Application of str in the promoter region of rice osfd1 gene or method for targeted deletion of the str in rice molecular breeding

Abstract

The application belongs to the technical field of gene editing, and particularly relates to application of a STR in a rice OsFD1 gene promoter region or a method for targeted deletion of the STR in rice molecular breeding. Based on a deletion experiment of a CRISPR / Cas9 system and analysis of agronomic traits such as heading date and yield of the gene edited rice, it is found that the short tandem repeat in the promoter region affects the expression of the OsFD1 gene, and by deleting the sequence in the region, the heading date of the rice can be appropriately delayed, and the yield of the rice can be improved. The T1 generation homozygous mutant obtained by the application can be screened to obtain materials with excellent heading date and yield for subsequent breeding, greatly shortening the breeding period and improving the adaptability of excellent rice varieties to different regions and seasons, and having important significance for expanding the planting range of excellent varieties and improving yield, and providing a new strategy for crop breeding improvement.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to an STR in the promoter region of the rice OsFD1 gene or a method for targeted deletion of the STR and its application in rice molecular breeding. Background Art

[0002] Rice is one of humanity's most important food crops, and heading date is a key agronomic trait that influences the seasonality and regional adaptability of rice varieties. An unoptimized heading date may fail to achieve high yields or pose a high risk of abiotic stress. In breeding practice, there is a strong demand for slight to moderate adjustments to the heading date. Numerous major genes controlling rice heading date have been identified through quantitative trait locus (QTL) analysis and positional cloning of mutants. The heading date of rice is regulated by the florigen genes RFT1 and Hd3a, with two main regulatory pathways: the Hd1-Hd3a interaction pathway and the Ghd7-Ehd1-Hd3a / RFT1 pathway, centered around the early heading quantitative trait gene Ehd1.

[0003] OsFD1 is a bZIP protein that specifically recognizes genes containing the ACGT sequence. Under short-day conditions, the florigen Hd3a interacts with 14-3-3 proteins in stem apical cells, forming a complex that is transported into the nucleus. There, it binds to the transcription factor OsFD1 to form a ternary florigen activation complex (FAC), inducing the transcription of OsMADS15 and promoting flowering. Under long-day conditions, the florigen RFT1 interacts with the phosphorylated bZIP transcription factor OsFD1 through 14-3-3 proteins to form the FAC, which positively regulates the expression of the floral signature genes OsMADS14 / 15 / 18 / 34 under long-day conditions, thereby initiating the floral transition in rice under long-day conditions. Phosphorylation of serine 192 (S192) in OsFD1 is crucial for FAC formation, facilitating its entry into the nucleus and promoting the transition from vegetative to reproductive growth in rice. Within a given growth cycle, rice heading date and yield are negatively correlated: earlier heading date results in lower yield, while a prolonged heading date can also lead to yield reduction. Therefore, it is necessary to regulate the OsFD1 gene to increase rice yield and enhance its agronomic traits.

[0004] The conventional japonica rice variety Nipponbare (Nip) has good palatability, with slightly larger grains, high yield, slightly more white belly, a lustrous appearance, good resistance, excellent quality, good appearance, and a pleasant taste. However, Nip varieties grown in South China head extremely early and have poor agronomic traits, necessitating an urgent need to extend the heading period and thereby increase yield. Currently, although RNAi technology can be used to fine-tune the heading period of rice by weakening the function of the OsFD1 gene, this method, which involves genetic modification, is difficult to widely apply in rice breeding. On the other hand, while editing the coding region of the OsFD1 gene can extend the heading period, it is also associated with a series of problems, such as a prolonged booting period, darkening of the ears, and reduced yield. Therefore, there is an urgent need to develop a method to quickly produce rice varieties with a moderately delayed heading period and increased yield. Summary of the Invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide an application of STR (short tandem repeat) in the promoter region of the rice OsFD1 gene or a method for targeted deletion of the STR in rice molecular breeding.

[0006] Another object of the present invention is to provide the use of the STR in the promoter region of the rice OsFD1 gene or a method for targeted deletion of the STR in delaying the heading date of rice.

[0007] Another object of the present invention is to provide the use of the STR in the promoter region of the rice OsFD1 gene or a method for targeted deletion of the STR in increasing yield.

[0008] A fourth object of the present invention is to provide a method for delaying the heading period of rice and / or increasing yield.

[0009] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0010] A rice OsFD1 gene promoter region STR or a method for targeted deletion of the STR and its application in rice molecular breeding, wherein the STR is located in the region -159 to -139 bp upstream of the start codon of the OsFD1 gene and has a nucleotide sequence of: 5'-ACTACTACTACTACTACTACTACT-3' (as shown in SEQ ID NO. 1).

[0011] The application of the STR in the promoter region of the rice OsFD1 gene or the method for targeted deletion of the STR in delaying the heading period of rice.

[0012] The application of the STR in the promoter region of the rice OsFD1 gene or the method for targeted deletion of the STR in improving rice yield.

[0013] In the above scheme of the present invention, the method includes existing technical means and reagents used for targeted deletion of the entire sequence of the STR, such as CRISPR / Cas9 technology and reagents used in the technology (including target sequence, sgRNA, etc.), such as CRISPR / Cas12 technology and reagents used in the technology (including target sequence, etc.), such as transcription activator-like effector-mediated nuclease technology (TALE Nucleases, TALENs) and reagents used in the technology.

[0014] A method for delaying the heading period of rice and / or increasing yield, comprising the following steps:

[0015] Using CRISPR / Cas9 technology to edit the promoter region of the rice OsFD1 gene, rice mutants with delayed heading date and / or increased yield were generated;

[0016] As one of the embodiments, the target site for editing the promoter region of the rice OsFD1 gene is the STR in the promoter region of the rice OsFD1 gene;

[0017] The STR is located in the region from -159 to -139 bp upstream of the start codon of the OsFD1 gene, and its nucleotide sequence is shown in SEQ ID NO.1;

[0018] Preferably, the editing of the rice OsFD1 promoter region is to delete the entire STR sequence located at -159 to -139 bp upstream of the start codon of the rice OsFD1 gene;

[0019] Preferably, the nucleotide sequence of the promoter region of the OsFD1 gene of the rice mutant is shown in SEQ ID NO.2;

[0020] As one of the implementation schemes, the targets edited by the CRISPR / Cas9 technology are:

[0021] T1: 5'-CTGGCCACTACTACTACTAC-3' (SEQ ID NO.3);

[0022] T2: 5'-CCTCTCTCTGTGTGTTTGTG-3' (SEQ ID NO. 4).

[0023] In addition, in the above embodiment, the expression vector of CRISPR / Cas9 technology is pYLCRISPR / Cas9 vector, and its backbone vector is pCAMBIA-1300, which can be used for plant genetic transformation and obtain transgenic plants;

[0024] A method for increasing rice yield or constructing a rice mutant with increased yield using CRISPR / Cas9 technology comprises the following steps:

[0025] S1. Construction of a CRISPR / Cas9 editing vector to target and delete the STR sequence in the promoter region of the rice OsFD1 gene shown in SEQ ID NO. 1;

[0026] S2. Transfer the CRISPR / Cas9 editing vector into the recipient rice plant to be gene-edited, and cultivate and screen for T0 generation plants that have successfully deleted the STR in the promoter region;

[0027] Specifically preferably, the CRISPR / Cas9 editing vector described in step S1 contains the following targets:

[0028] T1: 5'-CTGGCCACTACTACTACTAC-3' (SEQ ID NO.3);

[0029] and T2: 5'-CCTCTCTCTGTGTGTTTGTG-3' (SEQ ID NO. 4).

[0030] Specifically, the target site is located between -165bp upstream of the start codon of OsFD1 and the -111bp promoter region;

[0031] Specifically, the recipient rice to be gene-edited is the conventional japonica rice variety Nip;

[0032] Specifically, the T0 generation plants can be further self-pollinated to obtain T1 generation homozygous mutant plants;

[0033] Principle of the present invention:

[0034] Editing cis-regulatory elements in gene promoter regions using CRISPR / Cas9 technology allows for the temporal and spatial regulation of gene expression. Promoter elements in eukaryotic genes are diverse and complexly distributed, with the functions of most remaining unknown. Unlike mutations in coding regions, which typically render genes nonfunctional, mutations in cis-regulatory regions can alter the levels and patterns of gene expression. This novel breeding approach offers the potential for altering plant traits, enabling precision breeding by adjusting gene expression characteristics.

[0035] The present invention utilizes CRISPR-Cas9 technology to edit the STRs in the promoter region of the rice OsFD1 gene, located between -159 and -139 bp upstream of the start codon. Two gRNAs were designed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ), and a CRISPR / Cas9 gene-editing vector containing these two gRNA targets was constructed. The vector was then introduced into the plants to be edited. T0 plants with promoter STR deletions were screened for one round of self-pollination, and the phenotype of homozygous mutant T1 plants was evaluated. Plants with promoter STR deletion exhibited a slight delay in heading time and significantly increased grain weight per plant.

[0036] The present invention has the following advantages and effects compared to the prior art:

[0037] (1) The present invention is based on a deletion experiment of the CRISPR / Cas9 system and an analysis of the heading period and yield of gene-edited rice. It was found that by site-directed deletion of the STR in the promoter region of the gene, i.e., the region shown in SEQ ID NO.1, the heading period of rice can be appropriately prolonged while the yield of rice can be increased, which has very important applications in agricultural production.

[0038] (2) The T1 generation homozygous mutants obtained by the present invention can be used to screen materials with excellent heading period and yield for subsequent breeding, which greatly shortens the breeding period and improves the adaptability of excellent rice varieties to different regions and seasons. It is of great significance to expand the planting range of excellent varieties and increase yield, and provides a new strategy for crop breeding and improvement.

[0039] (3) The present invention provides a new "northern japonica rice southward migration" breeding method for expanding the ecological adaptability of existing excellent japonica rice varieties and cultivating high-quality japonica rice varieties suitable for cultivation in low-latitude areas.

[0040] (4) The present invention provides an efficient breeding method for creating rice varieties, germplasm resources, and hybrid rice parents with long growth periods based on the rice OsFD1 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] 图1 It is a schematic diagram of the rice OsFD1 gene structure, the insertion position of the knockout vector, and the nucleotide sequence of the mutant and wild-type OsFD1 gene target sequences in the transformed and regenerated rice lines. Nip is a wild plant, "-" indicates a sequence with a deletion mutation, and "+" indicates a sequence with an insertion mutation. The figure also shows the sequencing results of the mutant and wild-type lines.

[0042] 图2 Figure 4 is a comparative result analysis diagram of the expression amount of the OsFD1 gene of the homozygous mutant ED strain and the control strain on 4-5 mm and 8-9 mm young panicles.

[0043] 图3 Figure 5 is a comparative result analysis diagram of the heading date (HD) and grain weight per plant (GWP) yield of two homozygous mutant ED strains and the control strain, wherein a: heading date, b: grain weight per plant yield.

[0044] 图4 Figure 6 is a comparative result analysis diagram of the whole plant phenotype, main ear phenotype and single plant yield of the homozygous mutant ED strain and the control strain WT, wherein a: whole plant phenotype, b: main ear phenotype, c: single plant yield. DETAILED DESCRIPTION

[0045] The application will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the embodiments of the application are not limited thereto.

[0046] Unless otherwise specified, the reagents, materials, methods and equipment used in the application are conventional reagents, methods and equipment in the technical field.

[0047] The primer sequences involved in the embodiments are shown in Table 1:

[0048] Table 1

[0049]

[0050]

[0051] Example 1 Construction of Promoter Editing Vector

[0052] The promoter sequence of Nipponbare OsFD1 (Os09g0540800) in the CRISPR-GE (http: / / skl.scau.edu.cn / ) database was obtained, and the 1000bp promoter upstream of the start codon of OsFD1 was located at chr9:21291025-chr9:21292024. The specific sequence is as follows:

[0053] ATAATTCGTATTTTCATTGTTGTTAAATGATAAAACATGATTAATATTTTATGCATGACTTGTCTTTTTAATTTTTTTCATAATTTTTTTAAATAAGACGAACGGTCAAATGTTGGGCACGGAAACAGGGGTTTGTCTTTTTCTAAGACAGAGGGAGTATGCCAGAGTCTTAAATTTGGAGTTAAACAGGTCATACTCATGATCAACTATTTCTAAACCAAACCTTTACCATTATGTCACATGTCCACAACTAAACCTAGACAAGCTTACTAGTCATCAACTAAACATTACGAGGTGCCAAGGAGGAGGGCCACACCCAAGCACTACCAGCAGCAGCAGGAGGAGGCAGCTGCATCAGCACTTCAGTAGGGCATGTCCGATTGGATTGGAGGCGCCCAAGGCCTGGTTTAGTTCCCAACTTTTTCTTCAAACTTCTAATATTTTTATCATATATCAAAATTTTTCTACACACAAACTTCTAGCTCTTTCATCATATTGTTTTAATTTTAATTAAACTTTTAATTTTAGCGTGAATTAAACACACCCGAGACAACAATTTGACCGGCCATCGTGGGCTCTCGCTGGACGCTACTCCAGTCAACAGTGGTCAGTCGGTGTTTGTGTCACTGCTGCACAGTGAACAGTTGGGCCCTCCACACACGCCGCAGTGACGACAACACGAGCCATGCACACGCGTCAACCCCACATTGGCCCCCACTCGGATGACCAGTGAGCAACCCAGTGTGCTGCCAGGTGGGGCCCACTCACAGTCACAGCCGCTCAGCTCAGCTACTGAATAAAACCAACTCGCCAAGCAAAGCGAGGAGGCGACCCA CTGG CCACTACTACTACTAC TACTACTATTTCCT CCTCTCTCTGTGTGTTTGTG TCACACTCACGCTGAGCTTGCGAGCTTGCTTGCTCAAAAGAGGTAAAGAAACCGACCGCGAGGAGGTCTCGTCGGCCGGCGTGCGGCGGCGGCGGCGGCGGCGAGGGTGAT

[0054] Note: The underlined parts are target sites T1 and T2; the gray shading parts are STR.

[0055] The construction methods of the pYLCRISPR / Cas9 vector and pYLsgRNA-OsU6a and pYLsgRNA-OsU6b vectors (plasmids) used below are consistent with the vector construction method disclosed in the article "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants".

[0056] 1. Target selection

[0057] According to the STR position of the promoter region, two targets were designed through the CRISPR-GE website (http: / / skl.scau.edu.cn / ). Targets T1 and T2 were grouped together and constructed on the pYLCRISPR / Cas9 vector (the vector backbone was pCAMBIA-1300) and named editing vector I (pCas9 / OsFD1-ED). 图1 The target sequences are shown below:

[0058] Target T1 (SEQ ID NO. 3): 5′-CTGGCCACTACTACTACTAC-3′;

[0059] Target T2 (SEQ ID NO. 4): 5′-CCTCTCTCTGTGTGTTTGTG-3′;

[0060] The primer sequences were designed based on the target site T1. The primer sequences are as follows:

[0061] OsFD1-qdzT1-F (SEQ ID NO.5): 5'-TAGTAGTAGTAGTGGCCAGgtttcagagctagaaat-3';

[0062] OsFD1-qdzT1-R (SEQ ID NO.6): 5'-CTGGCCACTACTACTACTACggcagccaagccagca-3';

[0063] The primer sequences were designed based on the target site T2. The primer sequences are as follows:

[0064] OsFD1-qdzT2-F (SEQ ID NO.7): 5'-CACAAACACACAGAGAGAGGgtttcagagctagaaat-3';

[0065] OsFD1-qdzT2-R (SEQ ID NO.8): 5'-CCTCTCTCTGTGTGTTTGTGCaacacaagcggcagc-3';

[0066] Note: For primers T1 and T2, lowercase letters represent the terminal homologous recombination sequences cut from the pYLCRISPR / Cas9 vector, so that the pYLCRISPR / Cas9 vector and the rice OsFD1 gene sequence can be successfully connected using homologous recombination method in the future.

[0067] 2. Amplification and Ligation of sgRNA Expression Cassettes

[0068] 1) First-round PCR: The first-round PCR reaction was performed using the reaction primers UF, OsFD1-qdzT#-F, OsFD1-qdzT#-R (# indicates the corresponding target site number), and gR-R. T1 used OsU6a as the promoter, and T2 used OsU6b as the promoter. Each sgRNA expression cassette was divided into two PCR reactions. The reaction system was: 2× Phanta Max Buffer 7.5 μL, 10 mM dNTPs Mix 0.25 μL, Phanta Max Polymerase 0.2 U, pYLsgRNA-OsU6a / OsU6b 3 ng, 10 μM primer UF and adapter reverse primer OsFD1-qdzT#-R 0.3 μL each (reaction 1) or 10 μM adapter forward primer OsFD1-qdzT#-F and gR-R 0.3 μL each (reaction 2), and ddH2O was added to 15 μL. The PCR reaction program was: pre-denaturation at 95°C for 1 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 10 s, for a total of 20 cycles.

[0069] The amplified sequence of T1 reaction 1 is (SEQ ID NO.9):

[0070] CTCCGTTTTACCTGTGGAATCG GCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCAATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATT CGTCAGGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGG TGCTGGCTTGGCTGCCGTAGTAGTAGTAGTGGCCAG

[0071] Note: The underlined part is the primer UF and the adapter reverse primer OsFD1-qdzT1-R; the gray shading part is the partial sequence of the primer Pps-R;

[0072] The amplified sequence of T1 reaction 2 is (SEQ ID NO.10):

[0073] TAGTAGTAGTAGTGGCCAGGTTTCAGAGCTAGAAAT AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGA GTGGATGGAATTTTCCTCCG

[0074] Note: The underlined part is the adapter forward primer OsFD1-qdzT1-F and primer gR-R; the gray shading part is the partial sequence of primer Pgs-2;

[0075] The amplified sequence of T2 reaction 1 is (SEQ ID NO.11):

[0076] CTCCGTTTTACCTGTGGAATCG GCAGCAAAGGATGCAAGAACGAACTAAGCCGGACAAAAAAAAAAGGAGCACATATACAAACCGGTTTTATTCATGAATGGTCACGATGGATGATGGGGCTCAGACTTGAGCTACGAGGCCGCAGGCGAGAAGCCTAGTGTGCTCTCTGCTTGTTTGGGCCGT AACGGAGGATACGGCCGACGAGCGTGTACTACCGCGCGGGATGCCGCTGGGCGCTGCGGGGGCCGTTGGATGGGGATCGGTGGGTCGGGAGCGTTGAGGGGAGACAGGTTTAGTACCACCTCGCCTACCGAACAATGAAGAACCCACCTTATAACCCCGCGC GCTGCCGCTTGTGTTGCACAAACACAC AGAGAGAGG

[0077] Note: The underlined part is the primer UF and the adapter reverse primer OsFD1-qdzT2-R; the gray shading part is the partial sequence of the primer Pps-2;

[0078] The amplified sequence of T2 reaction 2 is (SEQ ID NO.12):

[0079] CACAAACACACAGAGAGAGGGTTTCAGAGCTAGAAAT AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGA GTGGATGGAATTTTCCTCCG

[0080] Note: The underlined part is the adapter forward primer OsFD1-qdzT2-F and primer gR-R; the gray shading part is the partial sequence of primer Pgs-L;

[0081] 2) Second round of PCR: Dilute the first round PCR reaction solution 10-fold. The specific method is as follows: add 1 μL of the products of reaction 1 and reaction 2 of target site T1 or T2 in the first round of PCR to 8 μL of ddH2O, mix and dilute 10-fold, and take 1 μL as template. The specific system of the second round of PCR reaction is as follows: template 1 μL, 2×Phanta Max Buffer 15 μL, 10mM dNTPs Mix 0.5 μL, Phanta Max Polymerase 0.4U, 0.5μL of the second-round universal PCR primers mixed at 10μM (T1 was a mixture of Pps-R and Pgs-2, and T2 was a mixture of Pps-2 and Pgs-L), and ddH2O was added to 30μL; the PCR reaction procedure was: 95℃ pre-denaturation for 1min; 95℃ denaturation for 15s, 58℃ annealing for 15s, and 72℃ extension for 10s, 25 cycles, and the sgRNA expression cassettes of T1 and T2 were obtained through the second round of PCR.

[0082] 3) The sgRNA expression cassette obtained in step 2) was subjected to a simultaneous enzyme digestion and ligation reaction with the pYLCRISPR / Cas9 vector using a variable temperature cycle. The reaction system was as shown in Table 2, and the reaction procedure was as follows: enzyme digestion at 37°C for 5 min, annealing at 10°C for 5 min, and ligation at 20°C for 5 min, for a total of 10 to 15 cycles; and finally, incubation at 37°C for 5 min.

[0083] Table 2 Enzyme digestion and ligation reaction system

[0084]

[0085] 3. Conversion of ligation products (electroporation)

[0086] The ligation product obtained in step 2 was dropped onto a Millipore VSWP04700 suspension dialysis membrane (0.025 μm pore size) and desalted by dialyzing with 0.2x TE for 15–30 min (preferably in a 4°C refrigerator). 1 μL of the dialyzed, desalted ligation product was electroporated into E. coli DH10B electrocompetent cells (purchased from Weidi Biotechnology Co., Ltd.). After electroporation, 1 mL of SOC medium was added and incubated at 37°C for 1 h. Plates were then plated using LB supplemented with 25 μg / mL Kan (kanamycin), 0.3–0.5 mM IPTG, and an appropriate amount of X-gal. The cells were incubated overnight at 37°C in a constant temperature incubator until positive colonies developed blue plaques. The negative selection marker gene ccdB in the empty plasmid produces a toxic protein that kills E. coli.

[0087] 4. Positive clone screening

[0088] Several blue colonies were selected for expansion and PCR amplification using detection primers SP-L1 and SP-R. After the target band appeared on electrophoresis, the clones were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing verification. After successful verification, the editing vector I (pCas9 / OsFD1-ED) was obtained and the plasmid was extracted. The positive monoclonal bacterial suspension and plasmid were sent to Wuhan Aidijing Biotechnology Co., Ltd. for transfer into Agrobacterium tumefaciens EHA105 and Agrobacterium transformation. Successful pCas9 / OsFD1-ED-transformed Agrobacterium and successful infection of japonica rice Nip seedlings with the positive Agrobacterium were obtained.

[0089] Example 2 Obtaining STR-Edited Plants in the Promoter Region

[0090] 1. Phenotypic screening of offspring of plants with STR editing in the OsFD1 promoter region

[0091] The obtained japonica rice Nip seedlings (T0 generation) that were successfully infected with Agrobacterium were planted and self-pollinated to obtain T1 generation plants. Total DNA from the leaves of T1 plants was extracted and amplified by PCR using primers OsFD1-F and OsFD1-R. The DNA was then sequenced and identified. A homozygous mutant with STR knockout in the OsFD1 gene promoter region was selected and named ED. Compared with the wild type, the OsFD1 gene promoter region of this mutant was missing 34 bp, and the STR region was successfully knocked out ( 图1 ).

[0092] The nucleotide sequences amplified by primers OsFD1-F and OsFD1-R are shown below:

[0093] ATAATTCGTATTTTCATTGTTGTTAAATGATAAAACATGATTAATATTTTATGCATGACTTGTCTTTTT AATTTTTTTCATAATTTTTTTAAATAAGACGAACGGTCAAATGTTGGGCACGGAAACAGGGGTTTGTCTTTTTCTAA GACAGAGGGAGTATGCCAGAGTCTTAAATTTGGAGTTAAACAGGTCATACTCATGATCAACTATTTCTAAACCAAAC CTTTACCATTATGTCACATGTCCACAACTAAACCTAGACAAGCTTACTAGTCATCAACTAAACATTACGAGGTGCCA AGGAGGAGGGCCACACCCAAGCACTACCAGCAGCAGCAGGAGGAGGCAGCTGCATCAGCACTTCAGTAGGGCATGTC CGATTGGATTGGAGGCGCCCAAGGCCTGGTTTAGTTCCCAACTTTTTCTTCAAACTTCTAATATTTTTATCATATAT CAAAATTTTTCTACACACAAACTTCTAGCTCTTTCATCATATTGTTTTAATTTTAATTAAACTTTTAATTTTAGCGT GAATTAAACACACCCGAGACAACAATTTGACCGGCCATCGTGGGCTCTCGCTGGACGCTACTCCAGTCAACAGTGGT CAGTCGGTGTTTGTGTCACTGCTGCACAGTGAACAGTTGGGCCCTCCACACACGCCGCAGTGACGACAACACGAGCC ATGCACACGCGTCAACCCCACATTGGCCCCCACTCGGATGACCAGTGAGCAACCCAGTGTGCTGCCAGGTGGGGCCC ACTCACAGTCACAGCCGCTCAGCTCAGCTACTGAATAAAACCAACTCGCCAAGCAAAGCGAGGAGGCGACCCACTGC TCTCTGTGTGTTTGTGTCACACTCACGCTGAGCTTGCGAGCTTGCTTGCTCAAAAGAGGTAAAGAAACCGACCGCGA GGAGGTCTCGTCGGCCGGCGTGCGGCGGCGGCGGCGGCGGCGAGGGTGAT ATGGCGATGGAGGACGACGAGGACATGTGGGCGAACACGAGCAGCCCCAGCGCGTCGCCGCCGCGGCCGAGGGGGTTCATCTCCACCGCGCTGAGCCTCAACTCGACGCACCTCCAAGGCCTCCTCCCGTCGTCCTCGTCGACGCCGCCGCCTCGCCGTGCCACGCCAGCGGCAACAACAACGGCGGCGGCGACGGCCGCAATGCCGCGCCGATGTCGTCCATCTCTTCGCCT

[0094] Note: The gray shading part is the primers OsFD1-F and OsFD1-R, and the underlined part is the nucleotide sequence of the promoter region of the OsFD1 gene of the rice mutant ED (SEQ ID NO. 2).

[0095] 2. Gene Expression Detection in OsFD1 Promoter-Edited Lines

[0096] The 4-5 mm and 8-9 mm young ears of the homozygous mutant ED of Nip were taken, RNA was extracted and reverse transcribed into cDNA, and UFC was used as the internal reference gene (primers UFC-qRT-F and UFC-qRT-R). The expression level of OsFD1 was detected using primers OsFD1-qRT-F and OsFD1-qRT-R (Table 1). The qRT-PCR reaction system was as follows: 10 μL of 2× ChamQ Universal SYBR qPCR Master Mix, 0.4 μL of primer OsFD1-qRT-F (10 μM), 0.4 μL of primer OsFD1-qRT-R (10 μM), 1 μL of diluted cDNA, and ddH2O to 20 μL. The reaction procedure was as follows: pre-denaturation at 95°C for 30 s, 40 cycles of 95°C for 10 s, and 60°C for 30 s, followed by generation of a melting curve at 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s.

[0097] qRT-PCR test results are as follows 图2 As shown, the expression level of OsFD1 in the 4-5 mm spikelets of the homozygous mutant ED plants was significantly lower than that of the wild type, decreasing by about 10.91%. The expression level of OsFD1 in the 8-9 mm spikelets of the homozygous mutant ED plants was extremely significantly lower than that of the wild type, decreasing by about 51.74%.

[0098] Example 3 Study on agronomic traits of rice heading period and rice yield

[0099] 1. The homozygous mutant ED from Example 2 was planted in a test field at the South China Agricultural University Experimental Base in Guangzhou, Guangdong Province. Wild-type japonica rice Nip and ED were also used as controls. Irrigation and fertilization were applied under natural light. Fifty plants were planted per line, with 10 plants per row.

[0100] 2. The heading date (HD) and grain weight per plant (GWP) of the homozygous mutant ED and the wild-type control strain Nip were investigated under natural long-day conditions. GWP refers to the weight of the whole grain after threshing and removing the empty husks.

[0101] 3. The above agronomic traits of the plants located in the middle of each row in each line were investigated, and significance analysis was performed using two-tailed Student's ttest.

[0102] The rice heading time is calculated from the date of rice sowing until the first rice panicle emerges. The wild type and homozygous mutant ED were grown in a test field under natural long-day conditions. The phenotypic and statistical data of the wild type and OsFD1 mutant were analyzed at the heading time on the 56th day after germination. It was found that the heading time of the homozygous mutant ED was significantly delayed under natural long-day conditions compared with the wild type ( 图3-图4 ), indicating that OsFD1 may promote the heading time of rice. While the heading period was delayed, the grain weight per plant of the homozygous mutant ED was significantly increased compared with the wild-type plants ( 图3-4 ).

[0103] It can be seen that through the method provided by the present invention, after STR editing in the promoter region of the OsFD1 gene of Nip, its growth period can be significantly extended under long-day conditions. By selecting the STR in the promoter region of the OsFD1 gene for deletion, the STR is located in the region -159 to -139 bp upstream of the start codon, Nip rice materials with extended growth period and increased yield can be quickly obtained. The present invention can provide an efficient gene knockout method and breeding method for breeding japonica rice varieties that adapt to different ecological conditions in low-latitude areas.

[0104] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A targeted deletion rice OsFD1 The application of the STR method of gene promoter region in rice molecular breeding is characterized by: The STR is located at OsFD1 The region from -159 to -139 bp upstream of the gene start codon, the nucleotide sequence of the STR is shown in SEQ ID NO. 1; The application is to delay the heading period of rice or increase rice yield.

2. A targeted deletion rice OsFD1 The application of the STR method of gene promoter region in delaying the heading period of rice is characterized by: The STR is located at OsFD1 The nucleotide sequence of the STR in the region from -159 to -139 bp upstream of the gene start codon is shown in SEQ ID NO.

1.

3. A targeted deletion rice OsFD1 The application of the STR method of gene promoter region in increasing rice yield is characterized by: The STR is located at OsFD1 The nucleotide sequence of the STR in the region from -159 to -139 bp upstream of the gene start codon is shown in SEQ ID NO.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The method includes CRISPR / Cas9 technology and reagents used in the technology, CRISPR / Cas12 technology and reagents used in the technology, or transcription activator-like effector-mediated nuclease technology and reagents used in the technology.

5. A method for delaying the heading period of rice or increasing yield, characterized in that The following steps are included: Editing rice using CRISPR / Cas9 technology OsFD1 gene promoter region, thereby obtaining rice mutants with delayed heading date and increased yield; The edited rice OsFD1 The target gene promoter region is rice OsFD1 STRs in gene promoter regions; The STR is located at OsFD1 The nucleotide sequence of the STR in the region from -159 to -139 bp upstream of the gene start codon is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that: The rice mutant OsFD1 The nucleotide sequence of the gene promoter region is shown in SEQ ID NO.

2.

7. The method according to claim 5, characterized in that: The targets edited by the CRISPR / Cas9 technology are T1 and T2. The nucleotide sequences of T1 and T2 are as follows: T1: 5'-CTGGCCACTACTACTACTAC-3'; T2: 5'-CCTCTCTCTGTGTGTTTGTG-3'.

8. The method according to claim 5, characterized in that: The expression vector of the CRISPR / Cas9 technology is a pYLCRISPR / Cas9 vector.

9. A method for increasing rice yield or constructing a rice mutant with increased yield using CRISPR / Cas9 technology, comprising the following steps: S1. Construction of a CRISPR / Cas9 editing vector to target and delete the rice gene shown in SEQ ID NO.1 OsFD1 STR sequence of the gene promoter region; S2. Transfer the CRISPR / Cas9 editing vector into the recipient rice plant to be gene-edited, and cultivate and screen for T0 generation plants with successful STR deletion in the promoter region.

10. The method according to claim 9, characterized in that: The recipient rice to be gene-edited is the conventional japonica rice variety Nip.

Images