 cells. Furthermore, this assay can functionally assay live cells after antigen stimulation, offering high specificity, intuitive reliability, and ease of use. It has been widely used in the detection of CK-secreting cells and ASCs, and has gained widespread adoption in immunology both domestically and internationally. Following antigen stimulation, lymphocytes locally produce cytokines, which are captured by specific monoclonal antibodies (mAbs) pre-coated on the PVDF membrane at the bottom of the ELISPOT plate. After cell removal, the captured cytokines bind to biotin-labeled mAbs, which are then bound to avidin labeled with alkaline phosphatase or horseradish peroxidase. After adding substrate for color development, purple or reddish-brown spots appear on the PVDF membrane, indicating that the cells produce cytokines. The spots are automatically counted and analyzed by an ELISPOT Reader.

[0507] The spleen organs were removed from the mouse model of Example 6, and the levels of IFN-γ and IL-2 secreted by spleen cells after stimulation with the peptide library were measured on day 56 after immunization.

[0508] Sample processing: Mouse spleen cell isolation and cryopreservation procedures.

[0509] Elispot method: Detect the levels of IFN-γ and IL-2 in the supernatant of spleen cells after stimulation with peptide library.

[0510] Main reagents

[0511] Table 9 Sample detection reagents

[0512] name source Mouse spleen cells Mylead FBS ExCellBio RPMI-1640 medium GIBCO DMSO Sigma Phosphate-buffered saline (1× PBS) Biotopped Phosphate buffered saline (20× PBS) Solarbio Phorbol 12-myristate 13-acetate (PMA) Sigma Ionomycin (ION) Sigma Penicillin-streptomycin mixture Gibco ELISpot Plus: Mouse IFN-γ (HRP) MabTech ELISpot Plus: Mouse IL-2 (HRP) MabTech

[0513] Test solution preparation

[0514] 1) FBS inactivation: Thaw FBS stored at -20°C at 4°C, then inactivate in a 56°C water bath for 30 minutes. Filter through a 0.22 μm filter and store at 2-8°C. The shelf life is 30 days.

[0515] 2) Prepare PMA working solution: Dissolve the PMA powder in a PMA reagent bottle by adding 1 ml of DMSO. Transfer the solution to a 15 ml centrifuge tube. Rinse the PMA reagent bottle with 1 ml of DMSO and transfer the rinse solution to a 15 ml centrifuge tube. Add 8 ml of DMSO to the 15 ml centrifuge tube and mix thoroughly to prepare a 100 μg / ml PMA working solution. Store at -20°C in a dark place.

[0516] 3) Prepare ION working solution: Dissolve the PMA powder in the ION reagent bottle by adding 2 ml of DMSO. Transfer the solution to a 15 ml centrifuge tube. Rinse the PMA bottle with 1 ml of DMSO. Repeat the rinsing step twice (3 times, 1 ml each time). Combine the rinse solutions and transfer them to a 15 ml centrifuge tube. Add 5 ml of DMSO to the 15 ml centrifuge tube and mix thoroughly to prepare a 1 mg / ml ION working solution. Store at -20°C.

[0517] 4) Prepare complete medium containing 1% double-antibody: Complete medium should be prepared at a ratio of RPMI-1640: inactivated FBS (9:1). Complete medium containing 1% double-antibody should be prepared at a ratio of complete medium: penicillin-streptomycin mixture (99:1). Mix well and store at 2-8°C. The shelf life is 14 days. Bring to room temperature before use.

[0518] 5) Prepare positive stimulator working solution: Add 400 μl of PMA working solution and 80 μl of ionomycin (ION) to 19.520 ml of complete culture medium. Prepare the positive stimulator working solution immediately before use. The final concentrations of PMA and ION are 2 μg / ml and 4 μg / ml, respectively.

[0519] 6) Prepare peptide working solution:

[0520] ① Prepare gE peptide library solution

[0521] Add 100 μl of DMSO to each tube of lyophilized powder to dissolve the peptide at a concentration of 1 mg / ml / peptide. Add 900 μl of PBS to the dissolved peptide solution to adjust the gE peptide library concentration to 100 μg / ml / peptide.

[0522] ② Prepare gE working solution

[0523] Prepare the gE peptide library solution at a ratio of 1:50: complete culture medium containing 1% double antibody. The concentration of the gE working solution after mixing is 2 μg / ml / peptide.

[0524] Negative control: The negative control is complete culture medium containing 1% double antibody.

[0525] 7) Prepare 1× PBS solution: Prepare according to the ratio of 20× PBS to pure water = 1:19. Store at room temperature and use immediately after preparation.

[0526] 8) Prepare PBS containing FBS: Prepare PBS (Biotopped) and inactivated FBS at a ratio of 200:1. Prepare immediately before use.

[0527] 9) Antibody preparation:

[0528] ① Preparation of R4-6A2-biotin: R4-6A2-biotin: PBS containing FBS = 1:1000, prepare and use immediately.

[0529] ② Preparation of 5H4-biotin: 5H4-biotin: PBS containing FBS = 1:1000, prepare and use immediately.

[0530] Experimental procedures

[0531] 1) The spleen organs were removed from the mouse model of Example 6, and the IFN-γ and IL-2 secretion levels of spleen cells after stimulation with the peptide library, as well as the IFN-γ and IL-2-producing CD4 and CD8 T cells, were measured on day 56 after immunization.

[0532] 2) Test samples: Spleens were harvested on day 56 and stored at -80°C.

[0533] Recovery of mouse spleen cells

[0534] Preparation: Before cell recovery, adjust the temperature of the thermostated water bath to 37 ºC and preheat the complete culture medium containing 1% double antibody at 37 ºC.

[0535] Sampling: The sample manager removes mouse spleen cells from the liquid nitrogen tank and transfers them to a box containing liquid nitrogen. Remove the cryovials from the box, spray them with 75% alcohol, and then place them in the transfer port of the cell culture room.

[0536] Thawing: The certifier immediately removes the cryovial from the transfer window and rapidly thaws the cells in a 37°C water bath. Once the cells have fully recovered, aseptically transfer them to a 15 ml centrifuge tube containing 9 ml of complete culture medium supplemented with 1% double-stranded antibody.

[0537] Rinse: Add 1 ml of complete culture medium containing 1% double antibody to the cryovial to rinse the cryovial, then transfer the rinse solution back to the 15 ml centrifuge tube.

[0538] Centrifugation: 400 g, 18-20 ºC, 10 min.

[0539] Counting: Discard the supernatant and resuspend the cells in 10 ml of complete culture medium containing 1% double-antibody. After mixing, immediately take 100 μl of the cell suspension and place it in an EP tube. Then immediately take 10 μl from the 100 μl cell suspension and add it to an EP tube containing 10 μl fluorescent staining solution. After mixing, take 10 μl and count the total number of live cells and cell viability using a fluorescence counter. (If the viability is less than 50%, repeat the fluorescence counter counting once, and the second counting result shall prevail.)

[0540] Recentrifugation: Centrifuge the remaining cells in the 15 ml centrifuge tube at 400 g at 18-20°C for 5 min.

[0541] Resuspension: Discard the supernatant and resuspend the cells in complete culture medium containing 1% double-antibody. Adjust the viable cell concentration to A0: 4 × 106 cells / ml, A1: 4 × 105 cells / ml.

[0542] Stimulation of mouse spleen cells

[0543] Wash the plate: Take the IFN-γ and IL-2 well plates, add 200 μl / well PBS (the PBS used in the entire experiment is sterile) and wash 4 times.

[0544] Blocking: Discard the PBS in the wells, tap the plate (try to remove the residual liquid in the wells), add 200 μl / well of complete culture medium containing 1% double antibody, and leave at room temperature for at least 30 minutes (the specific time can be recorded truthfully).

[0545] Plating: Discard the complete medium containing 1% double antibody in the well plate and tap the plate (try to remove the residual liquid in the well); add 100 μl / well of positive stimulator working solution to positive wells; add 100 μl / well of negative control to negative wells; add 100 μl / well of peptide working solution to peptide wells; blank wells do not contain cells, and only add 200 μl of negative control to each well.

[0546] Add cells: Add 100 μl / well of A0 cell suspension to negative wells and polypeptide wells, and add 100 μl / well of A1 cell suspension to positive wells.

[0547] Culture: Wrap the plate with aluminum foil and place it in a 37°C, 5% CO2 incubator for 21 h ± 30 min.

[0548] Note: The experimental operations in this section must be performed in a biological safety cabinet, and all reagents are sterile.

[0549] Cytokine detection

[0550] Washing: The next day, empty the original liquid in the well plate, tap the plate (try to remove the residual liquid in the well), add PBS at a rate of 200 μl / well, and wash 5 times.

[0551] Add secondary antibody: Discard PBS from the wells and tap the plate (to remove any remaining liquid). IFN-γ: Add 100 μl / well of R4-6A2-biotin working solution. IL-2: Add 100 μl / well of 5H4-biotin working solution. Incubate at room temperature for 2 h ± 5 min.

[0552] Wash the plate: Empty the original liquid in the well plate, tap the plate (try to remove the residual liquid in the well), add PBS at a rate of 200 μl / well, and wash 5 times.

[0553] Add the third antibody: Add 100 μl of Streptavidin-HRP working solution per well. Incubate at room temperature for 1 h ± 2 min. Empty the plate and tap to remove any remaining liquid. Add 200 μl of PBS per well and wash five times.

[0554] Wash the plate: Empty the original liquid in the well plate, tap the plate (try to remove the residual liquid in the well), add PBS at a rate of 200 μl / well, and wash 5 times.

[0555] Color development: Add 100 μl / well of TMB substrate solution, warmed to room temperature. After developing at room temperature for 15 ± 1 min, remove the liquid from the plate and rinse with pure water to stop color development. Remove the bottom plate and rinse the bottom surface.

[0556] Reading: After the plate is completely dry at room temperature and protected from light, use an ELISpot analyzer to photograph and read. Camera parameters: Shutter (Exposure): 400; Gain: 25. Counting parameters: IFN-γ-Mouse-Mab / IL-2-Mouse-Mab T: Size: 30; Intensity (Optical Density Threshold): 30; TNTC: 80%.

[0557] Example 8: Distribution of VZV gE Antigen in African Green Monkey Kidney (Vero) Cells

[0558] Vero cells are a cell lineage used in cell culture. The "Vero" lineage is derived from renal epithelial cells extracted from African green monkeys. Vero cells were transfected with different gE antigen variants we constructed (YK-VZV-010, YK-VZV-011, YK-VZV-013, YK-VZV-018, and YK-VZV-020). Transfected cells were stained with antibodies for gE antigen labeling and Golgi markers GM130 / TGN46, and antigen localization was observed using confocal microscopy. The results are shown in [ 1 ]. Figure 3 and Figure 4 .

[0559] Preparation of reagents and consumables

[0560] Table 10 Sample detection reagents and consumables

[0561] name source µ-Slide 8 Well Light-Proof Incubation Box ibidi Anti-VZV gE protein antibody abcam 488 donkey anti-mouse secondary antibody Yisheng Biotechnology Co., Ltd. Anti-fluorescence quenching mounting solution (containing DAPI) Biyuntian Biotechnology Co., Ltd. Phosphate-buffered saline (1× PBS) Biyuntian Biotechnology Co., Ltd. Phosphate buffered saline (20× PBS) Biyuntian Biotechnology Co., Ltd. Immunostaining permeabilization solution (Triton X-100) Biyuntian Biotechnology Co., Ltd. 4% paraformaldehyde fixative Biyuntian Biotechnology Co., Ltd. QuickBlock™ Primary Antibody Diluent for Immunostaining Biyuntian Biotechnology Co., Ltd. QuickBlock™ Immunostaining Blocking Solution Biyuntian Biotechnology Co., Ltd. QuickBlock™ Secondary Antibody Dilution Buffer for Immunofluorescence Staining Biyuntian Biotechnology Co., Ltd. 647-conj μgated GOLGA2 / GM130 antibody proteintech <![CDATA[CoraLite ® 594-conjμgated TGN46 antibody]]> proteintech

[0562] Experimental procedures

[0563] 1) Cell seeding: Vero cells (purchased from Beyotime Biotechnology Co., Ltd.) were seeded in a confocal microplate. When the cell seeding density reached approximately 30%, the number of cells was recorded. Culture was continued overnight.

[0564] 2) Transfection: Transfect with overexpression stock solution (50 ng / well) and culture for 48 h.

[0565] 3) Washing: Remove the confocal microplate from the culture medium and wash 1-3 times with PBS. Be careful not to shake violently during washing.

[0566] 4) Fixation: Add 200 μl of 4% paraformaldehyde solution to fix the cells, incubate at room temperature for 15 min, and then wash three times with 1x PBS, incubating at room temperature for 5 min each time.

[0567] 5) Permeabilization: Add 200 μl of 0.3% Triton X-100 (diluted in 1× PBS) and perforate for 10 min. Wash three times with 1× PBS, incubating at room temperature for 5 min each time.

[0568] 6) Blocking: Add 200 μl of immunostaining blocking solution and incubate at room temperature for 2 h.

[0569] 7) Primary Antibody Binding: Add 100 μl of primary antibody diluted in antibody diluent. The specific antibodies and dilution ratios are as follows: VZV gE antibody dilution ratio 1:100; 647-conjμgated GOLGA2 / GM130 antibody dilution ratio 1:100; CoraLite ® The 594-conjμgated TGN46 antibody was diluted 1:100 and incubated overnight at 4°C in the dark. The primary antibody was aspirated and can be recycled.

[0570] 8) Primary antibody washing: Wash three times with 1× PBS, 5 min each time to remove unbound primary antibody.

[0571] 9) Secondary antibody incubation: Add 200 μl of fluorescent secondary antibody diluted in antibody diluent at a dilution ratio of 1:300 and incubate at room temperature in the dark for 1.5 h.

[0572] 10) Secondary antibody washing: Wash three times with 1× PBS, 5 min each time, to remove unbound secondary antibody and avoid nonspecific staining.

[0573] 11) Nuclear staining and sealing: Remove the frame and add one drop of DAPI staining solution to each well. Cover the well and store at 4°C away from light.

[0574] 12) Use a confocal microscope to take pictures and observe.

[0575] Control settings

[0576] The present invention sets the comparison as follows:

[0577] LNP: blank LNP without mRNA vaccine;

[0578] Shingrix ® : Shingrix, a recombinant protein subunit vaccine produced and sold by GlaxoSmithKline ® , which is the extracellular region of VZVgE protein, with amino acids 1-539 and no mutation.

[0579] Comparative Example 1

[0580] Based on the herpes zoster mRNA vaccine antigen sequence reported in the literature (Morgan A, et al. 2020) and Moderna's patent (US11643441B1), the antigen developed in this patent is gE(1-573aa) Y569A. Based on this, this project designed YK-VZV-004 (SEQ ID NO: 15), which shares the same mutation site and truncation length as the herpes zoster mRNA vaccine antigen sequence gE(1-573aa) Y569A reported in Moderna's patent (US11643441B1). YK-VZV-004 (gE(1-573aa) Y569A) served as a positive control for antigen screening. The immunogenicity of the vaccine was evaluated along with the newly designed mutations and combinations of mutations in this invention. Specific results are shown in the Examples.

[0581] Comparative Example 2

[0582] Based on the herpes zoster mRNA vaccine antigen sequence reported in patent (CN114081943A), it was found that the VZV gE full-length polypeptide developed in this patent contains a mutation combination (Y569A, S593A, S595A, T596A, T598A). Based on this, this project designed YK-VZV-006 (SEQ ID NO: 19), which maintains the same mutation site combination (Y569A, S593A, S595A, T596A, T598A) as SEQ ID No. 2 mentioned in patent (CN114081943A). YK-VZV-006: gE (1-623aa), (Y569A, S593A, S595A, T596A, T598A) was also used as one of the controls for antigen screening of the present invention, and the immunogenicity of the vaccine was evaluated together with the newly designed mutations and mutation combination sequences of the present invention. The specific results are shown in the Examples.

[0583] Comparative Example 3

[0584] Based on the herpes zoster mRNA vaccine antigen sequence reported in US20230233671A1, the patent disclosed a VZV gE protein mutant, Y582A. Based on this, this project designed YK-VZV-045 (SEQ ID NO: 171), which retains the same mutation combination, Y582A, as the mRNA vaccine antigen sequence mentioned in US20230233671A1. YK-VZV-045 was also used as a control for antigen screening in the present invention, and the immunogenicity of the vaccine was evaluated along with the newly designed mutations and mutation combinations. Specific results are shown in the Examples.

[0585] Comparative Example 4

[0586] Based on the herpes zoster mRNA vaccine antigen sequence reported in CN108472309A, the patent disclosed a VZV gE protein mutant, Y582A. Based on this, this project designed YK-VZV-007 (SEQ ID NO: 23), which retains the same mutation combination as the mRNA vaccine antigen sequence mentioned in CN108472309A: Y582A; S593A; S595A; T596A; T598A. YK-VZV-007 was also used as a control for antigen screening in the present invention, and the immunogenicity of the vaccine was evaluated along with the newly designed mutations and mutation combinations of the present invention. Specific results are shown in the Examples.

[0587] Results summary and analysis

[0588] In vitro expression results of VZV gE antigen variants

[0589] Western blot test results of 43 VZV gE antigen variants ( Figure 2 ) showed that the expression level of YK-VZV-002 antigen protein was extremely low or almost non-existent; the expression results of YK-VZV-041, YK-VZV-042, and YK-VZV-043 antigen proteins were negative, with no expression; therefore, the above four sequences could not be used as candidate antigens for herpes zoster mRNA vaccine and were therefore excluded.

[0590] Other antigen variants all showed obvious protein expression, with the size of the expressed protein being approximately 63 kDa~75 kDa, which is consistent with the theoretical antigen design and can serve as effective candidate antigens for the next step of immunogenicity screening and evaluation.

[0591] The above Western blot experimental results show that YK-VZV-001, YK-VZV-003, YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-007 (Comparative Example 4), YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-012, and YK-VZ V-013, YK-VZV-014, YK-VZV-015, YK-VZV-016, YK-VZV-017, YK-VZV-018, YK-VZ V-019, YK-VZV-020, YK-VZV-021, YK-VZV-022, YK-VZV-023, YK-VZV-024, YK-VZV -025, YK-VZV-026, YK-VZV-027, YK-VZV-028, YK-VZV-029, YK-VZV-030, YK-VZV-031, YK-VZV-032, YK-VZV-033, YK-VZV-034, YK-VZV-035, YK-VZV-036, YK-VZV-037, YK-VZV-038, YK-VZV-039, YK-VZV-040, YK-VZV-044, YK-VZV-045 (Comparative Example 3) The above 39 antigen sequences all have obvious protein expression and can be used as effective candidate antigens for the next step of immunogenicity screening and evaluation. Therefore, gE-specific antibody IgG titer detection was carried out on the above antigens.

[0592] Results of gE protein-specific IgG antibody titers of VZV gE antigen variants in Balb / c mouse serum (D42)

[0593] As shown in Example 5, the ELISA method was used to detect the gE protein-specific IgG antibody titer in the serum of mice on the 42nd day after immunization. The test results are shown in Table 11 below:

[0594] Table 11 VZV gE protein-specific IgG antibody titers in mouse serum (day 42)

[0595] Test substance <![CDATA[Antibody GMT (×10 4 )]]> Test substance antibody GMT / Shingrix® antibody GMT (fold) Test substance antibody GMT / YK-VZV-007 antibody GMT (fold) YK-VZV-009 1000 5.3 2.8 YK-VZV-010 1000 5.3 2.8 YK-VZV-013 1000 5.3 2.8 YK-VZV-014 1000 5.3 2.8 YK-VZV-011 950 5.0 2.6 YK-VZV-012 944 5.0 2.6 YK-VZV-018 870 4.6 2.4 YK-VZV-020 800 4.2 2.2 YK-VZV-030 662 3.5 1.8 YK-VZV-031 659 3.5 1.8 YK-VZV-038 654 3.4 1.8 YK-VZV-021 650 3.4 1.8 YK-VZV-024 640 3.4 1.8 YK-VZV-028 630 3.3 1.8 YK-VZV-003 560 2.9 1.6 YK-VZV-001 540 2.8 1.5 YK-VZV-016 530 2.8 1.5 YK-VZV-015 520 2.7 1.4 YK-VZV-017 510 2.7 1.4 YK-VZV-023 190 1.0 0.5 YK-VZV-022 163 0.9 0.5 YK-VZV-026 163 0.9 0.5 YK-VZV-027 163 0.9 0.5 YK-VZV-033 163 0.9 0.5 YK-VZV-037 163 0.9 0.5 YK-VZV-039 163 0.9 0.5 YK-VZV-044 163 0.9 0.5 YK-VZV-040 162 0.9 0.5 YK-VZV-032 160 0.8 0.4 YK-VZV-034 154 0.8 0.4 YK-VZV-025 151 0.8 0.4 YK-VZV-035 150 0.8 0.4 YK-VZV-036 136 0.7 0.4 YK-VZV-029 102 0.5 0.3 LNP 0 0.0 0.0 <![CDATA[Shingrix ® ]]> 190 1.0 0.5 YK-VZV-004 (Comparative Example 1) 400 2.1 1.1 YK-VZV-006 (Comparative Example 2) 360 1.9 1.0 YK-VZV-045 (Comparative Example 3) 352 1.9 1.0 YK-VZV-007 (Comparative Example 4) 360 1.9 1.0

[0596] The results showed that Shingrix ® The titer of the positive control was 190×10 4 , among which, the effect is better than Shingrix ® The following variants are available: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, YK-VZV-020, YK-VZV-030, YK-VZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-02 4, YK-VZV-028, YK-VZV-003, YK-VZV-001, YK-VZV-016, YK-VZV-015, YK-VZV-017 and YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), YK-VZV-007 (Comparative Example 4), the effect of Shingrix ® 2.7~5.3 times that of the positive control.

[0597] Shingrix ® Based on the positive control as the standard, the gE-specific antibody IgG titer effect was also 1.8 to 2.8 times better than that of the YK-VZV-007 sequence (Comparative Example 4), and the following 14 variants were further extracted, including: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, YK -VZV-020, YK-VZV-030, YK-VZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028 and 4 control sequences YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) for subsequent testing.

[0598] VZV gE antigen variant cell-mediated immunity (FCM)

[0599] Cellular immunity, especially T cell immunity, plays an important role in the process of VZV infection. Studies have shown that cell-mediated immune effects are an important indicator for evaluating the immune effect of herpes zoster vaccines. In order to further evaluate the specific cellular immune response induced by immunizing mice with the above antigen mutant mRNA, Example 6 used FCM to detect the specific CD4 T cells induced by immunizing mice with VZV gE antigen mRNA. + T cells and CD8 + T cell immune response.

[0600] Taking Shingrix® positive control as the standard, based on the fact that the gE-specific antibody IgG titer effect was also better than that of the YK-VZV-007 sequence, the following 14 variants were further extracted, including: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, YK-VZV-020, YK-VZV-030, YK- The spleens of mice immunized with VZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028 and four control sequences, including YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3) and YK-VZV-007 (Comparative Example 4) on the 56th day were collected, and the secretion of IFN-γ and IL-2 by the mouse spleen was determined according to the detection method of Example 6. + T cells and CD8 + T cell ratio.

[0601] CD4 + T cells

[0602] CD4 + T cell immune effect plays an important role in the recovery of VZV infection and the immune effect of vaccines. It is one of the most important indicators for evaluating the immune effect of vaccines. The spleens of immunized mice were removed on the 56th day and the proportion of CD4+ T cells secreting IFN-γ and IL-2 in the spleens of mice was measured. The specific results are shown in the table below:

[0603]

[0604] IFN-γ + CD4 + T cells and IL-2 + CD4 + Total T cell proportion

[0605] A) Based on the above results, the test substances YK-VZV-010, YK-VZV-020, YK-VZV-013, YK-VZV-038, YK-VZV-012, YK-VZV-028, YK-VZV-031, YK-VZV-011, YK-VZV-021, YK-VZV-018, and YK-VZV-009 mRNA vaccines (a total of 11) were screened for secretion of IFN-γ + CD4 + T cells and IL-2 + CD4 + Shingrix ® The efficacy of the vaccine was more than 2 times that of the positive control vaccine, with the highest being 7 times, and 1.8 to 5.3 times that of YK-VZV-007 (Comparative Example 4). Furthermore, it was significantly better than YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3).

[0606] Among them, YK-VZV-010, YK-VZV-020, YK-VZV-013, YK-VZV-011, and YK-VZV-018 mRNA vaccines secrete IFN-γ + CD4 + T cells and IL-2 + CD4 + Shingrix ® The inhibitory effects of the two vaccines were 7.0, 5.2, 3.2, 2.7 and 2.3 times that of the positive control vaccine; and 5.3, 3.9, 2.4, 2.0 and 1.8 times that of YK-VZV-007 (Comparative Example 4), which were significantly higher than those of YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3).

[0607] The specific information is shown in the following table:

[0608] .

[0609] B) The IFN-γ secreted by the test substances YK-VZV-014, YK-VZV-030, and YK-VZV-024 mRNA vaccines + CD4 + T cells and IL-2 + CD4 + The total proportion of T cells is less than Shingrix ® The positive control vaccine was twice as high as the control vaccine and less than 1.5 times as high as the control vaccine 4 (YK-VZV-007), so it was eliminated. The specific results are shown in the following table:

[0610] .

[0611] IFN-γ + CD4 + T cell ratio

[0612] A) Screen out the test substances YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-014, YK-VZV-038, YK-VZV-031 IFN-γ secreted by mRNA vaccine + CD4 + The optimal T cell ratio is 1.00~2.00%, which is significantly higher than the control group (YK-VZV-004, YK-VZV-045, YK-VZV-007) and exceeds Shingrix. ® It is more than 3 times that of the positive control vaccine, with the highest reaching 6.7 times; it is about 2.2~4.4 times that of comparative example 4 (YK-VZV-007).

[0613] Among them, IFN-γ secreted by the mRNA vaccines corresponding to YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018 + CD4 + Shingrix ® 6.7, 5.7, 5.3, 5.3, and 4.0 times that of the positive control vaccine; 4.4, 3.8, 3.6, 3.6, and 2.7 times that of comparative example 4 (YK-VZV-007), and all significantly higher than comparative example 1 (YK-VZV-004) and comparative example 3 (YK-VZV-045).

[0614] The specific results are shown in the following table:

[0615] .

[0616] B) IFN-γ secreted by the test substances YK-VZV-021, YK-VZV-009, YK-VZV-024, and YK-VZV-030 mRNA vaccines + CD4 + T cells accounted for less than 1.0%, which was significantly lower than the optimal and better mRNA vaccine secretion cell ratio (1.0-2.0%), and only Shingrix ® The results were 2~3 times that of the positive control vaccine and 1~2 times that of comparative example 4 (YK-VZV-007). Therefore, YK-VZV-021, YK-VZV-009, YK-VZV-024, and YK-VZV-030 were eliminated from the candidate sequence. The specific results are shown in the following table:

[0617] Table 16 mRNA vaccine induces IFN-γ + CD4 + T cell-2

[0618] Test substance <![CDATA[CD4 + IFN-γ + ]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-021 0.90% 3.0 2.0 YK-VZV-009 0.80% 2.7 1.8 YK-VZV-024 0.70% 2.3 1.6 YK-VZV-030 0.60% 2.0 1.3 LNP 0.10% 0.3 0.2 <![CDATA[Shingrix ® ]]> 0.30% 1.0 0.7 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 1.7 1.1 YK-VZV-007 (Comparative Example 4) 0.45% 1.5 1.0

[0619] IL-2 + CD4 + T cells

[0620] A) Screening of IL-2 secreted by mRNA vaccines corresponding to the test substances YK-VZV-010, YK-VZV-020, YK-VZV-038, YK-VZV-031, YK-VZV-013, YK-VZV-028, YK-VZV-011, YK-VZV-012, YK-VZV-018, YK-VZV-021, and YK-VZV-009 + CD4 + The T cell ratio is the best, up to 1.10~3.70%, significantly higher than the control mRNA vaccines (YK-VZV-004, YK-VZV-045 and YK-VZV-007). ® It is more than 3.7 times that of the positive control vaccine and more than 2.2 times that of YK-VZV-007, and is significantly better than Comparative Example 1 (YK-VZV-004) and Comparative Example 3 (YK-VZV-045).

[0621] Among them, YK-VZV-010, YK-VZV-020, YK-VZV-013, YK-VZV-011, and YK-VZV-018 mRNA vaccines secrete IL-2 + CD4 + Shingrix ® The inhibitory effects of the two vaccines were 12.3, 8.3, 4.3, 4.0 and 3.7 times that of the positive control vaccine; and 7.4, 5.0, 2.6, 2.4 and 2.2 times that of YK-VZV-007 (Comparative Example 4). At the same time, they were significantly higher than YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3).

[0622] The specific results are shown in the following table:

[0623] Table 17 mRNA vaccine induces IL-2 + CD4 + T cell-1

[0624] Test substance <![CDATA[CD4 + IL-2 + ]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-010 3.70% 12.3 7.4 YK-VZV-020 2.50% 8.3 5.0 YK-VZV-038 1.40% 4.7 2.8 YK-VZV-031 1.40% 4.7 2.8 YK-VZV-013 1.30% 4.3 2.6 YK-VZV-028 1.30% 4.3 2.6 YK-VZV-011 1.20% 4.0 2.4 YK-VZV-012 1.20% 4.0 2.4 YK-VZV-018 1.10% 3.7 2.2 YK-VZV-021 1.10% 3.7 2.2 YK-VZV-009 1.10% 3.7 2.2 LNP 0.10% 0.3 0.2 <![CDATA[Shingrix ® ]]> 0.30% 1.0 0.6 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.1 YK-VZV-045 (Comparative Example 3) 0.30% 1.0 0.6 YK-VZV-007 (Comparative Example 4) 0.50% 1.7 1.0

[0625] B) IL-2 secreted by the test substances YK-VZV-014, YK-VZV-030, and YK-VZV-024 mRNA vaccines + CD4 + The proportion of T cells is less than 1.0%, which is significantly lower than the proportion of cells secreting the best and better mRNA vaccines (greater than 1.0%). ® The results were less than 3 times that of the positive control vaccine and less than 2 times that of YK-VZV-007 (Comparative Example 4); therefore, YK-VZV-014, YK-VZV-030, and YK-VZV-024 were eliminated from the candidate sequence. The specific results are shown in the following table:

[0626] Table 18 mRNA vaccine induces IL-2 + CD4 + T cell-2

[0627] Test substance <![CDATA[CD4 + IL-2 + ]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-014 0.80% 2.7 1.6 YK-VZV-030 0.80% 2.7 1.6 YK-VZV-024 0.60% 2.0 1.2 LNP 0.10% 0.3 0.2 <![CDATA[Shingrix ® ]]> 0.30% 1.0 0.6 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.1 YK-VZV-045 (Comparative Example 3) 0.30% 1.0 0.6 YK-VZV-007 (Comparative Example 4) 0.50% 1.7 1.0

[0628] ④ Conclusion

[0629] A) The proportion of immune cells in the spleen of mice after immunization with mRNA vaccines of the selected sequences:

[0630] IFN-γ + CD4 + T cells and IL-2 + CD4 + Shingrix ® More than 2 times of the positive control, up to 7 times; 1.8 to 5.3 times of YK-VZV-007 (Comparative Example 4);

[0631] IFN-γ + CD4 + The T cell ratio is 1.00~2.00%, which is Shingrix ® More than 3 times that of the positive control vaccine, with the highest reaching 6.7 times; and 2.2 to 4.4 times that of comparative example 4 (YK-VZV-007);

[0632] IL-2 + CD4 + The proportion of T cells is more than 1%, and Shingrix ® It is more than 3.7 times that of the positive control vaccine and more than 2.2 times that of YK-VZV-007; the information is as follows:

[0633] .

[0634] Among the above sequences, YK-VZV-010 induces CD4 + IFN-γ+ T cells and CD4 + IL + T cells account for more than 2% of spleen cells, which is Shingrix ® The immune effect is best at about 6 to 12 times that of the positive control vaccine.

[0635] B) The sequence of the mRNA vaccine secreted by the vaccine is deleted:

[0636] IFN-γ + CD4 + T cells and IL-2 + CD4 + The total proportion of T cells is less than Shingrix ® 2 times that of the positive control vaccine and less than 1.5 times that of comparative example 4 (YK-VZV-007);

[0637] or IFN-γ secreted by mRNA vaccines + CD4 + T cells are less than 1.0%, only Shingrix ® 2~3 times of the positive control vaccine and about 1~2 times of comparative example 4 (YK-VZV-007);

[0638] or

[0639] IL-2 + CD4 + T cells account for less than 1.0%, which is Shingrix ® Less than 3 times that of the positive control vaccine and less than 2 times that of YK-VZV-007 (Comparative Example 4); the information is as follows:

[0640] .

[0641] The above-mentioned mRNA vaccines induce the production of IFN-γ or IL-2 in CD4 + T cells account for less than 1% of spleen cells and produce IFN-γ + CD4 + T cells and IL-2 + CD4 + The total proportion of T cells is less than Shingrix ® The immune enhancement effect is poor compared with the sequences in Part A above, and it is not suitable as a candidate sequence for herpes zoster vaccine.

[0642] In summary, the test substances YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-038, and YK-VZV-031 mRNA vaccines were selected to induce the production of IFN-γ + CD4 + T cells and IL-2 + CD4 + The T cell effect was excellent, so the above sequence and YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) were used in subsequent CD8 + T cell immune analysis.

[0643] CD8+ T cells

[0644] In CD4 + Based on the results of T cells, the test substances YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-038, YK-VZV-031, as well as YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) were measured to determine their ability to induce the production of IL-2 / IFN-γ in CD8 T cells. + The specific results of T cell count are shown in the following table:

[0645]

[0646] IFN-γ + CD8 + T cells and IL-2 + CD8 + Total T cells

[0647] A) Based on the above results, the test substances YK-VZV-010, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-011 mRNA vaccines were screened to induce the secretion of IFN-γ + CD8 + T cells and IL-2 + CD8 + Shingrix ®The results are 4 to 7 times higher than that of the positive control vaccine and 3 to 5 times higher than that of YK-VZV-007 (Comparative Example 4). See the table below for specific results:

[0648] Table 22 mRNA vaccine induces IFN-γ + CD8 + T cells and IL-2 + CD8 + Total T cells-1

[0649] Test substance <![CDATA[CD8 + (IFN-γ + or IL-2 + )]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-010 7.90% 7.18 4.94 YK-VZV-013 7.10% 6.45 4.44 YK-VZV-020 5.60% 5.09 3.50 YK-VZV-018 5.20% 4.73 3.25 YK-VZV-011 5.10% 4.64 3.19 LNP 0.00% - - <![CDATA[Shingrix ® ]]> 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.60% 1.45 1.00

[0650] B) The IFN-γ secreted by the test substances YK-VZV-012, YK-VZV-028, YK-VZV-038, and YK-VZV-031 mRNA vaccines + CD8 + T cells and IL-2 + CD8 + The total proportion of T cells is less than Shingrix ® The positive control vaccine is 4 times, and less than 3 times that of YK-VZV-007 (Comparative Example 4). The specific results are shown in the table below:

[0651] Table 23 mRNA vaccine induces IFN-γ + CD8 + T cells and IL-2 + CD8 + Total T cells-2

[0652] Test substance <![CDATA[CD8 + (IFN-γ + or IL-2 + )]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-012 4.20% 3.82 2.63 YK-VZV-028 3.10% 2.82 1.94 YK-VZV-038 2.30% 2.09 1.44 YK-VZV-031 1.90% 1.73 1.19 LNP 0.00% - - <![CDATA[Shingrix ® ]]> 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.60% 1.45 1.00

[0653] IFN-γ + CD8 + T cells

[0654] A) Screening of IFN-γ secreted by the test substances YK-VZV-010, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-011 mRNA vaccines + CD8 + The T cell ratio was the best, all above 5.0%, with YK-VZV-010 having the highest ratio of 8.10%, which was significantly higher than that of comparison samples 1 to 4 (YK-VZV-004, YK-VZV-006, YK-VZV-045, and YK-VZV-007). The above five sequences are Shingrix ® The positive control vaccine is 4.5 to 7.0 times more potent than the positive control vaccine and about 2.5 to 4.5 times more potent than YK-VZV-007. The specific results are shown in the table below:

[0655] Table 24 mRNA vaccine induces IFN-γ+ CD8 + T cell-1

[0656] Test substance <![CDATA[CD8 + (IFN-γ + )]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-010 8.10% 7.36 4.26 YK-VZV-013 6.90% 6.27 3.63 YK-VZV-020 5.60% 5.09 2.95 YK-VZV-018 5.20% 4.73 2.74 YK-VZV-011 5.00% 4.55 2.63 LNP 0.00% - - <![CDATA[Shingrix ® ]]> 1.10% 1.00 0.58 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00

[0657] B) IFN-γ secreted by the test substances YK-VZV-012, YK-VZV-028, YK-VZV-038, and YK-VZV-031 mRNA vaccines + CD8 + T cells account for less than 5%, which is significantly lower than the optimal mRNA vaccine secretory cell ratio (5.00~8.10%), and only Shingrix ® The positive control vaccine was less than 4.0 times that of the positive control vaccine and about 1 to 2 times that of YK-VZV-007, so it was excluded. The specific results are shown in the table below:

[0658] Table 25 mRNA vaccine induces IFN-γ + CD8 + T cell-2

[0659] Test substance <![CDATA[CD8 + (IFN-γ + )]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-012 4.20% 3.82 2.21 YK-VZV-028 3.10% 2.82 1.63 YK-VZV-038 2.40% 2.18 1.26 YK-VZV-031 1.80% 1.64 0.95 LNP 0.00% - - <![CDATA[Shingrix ® ]]> 1.10% 1.00 0.58 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00

[0660] IL-2 + CD8 + T cells

[0661] A) Screening of IL-2 secreted by the test substances YK-VZV-010, YK-VZV-013, YK-VZV-018, YK-VZV-011, YK-VZV-028, and YK-VZV-020 mRNA vaccines + CD8 + The T cell ratio is the best, reaching 0.3~0.5%, and is significantly higher than the control group (YK-VZV-004, YK-VZV-006, YK-VZV-045, YK-VZV-007). ® The positive control vaccine is 2.5 to 4.0 times more potent than the positive control vaccine and about 1.5 to 3.0 times more potent than YK-VZV-007. The specific results are shown in the table below:

[0662] Table 26 mRNA vaccine induces IL-2 + CD8 + T cell-1

[0663] Test substance <![CDATA[CD8 + (IL-2 + )]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-010 0.50% 4.17 2.78 YK-VZV-013 0.40% 3.33 2.22 YK-VZV-018 0.40% 3.33 2.22 YK-VZV-011 0.40% 3.33 2.22 YK-VZV-028 0.40% 3.33 2.22 YK-VZV-020 0.30% 2.50 1.67 LNP 0.00% - - <![CDATA[Shingrix ® ]]> 0.12% 1.00 0.67 YK-VZV-004 (Comparative Example 1) 0.21% 1.75 1.17 YK-VZV-006 (Comparative Example 2) 0.20% 1.67 1.11 YK-VZV-045 (Comparative Example 3) 0.16% 1.33 0.89 YK-VZV-007 (Comparative Example 4) 0.18% 1.50 1.00

[0664] B) IL-2 secretion by the test substances YK-VZV-038, YK-VZV-012, and YK-VZV-031 mRNA vaccines + CD8 +The proportion of T cells is only below 0.2%, and its effect is better than Shingrix. ® The positive control vaccine and YK-VZV-007 were not significantly different or worse, only Shingrix ® The positive control vaccine was about 0.8 to 1.6 times that of the positive control vaccine and about 0.5 to 1.0 times that of YK-VZV-007, so it was excluded. The specific results are shown in the table below:

[0665] Table 27 mRNA vaccine induces IL-2 + CD8 + T cell-2

[0666] Test substance <![CDATA[CD8 + (IL-2 + )]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-038 0.20% 1.67 1.11 YK-VZV-012 0.10% 0.83 0.56 YK-VZV-031 0.10% 0.83 0.56 LNP 0.00% - - <![CDATA[Shingrix ® ]]> 0.12% 1.00 0.67 YK-VZV-004 (Comparative Example 1) 0.21% 1.75 1.17 YK-VZV-006 (Comparative Example 2) 0.20% 1.67 1.11 YK-VZV-045 (Comparative Example 3) 0.16% 1.33 0.89 YK-VZV-007 (Comparative Example 4) 0.18% 1.50 1.00

[0667] in conclusion:

[0668] Combining the above ①~③ results, the candidate vaccines were screened to determine the proportion of immune cells in the spleen of mice induced by the following:

[0669] A) IFN-γ + CD8 + T cells and IL-2 + CD8 + The total T cell percentage is more than 4 to 7 times that of Shingrix® vaccine and about 3 to 5 times that of YK-VZV-007 (Comparative Example 4);

[0670] IFN-γ + CD8 + The best T cell ratio is more than 5.0%, which is Shingrix ® It was more than 4.5 to 7.0 times that of the positive control vaccine and about 2.5 to 4.5 times that of YK-VZV-007;

[0671] IL-2 + CD8 + The optimal percentage of T cells is 0.3-0.5%, which is Shingrix. ® It is more than 2.5 to 4.0 times that of the positive control vaccine and about 1.5 to 3.0 times that of YK-VZV-007;

[0672] And they are all significantly higher than the control examples (YK-VZV-004, YK-VZV-006, YK-VZV-045, YK-VZV-007). The information is as follows:

[0673] .

[0674] B) The percentage of immune cells in the spleen of mice induced by the vaccine of the eliminated test substance:

[0675] IFN-γ +CD8+ T cells and IL-2 + CD8 + The total T cell percentage was less than 4 times that of Shingrix® vaccine and less than 3 times that of YK-VZV-007 (Comparative Example 4);

[0676] or IFN-γ + CD8 + T cells account for less than 5%, which is significantly lower than the optimal mRNA vaccine secretory cell ratio (5.20~8.10%), and only Shingrix ® less than 4.0 times that of the positive control vaccine and about 1 to 2 times that of YK-VZV-007;

[0677] or IL-2 + CD8 + The proportion of T cells is only below 0.2%, and its effect is better than Shingrix. ® The positive control vaccine and YK-VZV-007 were not significantly different or worse, only Shingrix ® The positive control vaccine was approximately 0.8 to 1.6 times that of the positive control vaccine and 0.5 to 1.0 times that of YK-VZV-007, so it was excluded;

[0678] The information is as follows:

[0679] .

[0680] YK-VZV-012 and YK-VZV-031 mRNA vaccines induce IL-2 production + CD8 + T cell percentage compared to Shingrix ® The vaccine and YK-VZV-007 (Comparative Example 4) were less effective and were therefore eliminated.

[0681] YK-VZV-028 and YK-VZV-038 mRNA vaccines induce IFN-γ production + CD8 + T cells and IFN-γ + and IL-2 + CD8 + The total proportion of T cells is only Shingrix ® The vaccine is about 2 times, which is significantly lower than the sequence designed in Part A above (up to 7 times or more). The immune effect is poor and it is not suitable as a candidate sequence for the shingles vaccine.

[0682] Therefore, based on the above results, it can be seen that the sequences with obvious advantages in comprehensive immune effects include: YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018. The immune effects are excellent and significantly better than other sequences, among which YK-VZV-010 has the best effect.

[0683] Results of gE protein-specific IgG antibody titers of VZV gE antigen variants in Balb / c mouse serum (D56)

[0684] In order to verify the consistency of the above-mentioned IgG antibody titers and the results of cellular immunity detection of some VZV gE antigen variants, the following test substances (including YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-013, YK-VZV-020, YK-VZV-014, YK-VZV-012, YK-VZV-018, YK-VZV-021, YK-VZV-024, YK-VZV-030, YK-VZV-031, YK-VZV-032, YK-VZV-033, YK-VZV-034, YK-VZV-035) were further used. ZV-028, YK-VZV-030, YK-VZV-031, YK-VZV-038 and YK-VZV-004 (Comparative Example 1), YK-VZV-045 (Comparative Example 3) and YK-VZV-007 (Comparative Example 4)), serum samples of immunized mice on the 56th day were measured, and the VZV binding-gE antibody IgG titer in the serum was detected according to the detection method in Example 5. The test results are shown in the following table:

[0685] Table 30 VZV-gE binding antibody IgG titer in serum (day 56)

[0686] Test substance <![CDATA[Antibody GMT (×10 4 ).]]> <![CDATA[The geometric mean titer (GMT) of the test substance antibody compared with Shingrix ® and the GMT of the antibody]]> Comparison of the test antibody GMT and YK-VZV-007 antibody GMT YK-VZV-010 750 5.00 2.68 YK-VZV-011 710 4.73 2.54 YK-VZV-018 698 4.65 2.49 YK-VZV-020 690 4.60 2.46 YK-VZV-013 669 4.46 2.39 YK-VZV-031 480 3.20 1.71 YK-VZV-030 454 3.03 1.62 YK-VZV-038 445 2.97 1.59 YK-VZV-009 420 2.80 1.50 YK-VZV-014 410 2.73 1.46 YK-VZV-012 405 2.70 1.45 YK-VZV-021 373 2.49 1.33 YK-VZV-028 357 2.38 1.28 YK-VZV-024 274 1.83 0.98 LNP 0 0.00 0.00 <![CDATA[Shingrix ® ]]> 150 1.00 0.54 YK-VZV-004 (Comparative Example 1) 330 2.20 1.18 YK-VZV-045 (Comparative Example 3) 170 1.13 0.61 YK-VZV-007 (Comparative Example 4) 280 1.87 1.00

[0687] According to the above results, on day 56, the gE-specific antibody IgG titers of the above mRNA vaccines were better than those of Shingrix ® Positive control, Shingrix ® The antibody GMT ranged from 270 to 750 × 10 4 The GMT of antibodies YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-020, and YK-VZV-013 can reach 650×10 4 The above is Shingrix ® The efficacy of the vaccine was 4.0 to 5.0 times that of the YK-VZV-007 (Comparative Example 4) and more than 2 times that of the YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3).

[0688] Combined with the above IgG antibody titer and CD4 + T cells and CD8 + The T cell test results showed that the five antigens YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018 had the best cellular immune effects, so they were used as candidate antigens for further detection and analysis using the subsequent ELISpot method.

[0689] VZV gE antigen variant cellular immune response (ELISOPT)

[0690] ELISpot is the gold standard for screening and evaluating the antigen-specific T cell immune effects of candidate vaccines. It can be used to distinguish different subsets of activated T cells through cytokines, such as T helper (Th) type 1 cells (producing IFN-γ, IL-2, IL-6, IL-12, IL-21 and TNF-α cytokines), Th2 (producing IL-4, IL-5, IL-10 and IL-13 cytokines) and Th17 (producing IL-17 cytokine) cells.

[0691] Five optimal antigen sequences (including YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018) were screened out by comprehensive IgG and cytokine test results, together with Comparative Example 1 (YK-VZV-004), Comparative Example 2 (YK-VZV-006), Comparative Example 3 (YK-VZV-045), and Comparative Example 4 (YK-VZV-007), and LNP and Shingrix were used. ® As a control, the ELISpot method was further used for detection, and the results were as follows:

[0692] 1) The amount of IFN-γ secreted by T cells stimulated by mRNA vaccines was above 500 SFU, with the highest being close to 600 SFU, which is about the same as Shingrix ® The secretion of cytokines stimulated by the mRNA vaccines is 16 to 19 times that of the positive control and 2.5 to 3.0 times that of comparative example 4 (YK-VZV-007); and is significantly better than that of comparative example 1 (YK-VZV-004), comparative example 2 (YK-VZV-006) or comparative example 3 (YK-VZV-045).

[0693] Among them, the mRNA vaccine prepared by the YK-VZV-010 sequence reached a maximum of 598.8 SFU, which is Shingrix ® 18.7 times that of the positive control and nearly 3 times that of the YK-VZV-007 control.

[0694] The IFN-γ secretion levels from high to low are YK-VZV-010, YK-VZV-018, YK-VZV-011, YK-VZV-020, and YK-VZV-013. There is no obvious difference between the groups, and the immune effects are good and significant.

[0695] Table 31 mRNA vaccine induces spleen cells to secrete IFN-γ +

[0696] Test substance <![CDATA[IFN-γ + (SFU)]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-010 598.8 18.71 2.99 YK-VZV-018 565 17.66 2.82 YK-VZV-011 561.7 17.55 2.80 YK-VZV-020 522.4 16.33 2.61 YK-VZV-013 511.0 15.97 2.55 LNP 1.2 0.04 0.01 <![CDATA[Shingrix ® ]]> 32.0 1.00 0.16 YK-VZV-004 (Comparative Example 1) 280.3 8.76 1.40 YK-VZV-006 (Comparative Example 2) 220.3 6.88 1.10 YK-VZV-045 (Comparative Example 3) 200.1 6.25 1.00 YK-VZV-007 (Comparative Example 4) 200.3 6.26 1.00

[0697] 2) The amount of IL-2 secreted by T cells stimulated by mRNA vaccines was above 400~600 SFU, which is Shingrix ® The secretion of cytokines stimulated by the mRNA vaccines is 10 to 16 times that of the positive control and 2.0 to 3.0 times that of the YK-VZV-007 control. It is also significantly better than the cytokines secreted by the mRNA vaccines corresponding to Comparative Example 1 (YK-VZV-004), Comparative Example 2 (YK-VZV-006) or Comparative Example 3 (YK-VZV-045).

[0698] Among them, the mRNA vaccine prepared by the YK-VZV-010 sequence reached a maximum of 614.5 SFU, which is Shingrix ® 16.00 times that of the positive control and more than 3 times that of the YK-VZV-007 control.

[0699] The IL-2 secretion levels from high to low are YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-013, and YK-VZV-020. There is no obvious difference between the groups, and the immune effects are good and significant.

[0700] Table 32 mRNA vaccine induces spleen cells to secrete IL-2 +

[0701] Test substance <![CDATA[IL-2 + (SFU)]]> <![CDATA[Compared with Shingrix ® (times)]]> Compared with YK-VZV-007 (times) YK-VZV-010 614.5 16.00 3.07 YK-VZV-011 490.3 12.77 2.45 YK-VZV-018 452.3 11.78 2.26 YK-VZV-013 441.6 11.50 2.20 YK-VZV-020 418.9 10.91 2.09 LNP 16.1 0.42 0.08 <![CDATA[Shingrix ® ]]> 38.4 1.00 0.19 YK-VZV-004 (Comparative Example 1) 274.7 7.15 1.37 YK-VZV-006 (Comparative Example 2) 230.3 6.00 1.15 YK-VZV-045 (Comparative Example 3) 205.3 5.35 1.02 YK-VZV-007 (Comparative Example 4) 200.4 5.22 1.00

[0702] Results of cellular localization of VZV gE antigen variants

[0703] C-terminal truncation and "A 568 Y 569 R 570 V 571 "Motif mutations reduce gE antigen localization to the trans-homozygous network

[0704] “A 568 Y 569 R 570 V 571" motif (SEQ ID NO: 184) is a transport motif that targets the gE polypeptide to the trans-Galvan network, YK-VZV-018 (SEQ ID NO: 63) and YK-VZV-020 (SEQ ID NO: 71) encode truncated polypeptides with the terminal 50 amino acids of the C-terminal region deleted (retaining 1-573aa), and mutated A 568 Y 569 R 570 V 571 Any site in the sequence (e.g., mutations at sites A568D and Y569K). The results of Example 8 show that both YK-VZV-018 and YK-VZV-020 variants result in reduced localization of the gE polypeptide to the trans-Gokistan network and enhanced cell membrane expression.

[0705] With "A 568 Y 569 R 570 V 571 ” or “Y 582 A 583 G 584 L 585 Any combination of mutations in the motifs reduced gE antigen localization to the trans-Hokite network.

[0706] YK-VZV-011 (SEQ ID NO: 35) and YK-VZV-013 (SEQ ID NO: 43) encode full-length gE polypeptide and have "A 568 Y 569 R 570 V 571 ” motif (SEQ ID NO: 184) at each site mutation, in addition, the “Y 582 A 583 G 584 L 585 " Endocytosis motif (SEQ ID NO: 185) also mutated (eg, Y582A). The results of Example 8 showed that the 568 Y 569 R 570 V 571 ” or “Y 582 A 583 G 584 L 585 "Any combination of mutation motifs resulted in gE antigen expression on the cell membrane.

[0707] 3) With "A 593 E 594 A 595 A 596 D 597 A 598"Full-length gE variants with mutated motifs, Y569K and Y582A mutations, have reduced localization to the trans-Galvan network

[0708] YK-VZV-010 (SEQ ID NO: 31) encodes the full-length gE polypeptide, and its A 593 E 594 A 595 A 596 D 597 A 598 (SEQ ID NO: 183) sequence replaced with "S 593 E 594 S 595 T 596 D 597 T 598 " motif (SEQ ID NO: 182). YK-VZV-010 replaces the Ser / Thr-rich "SSTT" acidic cluster with an Ala-rich sequence. In addition, the YK-VZV-010 mRNA vaccine also has Y569K and Y582 mutations. The results of Example 8 show that the cell membrane expression of the YK-VZV-010 gE polypeptide is enhanced.

[0709] Each of the above variants has modifications that reduce the localization of the encoded gE protein to the trans-Hokkigan network and enhance trafficking to the plasma membrane.

[0710] Table 33 Antigen localization results of different VZV antigen sequences on Vero cells

[0711] mutation site Antigen sequence SEQ ID NO Express Cellular localization gE full length; Y569K; Y582A; S593A; S595A; T596A; T598A YK-VZV-010 31 +++ Shows Golgi apparatus and cell membrane localization gE full length; A568D; Y569K; R570E; V571K YK-VZV-011 35 ++ Shows Golgi localization and cell membrane localization gE full length; A568D; Y569K; R570E; V571K; Y582A YK-VZV-013 43 ++ Shows Golgi and cytoplasmic localization and cell membrane gE(1-573aa);A568D YK-VZV-018 63 +++ Shows Golgi apparatus, cytoplasmic localization, and cell membrane gE (1-573aa); Y569K YK-VZV-020 71 +++ Showing Golgi apparatus and cytoplasmic localization and cell membrane

[0712] Summarize

[0713] In summary, the present invention designed 43 antigen sequences encoding VZV gE protein variants and screened out a number of sequences with excellent effects, including several sequences that were at least better than the vaccine Shingrix ®The results are surprising because the antigen sequences are more effective than those of YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4). Among these sequences, the sequences with mutation combinations of YK-VZV-010 (gE full length; Y569K; Y582A; S593A; S595A; T596A; T598A), YK-VZV-011 (gE full length; A568D; Y569K; R570E; V571K), YK-VZV-013 (gE full length; A568D; Y569K; R570E; V571K; Y582A), YK-VZV-018 (gE 1-573aa, A568D) and YK-VZV-020 (gE1-573aa, Y569K) are more preferred. The following table shows the complete sequence information and numbering of this application, taking the antigen sequence of YK-VZV-001 as an example, wherein SEQ NO ID: 2 and 3 are the nucleic acid sequence ("ORF-NT") and amino acid sequence ("ORF-AA") of the open reading frame of antigen YK-VZV-001, respectively; SEQ NO ID: 1 and 4 are the DNA sequence ("DNA") and mRNA sequence ("mRNA") of antigen YK-VZV-001, respectively.

[0714] Table 34 Sequence Listing Information

[0715] SEQ NO ID: Name Sequence type 1 YK-VZV-001-DNA DNA 2 YK-VZV-001- ORF-NT ORF-NT 3 YK-VZV-001- ORF-AA ORF-AA 4 YK-VZV-001- mRNA mRNA 5 YK-VZV-002- DNA DNA 6 YK-VZV-002- ORF-NT ORF-NT 7 YK-VZV-002- ORF-AA ORF-AA 8 YK-VZV-002-mRNA mRNA 9 YK-VZV-003-DNA DNA 10 YK-VZV-003-ORF-NT ORF-NT 11 YK-VZV-003-ORF-AA ORF-AA 12 YK-VZV-003-mRNA mRNA 13 YK-VZV-004-DNA DNA 14 YK-VZV-004- ORF-NT ORF-NT 15 YK-VZV-004- ORF-AA ORF-AA 16 YK-VZV-004- mRNA mRNA 17 YK-VZV-006- DNA DNA 18 YK-VZV-006- ORF-NT ORF-NT 19 YK-VZV-006- ORF-AA ORF-AA 20 YK-VZV-006- mRNA mRNA 21 YK-VZV-007-DNA DNA 22 YK-VZV-007-ORF-NT ORF-NT 23 YK-VZV-007-ORF-AA ORF-AA 24 YK-VZV-007-mRNA mRNA 25 YK-VZV-009-DNA DNA 26 YK-VZV-009-ORF-NT ORF-NT 27 YK-VZV-009-ORF-AA ORF-AA 28 YK-VZV-009-mRNA mRNA 29 YK-VZV-010-DNA DNA 30 YK-VZV-010-ORF-NT ORF-NT 31 YK-VZV-010-ORF-AA ORF-AA 32 YK-VZV-010-mRNA mRNA 33 YK-VZV-011-DNA DNA 34 YK-VZV-011-ORF-NT ORF-NT 35 YK-VZV-011-ORF-AA ORF-AA 36 YK-VZV-011-mRNA mRNA 37 YK-VZV-012-DNA DNA 38 YK-VZV-012-ORF-NT ORF-NT 39 YK-VZV-012-ORF-AA ORF-AA 40 YK-VZV-012-mRNA mRNA 41 YK-VZV-013-DNA DNA 42 YK-VZV-013-ORF-NT ORF-NT 43 YK-VZV-013-ORF-AA ORF-AA 44 YK-VZV-013-mRNA mRNA 45 YK-VZV-014-DNA DNA 46 YK-VZV-014-ORF-NT ORF-NT 47 YK-VZV-014-ORF-AA ORF-AA 48 UN-VZV-014 mRNA mRNA 49 UN-VZV-015-DNA DNA 50 YK-VZV-015-ORF-NT ORF-NT 51 YK-VZV-015-ORF-AA ORF-AA 52 UN-VZV-015 mRNA mRNA 53 UN-VZV-016-DNA DNA 54 YK-VZV-016-ORF-NT ORF-NT 55 YK-VZV-016-ORF-AA ORF-AA 56 UN-VZV-016 mRNA mRNA 57 UN-VZV-017-DNA DNA 58 YK-VZV-017-ORF-NT ORF-NT 59 YK-VZV-017-ORF-AA ORF-AA 60 UN-VZV-017 mRNA mRNA 61 UN-VZV-018-DNA DNA 62 YK-VZV-018-ORF-NT ORF-NT 63 YK-VZV-018-ORF-AA ORF-AA 64 UN-VZV-018 mRNA mRNA 65 UN-VZV-019-DNA DNA 66 YK-VZV-019-ORF-NT ORF-NT 67 YK-VZV-019-ORF-AA ORF-AA 68 UN-VZV-019 mRNA mRNA 69 YK-VZV-020-DNA DNA 70 YK-VZV-020-ORF-NT ORF-NT 71 YK-VZV-020-ORF-AA ORF-AA 72 UN-VZV-020-mRNA mRNA 73 UN-VZV-021-DNA DNA 74 YK-VZV-021-ORF-NT ORF-NT 75 YK-VZV-021-ORF-AA ORF-AA 76 UN-VZV-021 mRNA mRNA 77 UN-VZV-022-DNA DNA 78 YK-VZV-022-ORF-NT ORF-NT 79 YK-VZV-022-ORF-AA ORF-AA 80 UN-VZV-022 mRNA mRNA 81 UN-VZV-023-DNA DNA 82 YK-VZV-023-ORF-NT ORF-NT 83 YK-VZV-023-ORF-AA ORF-AA 84 UN-VZV-023 mRNA mRNA 85 UN-VZV-024-DNA DNA 86 YK-VZV-024-ORF-NT ORF-NT 87 YK-VZV-024-ORF-AA ORF-AA 88 UN-VZV-024 mRNA mRNA 89 UN-VZV-025-DNA DNA 90 YK-VZV-025-ORF-NT ORF-NT 91 YK-VZV-025-ORF-AA ORF-AA 92 UN-VZV-025 mRNA mRNA 93 UN-VZV-026-DNA DNA 94 YK-VZV-026-ORF-NT ORF-NT 95 YK-VZV-026-ORF-AA ORF-AA 96 UN-VZV-026 mRNA mRNA 97 UN-VZV-027-DNA DNA 98 YK-VZV-027-ORF-NT ORF-NT 99 YK-VZV-027-ORF-AA ORF-AA 100 UN-VZV-027 mRNA mRNA 101 UN-VZV-028-DNA DNA 102 YK-VZV-028-ORF-NT ORF-NT 103 YK-VZV-028-ORF-AA ORF-AA 104 UN-VZV-028 mRNA mRNA 105 UN-VZV-029-DNA DNA 106 YK-VZV-029-ORF-NT ORF-NT 107 YK-VZV-029-ORF-AA ORF-AA 108 UN-VZV-029 mRNA mRNA 109 UN-VZV-030-DNA DNA 110 YK-VZV-030-ORF-NT ORF-NT 111 YK-VZV-030-ORF-AA ORF-AA 112 UN-VZV-030-mRNA mRNA 113 UN-VZV-031-DNA DNA 114 YK-VZV-031-ORF-NT ORF-NT 115 YK-VZV-031-ORF-AA ORF-AA 116 UN-VZV-031 mRNA mRNA 117 YK-VZV-032-DNA DNA 118 YK-VZV-032-ORF-NT ORF-NT 119 YK-VZV-032-ORF-AA ORF-AA 120 UN-VZV-032 mRNA mRNA 121 UN-VZV-033-DNA DNA 122 YK-VZV-033-ORF-NT ORF-NT 123 YK-VZV-033-ORF-AA ORF-AA 124 UN-VZV-033 mRNA mRNA 125 UN-VZV-034-DNA DNA 126 YK-VZV-034-ORF-NT ORF-NT 127 YK-VZV-034-ORF-AA ORF-AA 128 UN-VZV-034-mRNA mRNA 129 UN-VZV-035-DNA DNA 130 YK-VZV-035-ORF-NT ORF-NT 131 YK-VZV-035-ORF-AA ORF-AA 132 UN-VZV-035 mRNA mRNA 133 UN-VZV-036-DNA DNA 134 YK-VZV-036-ORF-NT ORF-NT 135 YK-VZV-036-ORF-AA ORF-AA 136 UN-VZV-036 mRNA mRNA 137 UN-VZV-037-DNA DNA 138 YK-VZV-037-ORF-NT ORF-NT 139 YK-VZV-037-ORF-AA ORF-AA 140 UN-VZV-037 mRNA mRNA 141 UN-VZV-038-DNA DNA 142 YK-VZV-038-ORF-NT ORF-NT 143 YK-VZV-038-ORF-AA ORF-AA 144 YK-VZV-038-mRNA mRNA 145 YK-VZV-039-DNA DNA 146 YK-VZV-039-ORF-NT ORF-NT 147 YK-VZV-039-ORF-AA ORF-AA 148 YK-VZV-039-mRNA mRNA 149 YK-VZV-040-DNA DNA 150 YK-VZV-040-ORF-NT ORF-NT 151 YK-VZV-040-ORF-AA ORF-AA 152 YK-VZV-040-mRNA mRNA 153 YK-VZV-041-DNA DNA 154 YK-VZV-041-ORF-NT ORF-NT 155 YK-VZV-041-ORF-AA ORF-AA 156 YK-VZV-041-mRNA mRNA 157 YK-VZV-042-DNA DNA 158 YK-VZV-042-ORF-NT ORF-NT 159 YK-VZV-042-ORF-AA ORF-AA 160 YK-VZV-042-mRNA mRNA 161 YK-VZV-043-DNA DNA 162 YK-VZV-043-ORF-NT ORF-NT 163 YK-VZV-043-ORF-AA ORF-AA 164 YK-VZV-043-mRNA mRNA 165 YK-VZV-044-DNA DNA 166 YK-VZV-044-ORF-NT ORF-NT 167 YK-VZV-044-ORF-AA ORF-AA 168 YK-VZV-044-mRNA mRNA 169 YK-VZV-045-DNA DNA 170 YK-VZV-045-ORF-NT ORF-NT 171 YK-VZV-045-ORF-AA ORF-AA 172 YK-VZV-045-mRNA mRNA 173 5’ UTR Synthetic 174 5’ UTR 175 C3 (complement component 3) 5’ UTR 176 Synthetic 177 5’ UTR Synthetic 178 5’ UTR 179 Synthetic 180 3’ UTR Homo sapiens hemoglobin β-globin gene 1 (TA) 181 3’ UTR Homo sapiens hemoglobin β-globin gene 182 <![CDATA[S 593 ES 595 T 596 DT 598 Motif]]> 3’ UTR 183 <![CDATA[A 593 EA 595 A 596 DA 598 motif]]> PCBP4 gene 184 <![CDATA[A 568 YRV 571 Motif]]> 3’ UTR 185 <![CDATA[Y 582 AGL 585 Motif]]> CYBA_1.5x Amino acid sequence Amino acid sequence Amino acid sequence Amino acid sequence

[0716] SEQ ID NO: 1 YK-VZV-001-DNA

[0717]

[0718] SEQ ID NO: 2 YK-VZV-001-ORF-NT

[0719]

[0720] SEQ ID NO: 3 YK-VZV-001- ORF-AA

[0721] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0722] SEQ ID NO: 4 YK-VZV-001-mRNA

[0723]

[0724] SEQ ID NO: 5 YK-VZV-002 DNA

[0725]

[0726] SEQ ID NO: 6 YK-VZV-002- ORF-NT

[0727]

[0728] SEQ ID NO: 7 YK-VZV-002-ORF-AA

[0729] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYA

[0730] SEQ ID NO: 8 YK-VZV-002-mRNA

[0731]

[0732] SEQ ID NO: 9 YK-VZV-003 DNA

[0733]

[0734] SEQ ID NO: 10 YK-VZV-003-ORF-NT

[0735]

[0736] SEQ ID NO: 11 YK-VZV-003-ORF-AA

[0737] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKA

[0738] SEQ ID NO: 12 YK-VZV-003-mRNA

[0739]

[0740] SEQ ID NO: 13 YK-VZV-004 DNA

[0741]

[0742] SEQ ID NO: 14 YK-VZV-004-ORF-NT

[0743]

[0744] SEQ ID NO: 15 YK-VZV-004-ORF-AA

[0745] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAARVDK

[0746] SEQ ID NO: 16 YK-VZV-004-mRNA

[0747]

[0748] SEQ ID NO: 17 YK-VZV-006 DNA

[0749]

[0750] SEQ ID NO: 18 YK-VZV-006-ORF-NT

[0751]

[0752] SEQ ID NO: 19 YK-VZV-006-ORF-AA

[0753] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAARVDKSPYNQSMYYAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0754] SEQ ID NO: 20 YK-VZV-006-mRNA

[0755]

[0756] SEQ ID NO: 21 YK-VZV-007 DNA

[0757]

[0758] SEQ ID NO: 22 YK-VZV-007- ORF-NT

[0759]

[0760] SEQ ID NO: 23 YK-VZV-007- ORF-AA

[0761] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYAAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0762] SEQ ID NO: 24 YK-VZV-007- mRNA

[0763]

[0764] SEQ ID NO: 25 YK-VZV-009-DNA

[0765]

[0766] SEQ ID NO: 26 YK-VZV-009-ORF-NT

[0767]

[0768] SEQ ID NO: 27 YK-VZV-009-ORF-AA

[0769] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDKSPYNQSMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0770] SEQ ID NO: 28 YK-VZV-009- mRNA

[0771]

[0772] SEQ ID NO: 29 YK-VZV-010 DNA

[0773]

[0774] SEQ ID NO: 30 YK-VZV-010-ORF-NT

[0775]

[0776] SEQ ID NO: 31 YK-VZV-010-ORF-AA

[0777] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDKSPYNQSMYAAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0778] SEQ ID NO: 32 YK-VZV-010-mRNA

[0779]

[0780] SEQ ID NO: 33 YK-VZV-011 DNA

[0781]

[0782] SEQ ID NO: 34 YK-VZV-011-ORF-NT

[0783]

[0784] SEQ ID NO: 35 YK-VZV-011-ORF-AA

[0785] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0786] SEQ ID NO: 36 YK-VZV-011- mRNA

[0787]

[0788] SEQ ID NO: 37 YK-VZV-012 DNA

[0789]

[0790] SEQ ID NO: 38 YK-VZV-012-ORF-NT

[0791]

[0792] SEQ ID NO: 39 YK-VZV-012- ORF-AA

[0793] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYYAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0794] SEQ ID NO: 40 YK-VZV-012- mRNA

[0795]

[0796] SEQ ID NO: 41 YK-VZV-013-DNA

[0797]

[0798] SEQ ID NO: 42 YK-VZV-013- ORF-NT

[0799]

[0800] SEQ ID NO: 43 YK-VZV-013-ORF-AA

[0801] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0802] SEQ ID NO: 44 YK-VZV-013- mRNA

[0803]

[0804] SEQ ID NO: 45 YK-VZV-014-DNA

[0805]

[0806] SEQ ID NO: 46 YK-VZV-014-ORF-NT

[0807]

[0808] SEQ ID NO: 47 YK-VZV-014-ORF-AA

[0809] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYAAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0810] SEQ ID NO: 48 YK-VZV-014-mRNA

[0811]

[0812] SEQ ID NO: 49 YK-VZV-015-DNA

[0813]

[0814] SEQ ID NO: 50 YK-VZV-015- ORF-NT

[0815]

[0816] SEQ ID NO: 51 YK-VZV-015- ORF-AA

[0817] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0818] SEQ ID NO: 52 YK-VZV-015- mRNA

[0819]

[0820] SEQ ID NO: 53 YK-VZV-016-DNA

[0821]

[0822] SEQ ID NO: 54 YK-VZV-016- ORF-NT

[0823]

[0824] SEQ ID NO: 55 YK-VZV-016- ORF-AA

[0825] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYYAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0826] SEQ ID NO: 56 YK-VZV-016- mRNA

[0827]

[0828] SEQ ID NO: 57 YK-VZV-017-DNA

[0829]

[0830] SEQ ID NO: 58 YK-VZV-017- ORF-NT

[0831]

[0832] SEQ ID NO: 59 YK-VZV-017- ORF-AA

[0833] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDK

[0834] SEQ ID NO: 60 YK-VZV-017- mRNA

[0835]

[0836] SEQ ID NO: 61 YK-VZV-018-DNA

[0837]

[0838] SEQ ID NO: 62 YK-VZV-018- ORF-NT

[0839]

[0840] SEQ ID NO: 63 YK-VZV-018- ORF-AA

[0841] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDYRVDK

[0842] SEQ ID NO: 64 YK-VZV-018- mRNA

[0843]

[0844] SEQ ID NO: 65 YK-VZV-019 DNA

[0845]

[0846] SEQ ID NO: 66 YK-VZV-019-ORF-NT

[0847]

[0848] SEQ ID NO: 67 YK-VZV-019- ORF-AA

[0849] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKYRVDK

[0850] SEQ ID NO: 68 YK-VZV-019- mRNA

[0851]

[0852] SEQ ID NO: 69 YK-VZV-020-DNA

[0853]

[0854] SEQ ID NO: 70 YK-VZV-020-ORF-NT

[0855]

[0856] SEQ ID NO: 71 YK-VZV-020- ORF-AA

[0857] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDK

[0858] SEQ ID NO: 72 YK-VZV-020-mRNA

[0859]

[0860] SEQ ID NO: 73 YK-VZV-021 DNA

[0861]

[0862] SEQ ID NO: 74 YK-VZV-021- ORF-NT

[0863]

[0864] SEQ ID NO: 75 YK-VZV-021-ORF-AA

[0865] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYEVDK

[0866] SEQ ID NO: 76 YK-VZV-021-mRNA

[0867]

[0868] SEQ ID NO: 77 YK-VZV-022 DNA

[0869]

[0870] SEQ ID NO: 78 YK-VZV-022-ORF-NT

[0871]

[0872] SEQ ID NO: 79 YK-VZV-022-ORF-AA

[0873] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRKDK

[0874] SEQ ID NO: 80 YK-VZV-022-mRNA

[0875]

[0876] SEQ ID NO: 81 YK-VZV-023-DNA

[0877]

[0878] SEQ ID NO: 82 YK-VZV-023-ORF-NT

[0879]

[0880] SEQ ID NO: 83 YK-VZV-023-ORF-AA

[0881] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDK

[0882] SEQ ID NO: 84 YK-VZV-023-mRNA

[0883]

[0884] SEQ ID NO: 85 YK-VZV-024-DNA

[0885]

[0886] SEQ ID NO: 86 YK-VZV-024-ORF-NT

[0887]

[0888] SEQ ID NO: 87 YK-VZV-024- ORF-AA

[0889] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDAEKDK

[0890] SEQ ID NO: 88 YK-VZV-024- mRNA

[0891]

[0892] SEQ ID NO: 89 YK-VZV-025 DNA

[0893]

[0894] SEQ ID NO: 90 YK-VZV-025-ORF-NT

[0895]

[0896] SEQ ID NO: 91 YK-VZV-025-ORF-AA

[0897] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKKEKDK

[0898] SEQ ID NO: 92 YK-VZV-025-mRNA

[0899]

[0900] SEQ ID NO: 93 YK-VZV-026-DNA

[0901]

[0902] SEQ ID NO: 94 YK-VZV-026-ORF-NT

[0903]

[0904] SEQ ID NO: 95 YK-VZV-026-ORF-AA

[0905] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYYAGLPV

[0906] SEQ ID NO: 96 YK-VZV-026-mRNA

[0907]

[0908] SEQ ID NO: 97 YK-VZV-027-DNA

[0909]

[0910] SEQ ID NO: 98 YK-VZV-027-ORF-NT

[0911]

[0912] SEQ ID NO: 99 YK-VZV-027- ORF-AA

[0913] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYYAGLPV

[0914] SEQ ID NO: 100 YK-VZV-027-mRNA

[0915]

[0916] SEQ ID NO: 101 YK-VZV-028-DNA

[0917]

[0918] SEQ ID NO: 102 YK-VZV-028-ORF-NT

[0919]

[0920] SEQ ID NO: 103 YK-VZV-028-ORF-AA

[0921] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYAAGLPV

[0922] SEQ ID NO: 104 YK-VZV-028-mRNA

[0923]

[0924] SEQ ID NO: 105 YK-VZV-029-DNA

[0925]

[0926] SEQ ID NO: 106 YK-VZV-029-ORF-NT

[0927]

[0928] SEQ ID NO: 107 YK-VZV-029-ORF-AA

[0929] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYGAGLPV

[0930] SEQ ID NO: 108 YK-VZV-029-mRNA

[0931]

[0932] SEQ ID NO: 109 YK-VZV-030-DNA

[0933]

[0934] SEQ ID NO: 110 YK-VZV-030-ORF-NT

[0935]

[0936] SEQ ID NO: 111 YK-VZV-030-ORF-AA

[0937] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYAAGLPV

[0938] SEQ ID NO: 112 YK-VZV-030-mRNA

[0939]

[0940] SEQ ID NO: 113 YK-VZV-031-DNA

[0941]

[0942] SEQ ID NO: 114 YK-VZV-031-ORF-NT

[0943]

[0944] SEQ ID NO: 115 YK-VZV-031-ORF-AA

[0945] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYGAGLPV

[0946] SEQ ID NO: 116 YK-VZV-031-mRNA

[0947]

[0948] SEQ ID NO: 117 YK-VZV-032-DNA

[0949]

[0950] SEQ ID NO: 118 YK-VZV-032-ORF-NT

[0951]

[0952] SEQ ID NO: 119 YK-VZV-032-ORF-AA

[0953] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDYRVDKSPYNQSMYAAGLPV

[0954] SEQ ID NO: 120 YK-VZV-032-mRNA

[0955]

[0956] SEQ ID NO: 121 YK-VZV-033-DNA

[0957]

[0958] SEQ ID NO: 122 YK-VZV-033-ORF-NT

[0959]

[0960] SEQ ID NO: 123 YK-VZV-033-ORF-AA

[0961] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDKSPYNQSMYAAGLPV

[0962] SEQ ID NO: 124 YK-VZV-033-mRNA

[0963]

[0964] SEQ ID NO: 125 YK-VZV-034-DNA

[0965]

[0966] SEQ ID NO: 126 YK-VZV-034-ORF-NT

[0967]

[0968] SEQ ID NO: 127 YK-VZV-034-ORF-AA

[0969] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYEVDKSPYNQSMYAAGLPV

[0970] SEQ ID NO: 128 YK-VZV-034-mRNA

[0971]

[0972] SEQ ID NO: 129 YK-VZV-035-DNA

[0973]

[0974] SEQ ID NO: 130 YK-VZV-035-ORF-NT

[0975]

[0976] SEQ ID NO: 131 YK-VZV-035-ORF-AA

[0977] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRKDKSPYNQSMYAAGLPV

[0978] SEQ ID NO: 132 YK-VZV-035-mRNA

[0979]

[0980] SEQ ID NO: 133 YK-VZV-036-DNA

[0981]

[0982] SEQ ID NO: 134 YK-VZV-036-ORF-NT

[0983]

[0984] SEQ ID NO: 135 YK-VZV-036-ORF-AA

[0985] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0986] SEQ ID NO: 136 YK-VZV-036-mRNA

[0987]

[0988] SEQ ID NO: 137 YK-VZV-037-DNA

[0989]

[0990] SEQ ID NO: 138 YK-VZV-037-ORF-NT

[0991]

[0992] SEQ ID NO: 139 YK-VZV-037-ORF-AA

[0993] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYAAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[0994] SEQ ID NO: 140 YK-VZV-037-mRNA

[0995]

[0996] SEQ ID NO: 141 YK-VZV-038-DNA

[0997]

[0998] SEQ ID NO: 142 YK-VZV-038-ORF-NT

[0999]

[1000] SEQ ID NO: 143 YK-VZV-038-ORF-AA

[1001] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYGAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[1002] SEQ ID NO: 144 YK-VZV-038-mRNA

[1003]

[1004] SEQ ID NO: 145 YK-VZV-039-DNA

[1005]

[1006] SEQ ID NO: 146 YK-VZV-039-ORF-NT

[1007]

[1008] SEQ ID NO: 147 YK-VZV-039-ORF-AA

[1009] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYGAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[1010] SEQ ID NO: 148 YK-VZV-039-mRNA

[1011]

[1012] SEQ ID NO: 149 YK-VZV-040-DNA

[1013]

[1014] SEQ ID NO: 150 YK-VZV-040-ORF-NT

[1015]

[1016] SEQ ID NO: 151 YK-VZV-040-ORF-AA

[1017] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYGAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[1018] SEQ ID NO: 152 YK-VZV-040-mRNA

[1019]

[1020] SEQ ID NO: 153 YK-VZV-041-DNA

[1021]

[1022] SEQ ID NO: 154 YK-VZV-041-ORF-NT

[1023]

[1024] SEQ ID NO: 155 YK-VZV-041-ORF-AA

[1025] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDSESTDTEEE

[1026] SEQ ID NO: 156 YK-VZV-041-mRNA

[1027]

[1028] SEQ ID NO: 157 YK-VZV-042-DNA

[1029]

[1030] SEQ ID NO: 158 YK-VZV-042-ORF-NT

[1031]

[1032] SEQ ID NO: 159 YK-VZV-042-ORF-AA

[1033] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDAEAADAEEE

[1034] SEQ ID NO: 160 YK-VZV-042-mRNA

[1035]

[1036] SEQ ID NO: 161 YK-VZV-043-DNA

[1037]

[1038] SEQ ID NO: 162 YK-VZV-043-ORF-NT

[1039]

[1040] SEQ ID NO: 163 YK-VZV-043-ORF-AA

[1041] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[1042] SEQ ID NO: 164 YK-VZV-043-mRNA

[1043]

[1044] SEQ ID NO: 165 YK-VZV-044-DNA

[1045]

[1046] SEQ ID NO: 166 YK-VZV-044-ORF-NT

[1047]

[1048] SEQ ID NO: 167 YK-VZV-044-ORF-AA

[1049] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR

[1050] SEQ ID NO: 168 YK-VZV-044-mRNA

[1051]

[1052] SEQ ID NO: 169 YK-VZV-045-DNA

[1053]

[1054] SEQ ID NO: 170 YK-VZV-045-ORF-NT

[1055]

[1056] SEQ ID NO: 171 YK-VZV-045- ORF-AA

[1057] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[1058] SEQ ID NO: 172 YK-VZV-045-mRNA

[1059]

[1060] SEQ ID NO: 173 5’ UTR

[1061] 5’AGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC3’

[1062] SEQ ID NO: 174 5’ UTR

[1063] 5’AGACTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCACCGCCACC3’

[1064] SEQ ID NO: 175 5’ UTR

[1065] 5’AGCATTCTGTGGTCTGATCATCCTGTGGTTTCGTCGCCGCCATCCTCGTCGCGACACGCTGTTTTCGGTTCTCGGCCCGACGAGCCATCGCCATCCTACAGC3’

[1066] SEQ ID NO: 176 5’ UTR

[1067] 5’AGCACTCGCGCTGCCATCACTCTTCCGCCGTCTTCGCCGCCATCCTCGGCGCGACTCGCTTCTTTCGGTTCTACCAGGTAGAGTCCGCCGCCATCCTCCACC3’

[1068] SEQ ID NO: 177 5’ UTR

[1069] 5'AGCTTGTCTCGCTCCGGGGAACGCTCGGAAACTCCCGGCCGCCGCCACCCGCGTCTGTTCTGTTACACAAGGGAAGAAAAGCCGCTGCCGCACTCCGAGTGT3’

[1070] SEQ ID NO: 178 3’ UTR

[1071] 5’gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggc3’

[1072] SEQ ID NO: 179 3' UTR

[1073] 5'GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAAAAAACATTTTTTCATTTGC3'

[1074] SEQ ID NO: 180 3' UTR

[1075] 5'TTCTGGACTTCTGGACTCTGGACTCTGGACTCTGGACTCTGGACTCTGGACTCTGGACTCTGGACTCTGGACTCTGGAC3'

[1076] SEQ ID NO: 181 3' UTR

[1077] 5'CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGACCTCGCCCCGGACCCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGC3'

[1078] SEQ ID NO: 182 S 593 ES 595 T 596 DT 598

[1079] SEQ ID NO: 183 A 593 EA 595 A 596 YES 598

[1080] SEQ ID NO: 184 A 568 YRV 571

[1081] SEQ ID NO: 185 Y 582 AGL 585 。

Claims

1. An immunogenic composition comprising varicella-zoster virus (VZV) ribonucleic acid (RNA), said RNA encoding a wild-type VZV gE glycoprotein variant; The sequence of the wild-type VZV gE glycoprotein is SEQ ID NO: 3; wherein the VZV gE glycoprotein variant is a variant selected from the group consisting of: YK-VZV-020, YK-VZV-030, YK-VZV-031, YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-012, YK-VZV-013 and YK-VZV-014, 2. The composition of claim 1, wherein the VZV gE glycoprotein variant is a variant selected from the group consisting of: YK-VZV-020, YK-VZV-010, YK-VZV-011 and YK-VZV-013, 3. The composition of claim 1, wherein the amino acid sequence of the VZV gE glycoprotein variant is shown in SEQ ID NO: 27, 31, 35, 39, 43, 47, 71, 111 or 115.

4. The composition of claim 1, wherein the VZV RNA has an open reading frame (ORF) encoding a VZV gE glycoprotein variant, and the sequence of the open reading frame is shown in SEQ ID NO: 26, 30, 34, 38, 42, 46, 70, 110 or 114. The composition of claim 1 , wherein the VZV RNA further comprises a 5′ untranslated region (UTR). 6 . The composition of claim 5 , wherein the sequence of the 5′UTR is shown in SEQ ID NO: 173, 174, 175, 176 or 177.

7. The composition of claim 1, wherein the RNA of VZV further comprises a 3' untranslated region (UTR). 8 . The composition of claim 7 , wherein the sequence of the 3′UTR is shown in SEQ ID NO: 178, 179, 180 or 181.

9. The composition of claim 1, wherein the VZV RNA further comprises a poly(A) tail.

10. The composition of claim 9, wherein the poly(A) tail has a length of 50 to 150 nucleotides.

11. The composition of claim 1, wherein the VZV RNA further comprises a 5' end cap.

12. The composition of claim 11, wherein the 5' end cap is 7mG(5')ppp(5')NlmpNp.

13. The composition of claim 4, wherein the sequence of the open reading frame is codon optimized.

14. The composition of claim 13, wherein the sequence of the open reading frame comprises at least one base modification.

15. The composition of claim 14, wherein the base modification is selected from one or more of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine.

16. The composition of claim 15, wherein the base modification is replacement of uracil with pseudouridine and / or N1-methylpseudouridine.

17. The composition of claim 14, 15 or 16, wherein the base modification is 1 to 100% base modification. The composition of claim 17 , wherein the base modification is 100% base modification.

19. The composition of claim 1, wherein the sequence of the VZV RNA is shown in SEQ ID NO: 28, 32, 36, 40, 44, 48, 72, 112 or 116.

20. The composition of claim 1, wherein the RNA of VZV is mRNA.

21. The composition of claim 1, wherein the DNA sequence corresponding to the RNA encoding the VZV gE glycoprotein is shown in SEQ ID NO: 25, 29, 33, 37, 41, 45, 69, 109 or 113.

22. A method for preparing a composition as claimed in any one of claims 1 to 21, comprising: Providing a template for transcribing the VZV RNA; The template is used for transcription under conditions suitable for transcribing the RNA.

23. The method of claim 22, further comprising a purification step selected from the group consisting of lithium chloride precipitation, affinity chromatography, ultrafiltration and cellulose chromatography.

24. The composition according to claim 1, which is a vaccine, further comprising a pharmaceutically acceptable carrier.

25. The composition of claim 24, wherein the carrier comprises a lipid mixture.

26. The composition of claim 25, wherein the lipid mixture is a lipid nanoparticle (LNP).

27. The composition of claim 24, 25 or 26, wherein the vaccine is an mRNA vaccine.

28. The composition of claim 26, wherein the lipid nanoparticles comprise cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

29. The composition of claim 28, wherein the cationic lipid is selected from the group consisting of YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA:

30. The composition of claim 28, wherein the molar ratio of the cationic lipid to the neutral lipid is (1-10):

1.

31. The composition of claim 28, wherein the molar ratio of the cationic lipid to the structural lipid is (1-5):

1.

32. The composition of claim 28, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (25-75): (5-25): (15-65): (0.5-10).

33. The composition of claim 32, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (35-49): (7.5-15): (35-55): (1-5).

34. The composition of claim 33, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer-conjugated lipid is 49:10:43.5:1.

5.

35. The composition of claim 28, wherein the neutral lipid is selected from phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, derivatives thereof, and any combination thereof.

36. The composition of claim 28, wherein the neutral lipid is selected from the group consisting of: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1-,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diamidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-acid choline, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

37. The composition of claim 28, wherein the neutral lipid is DOPE and / or DSPC.

38. The composition of claim 28, wherein the structured lipid is selected from the group consisting of sterols, cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, alpha-tocopherol, corticosteroids, and any combination thereof.

39. The composition of claim 38, wherein the structured lipid comprises cholesterol.

40. The composition of claim 39, wherein the structured lipid is cholesterol.

41. The composition of claim 28, wherein the polymer conjugated lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and any combination thereof.

42. The composition of claim 41, wherein the polymer conjugated lipid is selected from the group consisting of: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), methoxy polyethylene glycol ditetradecanoyl acetamide (ALC-0159), and any combination thereof.

43. The composition of claim 24, wherein the effective dose of the VZV RNA is 25 μg to 200 μg. The composition of claim 43 , wherein the effective dose of the VZV RNA is 50 μg to 100 μg.

45. The composition of claim 24, wherein the vaccine is an injectable.

46. ​​The composition of claim 45, wherein the vaccine is a liquid formulation or a lyophilized formulation.

47. A method for preparing a composition as claimed in any one of claims 24 to 46, comprising: The VZV RNA is mixed with the pharmaceutically acceptable carrier.

48. The method of claim 47, comprising encapsulating at least a portion of the RNA within a lipid nanoparticle.

49. Use of a composition as claimed in any one of claims 1 to 21, 24 to 46 in the preparation of a medicament for inducing a protective immune response against VZV in a subject.

50. The use of claim 49, wherein the protective immune response comprises the production of neutralizing antibodies.

51. The composition of claim 1, for use in inducing a protective immune response against VZV in a subject in need thereof.

52. The composition of claim 51, wherein the protective immune response comprises the production of neutralizing antibodies.

Images