Primer probe combination for detecting monkey pox virus and application thereof

Abstract

The invention discloses a primer probe combination for detecting monkey pox virus and application of the primer probe combination. The sequences of the primer probes are as shown in SEQ ID NO. 1 to SEQ ID NO. 9; the primer probe disclosed by the invention can be used for specifically amplifying target sequences in a middle and non-branch Clade I, a west non-branch Clade II and a middle and non-branch variant Clade Ib, and detecting corresponding pathogens; based on the primer probes, three pathogens can be detected and typed in one reaction tube by using a multiplex fluorescent PCR technology, so that the detection efficiency is improved. Various pathogen detection primers and probes are not subjected to cross reaction, and secondary structures are not formed between the primers and the probes, so that the detection efficiency and the accuracy of a detection result are ensured; the detection sensitivity is high and can reach 250 copy / ml, the specificity is high, and cross reaction with pathogens such as vaccinia, varicella and herpes viruses is avoided.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular detection, and in particular relates to a primer-probe combination for detecting monkeypox virus and an application thereof. Background Art

[0002] Monkeypox is a zoonotic disease caused by the monkeypox virus. The incubation period ranges from 5 to 21 days, usually 6 to 13 days. Clinical manifestations include polymorphic skin lesions (including papules, blisters, pustules, ulcers, and crusts), fever, and swollen lymph nodes.

[0003] Monkeypox virus (MPXV) belongs to the Poxviridae family, genus Orthopoxvirus, species Monkeypox virus. The viral genome consists of a linear, double-stranded DNA genome of approximately 197 kb. The importance of monkeypox typing lies in its ability to influence disease severity and mortality. Search results indicate that monkeypox virus (MPXV) is divided into two distinct clades: the West African clade and the Central African clade (formerly known as the Congo Basin clade). These two clades exhibit significant differences in pathogenicity and mortality. The West African clade has a case fatality rate of approximately 3%, while the Central African clade has a higher case fatality rate of approximately 10%. This difference means that viruses from different clades may require different public health response strategies and treatments.

[0004] MPXV variants are a clade of MPXV (monkeypox virus) and a subclade of the Central African clade. MPXV variants are dangerous because they can cause human infection and are generally associated with more severe disease and higher mortality rates than the West African clade.

[0005] The harm of monkeypox variants is mainly manifested in the following aspects:

[0006] 1. Infectivity: Monkeypox virus can be transmitted through close contact, including skin-to-skin, mouth-to-mouth, or mouth-to-skin contact, as well as through contaminated objects. Additionally, the virus can be transmitted through contact with contaminated objects and prolonged close inhalation of respiratory droplets from infected individuals.

[0007] 2. Clinical symptoms: After infection with monkeypox type 1b, patients may experience symptoms such as rash, fever, headache, myalgia, back pain, fatigue, and swollen lymph nodes. The rash may progress from macules, papules, herpes, pustules to scabs and may appear anywhere on the body, including the palms and soles, face, mouth and throat, groin, and genitals.

[0008] 3. Complications: Monkeypox may cause several complications, including secondary bacterial infection at the site of skin lesions, bronchopneumonia, encephalitis, corneal infection, and sepsis. Severe cases are more common in young children and immunocompromised individuals, and the prognosis is related to the infected viral clade, degree of viral exposure, preexisting health conditions, and the severity of complications.

[0009] 4. Mortality rate: The Central African branch to which the monkeypox virus variants belong generally has a higher mortality rate than the West African branch. It is reported that the mortality rate of the West African branch is about 3%, while the mortality rate of the Central African branch is about 10%.

[0010] 5. Global impact: In 2022, monkeypox cases were reported in many parts of the world, including some non-endemic countries, indicating that the spread of monkeypox virus may have exceeded its traditional endemic areas, posing new challenges to global public health.

[0011] In summary, the dangers of monkeypox virus variants lie in their infectiousness, clinical symptoms, potential complications, and high mortality rate, all of which pose a threat to public health. Therefore, the prevention and control of monkeypox virus variants is crucial.

[0012] Furthermore, understanding the branching of viruses can aid in epidemiological investigations, helping public health experts track the spread of the virus, identify possible sources of infection, and assess the severity of the outbreak and potential health risks, which is crucial for developing effective prevention and control measures. Summary of the Invention

[0013] The first aspect of the present invention aims to provide a primer-probe combination.

[0014] The second aspect of the present invention aims to provide a kit.

[0015] The third aspect of the present invention is to provide a method for preparing the above-mentioned kit.

[0016] The fourth aspect of the present invention is to use the above primer probe set or kit.

[0017] The fifth aspect of the present invention aims to provide a method for detecting and / or typing monkeypox virus.

[0018] The technical solution adopted by the present invention is:

[0019] In a first aspect of the present invention, a primer-probe combination is provided, comprising a primer-probe set for detecting at least one of a monkeypox virus variant, a monkeypox virus West African strain, and a monkeypox virus Central African strain; the primer-probe set comprises a primer pair and a probe;

[0020] The nucleotide sequences of the primer pair for detecting monkeypox virus variants are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0021] The nucleotide sequence of the probe for detecting monkeypox virus variants is shown in SEQ ID NO.3;

[0022] The nucleotide sequences of the primer pair for detecting the West African strain of monkeypox virus are shown in SEQ ID NO.4 and SEQ ID NO.5;

[0023] The nucleotide sequence of the probe for detecting the West African strain of monkeypox virus is shown in SEQ ID NO.6;

[0024] The nucleotide sequences of the primer pair for detecting non-strains of monkeypox virus are shown in SEQ ID NO.7 and SEQ ID NO.8;

[0025] The nucleotide sequence of the probe for detecting non-strain monkeypox virus is shown in SEQ ID NO.9.

[0026] Preferably, both ends of the probe are labeled with a fluorescent reporter gene and a fluorescent quencher gene, respectively.

[0027] Preferably, the 5' end of the probe is labeled with a fluorescent reporter gene, and the 3' end is labeled with a fluorescent quencher gene.

[0028] Preferably, the fluorescence reporter gene is selected from at least one of FAM, VIC, ROX, CY5, HRF705 and cy3; and the fluorescence quencher gene is selected from at least one of ddq, BHQ1, BHQ2, BHQ3, tamra and nfq.

[0029] When detecting at least two of the monkeypox virus variant strain, the monkeypox virus West African strain, and the monkeypox virus Central African strain, the fluorescent groups labeled with the probe sequences are different.

[0030] The second aspect of the present invention provides a kit, which comprises the primer probe set described in the first aspect of the present invention.

[0031] Preferably, the molar ratio of the upstream primer, the downstream primer and the probe in the primer pair is (1-3):(1-3):1.

[0032] Preferably, the kit further comprises one or more of PCR buffer, dNTP, and Taq DNA polymerase.

[0033] The third aspect of the present invention provides a method for preparing the above-mentioned kit, comprising the following steps: mixing a primer probe set, a PCR buffer, dNTPs, and a Taq DNA polymerase to obtain the kit.

[0034] In a fourth aspect, the present invention provides the use of the above-mentioned primer-probe combination and kit in detecting and / or typing monkeypox virus, wherein the monkeypox virus includes: one or more of monkeypox virus variants, monkeypox virus West African strains and monkeypox virus Central African strains.

[0035] A fifth aspect of the present invention provides a method for detecting and / or typing monkeypox virus, comprising the following steps:

[0036] (1) Extract DNA from samples;

[0037] (2) performing PCR detection on the RNA of the sample using the primer-probe set described in the first aspect of the present invention or the kit described in the second aspect of the present invention, and analyzing the detection results;

[0038] This method is not for diagnostic purposes;

[0039] The monkeypox virus includes: one or more of a monkeypox virus variant, a monkeypox virus West African strain and a monkeypox virus Central African strain.

[0040] Preferably, the reaction procedure of the PCR in step (2) is: 95°C for 2 min; 95°C for 5 s, 60°C for 15 s, for 45 cycles.

[0041] The beneficial effects of the present invention are:

[0042] The present invention designs corresponding primer-probe combinations for the G2R gene of the Central African strain (Clade I), the G2R gene of the West African strain (Clade II), and the G2R gene of the variant strain (Clade Ib) of the monkeypox virus; thereby, the target sequence can be specifically amplified and the corresponding pathogen can be detected; based on the primer-probe, multiplex fluorescence PCR technology can be used to detect and type three pathogens in a single reaction tube, thereby improving detection efficiency. There is no cross-reaction between the various pathogen detection primers and probes, and no secondary structure is formed between the primers, between the primers and probes, or between the probes, thereby ensuring detection efficiency and accuracy of the test results; the detection sensitivity can reach 250 copies / ml, the specificity is high, and there is no cross-reaction with pathogens such as cowpox, varicella, and herpes viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a sensitivity test for monkeypox virus variants; 1:1X10E7, 2:1X10E6, 3:1X10E5, 4:1X10E4, 5:1000, 6:500, 7:250copy / mL.

[0044] Figure 2 This is a monkeypox virus variant specific experiment.

[0045] Figure 3 This is a sensitivity test for the West African strain of monkeypox virus; 1:1X10E7, 2:1X10E6, 3:1X10E5, 4:1X10E4, 5:1000, 6:500, 7:250 copy / mL.

[0046] Figure 4 This is a specific test for the West African strain of monkeypox virus.

[0047] Figure 5 This is a sensitivity test for the African strain of monkeypox virus; 1:1X10E7, 2:1X10E6, 3:1X10E5, 4:1X10E4, 5:1000, 6:500, 7:250copy / mL.

[0048] Figure 6 This is a non-strain-specific assay for monkeypox virus.

[0049] Figure 7 These are the test results for a mixed sample of three pathogens: monkeypox virus variants, West African strains, and Central African strains. DETAILED DESCRIPTION

[0050] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0051] The instrument used in this embodiment is the Pangu fully automatic fluorescence PCR instrument.

[0052] Sample source: The monkeypox virus variant strain (Clade Ib) is an artificially constructed plasmid, and other samples are from the Guangzhou Customs Technical Center.

[0053] Example 1 Design of primers and probes for detecting and typing monkeypox virus

[0054] 1. This example designs corresponding primer-probe combinations for the G2R gene of the Central African strain (Clade I), the West African strain (Clade II), and the variant strain (Clade Ib) of monkeypox virus; thereby enabling specific amplification of the target sequence and detection of the corresponding pathogen.

[0055] The primer and probe sequences used to detect the monkeypox virus variant strain (Clade Ib) are:

[0056] MPXV-IB-FP: TCCGTTTGATATAGGATGTGGAC (SEQ ID NO. 1);

[0057] MPXV-IB-RP:ACTTCGAAATGGAAAAGACTTCC(SEQ ID NO.2);

[0058] MPXV-IB-P: FAM-TGGATAATGCGCCTGAATATCTAGG-BHQ1 (SEQ ID NO.3);

[0059] The primer and probe sequences used to detect the West African strain of monkeypox virus (Clade II) are:

[0060] MPXV-II-FP: AACGAATACAGAAGCCGTAATCTA (SEQ ID NO.4);

[0061] MPXV-II-RP: CACACGGTGTACATTGTGTATTAGT (SEQ ID NO.5);

[0062] MPXV-II-P: ROX-AGCGTAAGTTCCCGGAGGACACG-BHQ2 (SEQ ID NO. 6);

[0063] The primer and probe sequences used to detect the non-Clade I strain of monkeypox virus are:

[0064] MPXV-I-FP:ATGTCCAGGATAACATTTTACGG(SEQ ID NO.7)

[0065] MPXV-I-RP:GCGTGACGGAATAGTACAGTATG(SEQ ID NO.8)

[0066] MPXV-IP: CY5-TTCCCAACAATGTCAGGAACGTCA-BHQ1 (SEQ ID NO. 9).

[0067] Example 2 Kit for detecting and typing monkeypox virus

[0068] The kit includes the following components:

[0069] Primer and probe sequences for detecting monkeypox virus variant strains (Clade Ib), West African strains (Clade II), and Central African strains (Clade I); also include buffer, dNTPs, and Taq DNA polymerase;

[0070] The reaction solution reagents were prepared according to Table 1, divided into 8 tube strips and placed in an air dryer for air drying, with 20 μL per tube; and used for the detection of the samples to be tested.

[0071] Table 1

[0072] name Dosage (μL) 5× PCR buffer 5 25mM dNTP 0.2 Taq DNA polymerase (5U / μL) 0.3 MPXV-IB-FP(100μm) 0.1 MPXV-IB-RP(100μm) 0.1 MPXV-IB-P(100μm) 0.05 MPXV-II-FP(100μm) 0.1 MPXV-II-RP(100μm) 0.1 MPXV-II-P(100μm) 0.04 MPXV-I-FP(100μm) 0.12 MPXV-I-RP(100μm) 0.12 MPXV-IP(100μm) 0.05 Rehydrate to 20 μL

[0073] Example 3 A method for detecting and typing monkeypox virus

[0074] The method comprises the following steps:

[0075] 1) Mixing the reaction solution reagent with the sample to be tested and performing fluorescent PCR, wherein the reaction system is as shown in Table 2 and the reaction conditions are as shown in Table 3;

[0076] Table 2

[0077] Reaction liquid components Volume (μL) Monkeypox virus typing test reagent (air-dried) 1test(1 tube) DNA sample to be tested 20

[0078] Table 3

[0079]

[0080] 2) Fluorescence PCR instrument collects fluorescence signals.

[0081] Example 4 Sensitivity test of monkeypox virus variants

[0082] A monkeypox virus variant sample was selected and gradiently diluted to obtain monkeypox virus variant samples with concentrations of 1X10E7, 1X10E6, 1X10E5, 1X10E4, 1000, 500, and 250 copy / ml, respectively; the samples were tested by the method in Example 3, and the results are shown in FIG. Figure 1 .

[0083] pass Figure 1 It can be seen that the primer probe in Example 1 has a high sensitivity for detecting monkeypox virus variants, which can reach 250 copies / mL.

[0084] Example 5 Monkeypox virus variant specificity experiment

[0085] A monkeypox virus variant sample was selected at a concentration of 1×10E4 copy / mL, and vaccinia, varicella, and herpes virus samples were selected at a concentration of 1×10E4 copy / mL; the samples were tested using the method described in Example 1;

[0086] See the results Figure 2 ; It shows that the primer probe in Example 1 has high specificity for monkeypox virus variants and has no cross reaction with cowpox, varicella, and herpes viruses.

[0087] Example 6 Sensitivity test of monkeypox virus West African strain

[0088] A sample of the West African strain of monkeypox virus was selected and graded diluted to obtain samples of the West African strain of monkeypox virus at concentrations of 1×10E7, 1×10E6, 1×10E5, 1×10E4, 1000, 500, and 250 copy / mL, respectively. The samples were tested by the method in Example 3. The results are shown in FIG. Figure 3 .

[0089] pass Figure 3 It can be seen that the primer probe in Example 1 has a high detection sensitivity for monkeypox virus West African strain samples, which can reach 250 copies / mL.

[0090] Example 7 Monkeypox virus West African strain specificity experiment

[0091] A West African strain of monkeypox virus was selected at a concentration of 1×10E4 copy / mL, and vaccinia, varicella, and herpes virus samples were selected at a concentration of 1×10E4 copy / mL. The samples were tested using the method described in Example 1.

[0092] See the results Figure 4 ; It shows that the primer probe in Example 1 has high specificity for the West African strain of monkeypox virus and has no cross reaction with cowpox, varicella, and herpes viruses.

[0093] Example 8 Sensitivity test of monkeypox virus in non-human strains

[0094] A sample of the Central African strain of monkeypox virus was selected, and a sample of the West African strain of monkeypox virus was gradiently diluted to obtain samples of the Central African strain of monkeypox virus with concentrations of 1×10E7, 1×10E6, 1×10E5, 1×10E4, 1000, 500, and 250 copy / mL, respectively; the samples were tested by the method in Example 3, and the results are shown in FIG. Figure 3 .

[0095] pass Figure 5 It can be seen that the primer probe in Example 1 has a high detection sensitivity for non-strain samples of monkeypox virus, which can reach 250 copies / mL.

[0096] Example 9 Non-strain specific experiment in monkeypox virus

[0097] A sample of the non-strain monkeypox virus was selected at a concentration of 2×10E4 copies / mL, and samples of vaccinia, varicella, and herpes simplex virus were selected at a concentration of 2×10E4 copies / mL; the samples were tested using the method described in Example 1.

[0098] See the results Figure 6 ; This shows that the primer probe in Example 1 has high specificity for non-strains of monkeypox virus and has no cross reaction with cowpox, varicella, and herpes viruses.

[0099] Example 10 Monkeypox virus typing

[0100] Three pathogen samples, namely, monkeypox virus variant (2×10E4 copy / mL), monkeypox virus West African strain (2×10E4 copy / mL), and monkeypox virus Central African strain (2×10E4 copy / mL), were mixed and tested using the method in Example 3.

[0101] See the results Figure 7 ; It shows that three pathogens, namely, monkeypox virus variants, monkeypox virus West African strain, and monkeypox virus Central African strain, can be detected simultaneously in one reaction tube with similar concentrations, and there will be no cross-reaction between the various pathogen detection primers and probes; it can also be used for typing monkeypox virus variants, monkeypox virus West African strain, and monkeypox virus Central African strain.

[0102] The above specific embodiments provide a detailed description of the present invention. However, the present invention is not limited to the above embodiments. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with each other unless there is a conflict.

Claims

1. A primer-probe combination, comprising a primer-probe set for detecting at least one of a monkeypox virus variant, a monkeypox virus West African strain, and a monkeypox virus Central African strain; the primer-probe set comprises a primer pair and a probe; The nucleotide sequences of the primer pair for detecting monkeypox virus variants are shown in SEQ ID NO.1 and SEQ ID NO.2; The nucleotide sequences of the primer pairs for detecting the West African strain of monkeypox virus are shown in SEQ ID NO.4 and SEQ ID NO.5; The nucleotide sequences of the primer pair for detecting non-strains of monkeypox virus are shown in SEQ ID NO.7 and SEQ ID NO.

8.

2. The primer-probe combination according to claim 1, characterized in that: The nucleotide sequence of the probe for detecting monkeypox virus variants is shown in SEQ ID NO.3; the nucleotide sequence of the probe for detecting the West African strain of monkeypox virus is shown in SEQ ID NO.6; and the nucleotide sequence of the probe for detecting the Central African strain of monkeypox virus is shown in SEQ ID NO.

9.

3. The primer-probe combination according to claim 2, characterized in that: The two ends of the probe are respectively labeled with a fluorescent reporter gene and a fluorescent quencher gene; preferably, the 5' end of the probe is labeled with a fluorescent reporter gene, and the 3' end is labeled with a fluorescent quencher gene. 4 . A kit comprising the primer-probe set according to claim 1 .

5. The kit according to claim 4, characterized in that The molar ratio of the upstream primer, the downstream primer and the probe in the primer pair is (1-3):(1-3):

1.

6. The kit according to claim 4, characterized in that The kit further comprises one or more of PCR buffer, dNTP and TaqDNA polymerase.

7. The method for preparing the kit according to claim 6, comprising the following steps: The primer probe set, PCR buffer, dNTP and Taq DNA polymerase are mixed.

8. Use of the primer-probe combination according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 6 in detecting and / or typing monkeypox virus; preferably, the monkeypox virus comprises: One or more of a monkeypox virus variant, a monkeypox virus West African strain, and a monkeypox virus Central African strain.

9. A method for detecting and / or typing monkeypox virus, comprising the following steps: (1) Extract DNA from samples; (2) using the primer-probe set described in any one of claims 1 to 3 or the kit described in any one of claims 4 to 6 to perform PCR detection on the RNA of the sample, and analyzing the detection results; This method is not intended for diagnostic purposes; Preferably, the monkeypox virus comprises: One or more of a monkeypox virus variant, a monkeypox virus West African strain, and a monkeypox virus Central African strain.

10. The method according to claim 9, characterized in that The reaction procedure of the PCR in step (2) is: 95°C for 2 min; 95°C for 5 s, 60°C for 15 s, and 45 cycles.

Images