Specific primers for detecting pestalosphaeria theae and application thereof
By designing specific primers Ppos2F and Ppos2R for PCR amplification and electrophoretic separation, the problem of early identification and monitoring of tea leaf spot pathogens has been solved, achieving rapid, low-cost, and specific detection, which is suitable for early diagnosis and field monitoring of tea leaf spot.
Patent Information
- Application Number
- CN202410582758.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-11
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-05-11
AI Technical Summary
Existing technologies lack effective means for rapid and low-cost identification and monitoring of tea leaf spot pathogens, especially in the early stages, making it difficult to determine the timing of prevention and control.
We designed and applied specific primers Ppos2F and Ppos2R for PCR amplification, followed by electrophoretic separation, to achieve specific detection of *Pteris multifiliis*.
It enables early diagnosis and monitoring of tea leaf spot pathogens, and is characterized by high specificity, speed, low cost, and good stability, making it suitable for field testing.
Smart Images

Figure CN118272572B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of agricultural biology and crop disease detection, identification, and control technology, specifically relating to specific primers for detecting *Tea spores* and their applications. Background Technology
[0002] Tea grey blight is one of the most serious fungal diseases affecting the leaves of tea plants. In the Hefeng area of Hubei Province, this disease is mainly caused by the plant pathogen *Tea spores* (*Tea grey blight*). Pseudopestalotiopsis theae Caused by [unclear text - possibly a fungus name], according to the latest classification system, its asexual form belongs to the deuteromycetes. This disease mainly affects the tips, edges, or other parts of mature and old leaves of tea trees, as well as young leaves and shoots, causing extensive leaf drop and shoot dieback, leading to weakened tree vigor and a significant decrease in yield, often reaching 10% to 50%. Tea leaf spot disease has been reported in East African countries such as India, Sri Lanka, Japan, and Kenya, with yield losses exceeding 50%, or even total crop failure, severely impacting tea production and quality and hindering the steady development of the tea industry.
[0003] Tea leaf spot pathogen ( Pseudopestalotiopsis theae ), tea gray mold ( Botrytis cineria ) and Alternaria tea-leaved bacteria ( Alternaria altanata All of these can cause leaf spot disease in tea. Early symptoms of leaf spot disease caused by *Tea discoidella* are quite similar to those caused by other fungi. To distinguish between different fungi, identification can only be made by observing whether fruiting bodies develop on the lesions in later stages or by tissue isolation of the pathogen.
[0004] However, using traditional morphology to differentiate the pathogens is labor-intensive, costly, time-consuming, and impractical. Furthermore, observing the morphology of lesions in the late stages of disease can easily lead to missing the optimal control period. Therefore, there is still a lack of effective means to identify and monitor tea leaf spot pathogens. Summary of the Invention
[0005] To address the lack of effective means for identifying and monitoring leaf spot pathogens in tea, the present invention aims to provide a specific primer for detecting *Tea spores*.
[0006] Another object of the present invention is to provide applications of the above primers.
[0007] Another object of the present invention is to provide a method for detecting *Tea discus*.
[0008] Specific primers for detecting *Pseudomonas aeruginosa* according to specific embodiments of the present invention include Ppos2R and Ppos2F.
[0009] SEQ ID NO. 1 (Ppos2F): 5'-AAGACGCCAGCACGAGAAC-3';
[0010] SEQ ID NO. 2 (Ppos2R): 5'-CCCTTGGTGCGTATCAGTT-3'.
[0011] The application provides application of the specific primer for detecting Pestalotiopsis theae, and in particular, application in early diagnosis of tea annular spot disease, Pestalotiopsis theae monitoring and identification, etc.
[0012] According to the method for detecting Pestalotiopsis theae provided in the embodiment of the application, the method comprises the process of performing PCR on the to-be-tested object by using the specific primer.
[0013] Table 1 Strain number, host information, collection site and time used in the application
[0014]
[0015] According to the method for detecting Pestalotiopsis theae provided in the embodiment of the application, the method comprises the following steps:
[0016] (1) extracting genomic DNA of the to-be-tested object;
[0017] (2) performing PCR amplification on the DNA extracted in step (1) by using the specific primer;
[0018] (3) performing electrophoresis separation on the amplification product obtained in step (2), and if a 473bp band is obtained, it is determined that the to-be-tested object contains Pestalotiopsis theae.
[0019] According to the method for detecting Pestalotiopsis theae provided in the embodiment of the application, in step (2), the reaction system of PCR amplification is as follows: Taq PCR Master Mix 12.5 μl, specific primer 1 μl, template DNA 1 μl, ddH2O 9.5 μl, and the total volume of the reaction is 25 μl, and the specific table is shown below.
[0020]
[0021] According to the method for detecting Pestalotiopsis theae provided in the embodiment of the application, in step (2), the reaction conditions of PCR amplification are as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 1 min, 27 cycles; extension at 72℃ for 5 min; and cooling to 16℃ for 5 min.
[0022] The method for detecting Pestalosphaeria sp. on tea according to the specific embodiment of the present application, in step (3), the amplified product is subjected to electrophoretic separation with 1.0% agarose gel, specifically, 3.0 μL of the PCR amplified product is subjected to electrophoretic separation, if a band of 473 bp is amplified, it is judged that the to-be-tested substance contains Pestalosphaeria sp. (Pseudopestalotiopsis theae) .
[0023] The present application has the following beneficial effects:
[0024] The present application obtains a specific fragment of Pestalosphaeria sp. according to a RAPD marker, acquires the sequence of the specific fragment through TA cloning, then designs, optimizes and selects an amplification primer pair to obtain a specific primer sequence Ppos2F / R, and uses the primer pair to amplify and sequence the target fragment.
[0025] The specific primer of the present application can detect 0.04 ng of Pestalosphaeria sp. DNA, can specifically distinguish Pestalosphaeria sp. from other fungal species on tea, and can be directly applied to field detection. The specific primer of the present application has the advantages of strong specificity, short detection time, good stability, wide applicability, simplicity, rapidness, low cost and the like, and can be effectively used for early diagnosis of tea Pestalosphaeria sp., and monitoring and identification of Pestalosphaeria sp.
[0026] The present application further provides a method for rapidly detecting Pestalosphaeria sp., and the specific steps are extracting DNA of a to-be-tested substance, amplifying by PCR, detecting the amplified product by gel electrophoresis, and judging whether the sample contains Pestalosphaeria sp. or not, the judgment method being: if a single amplified band of 473 bp appears in the electrophoretic result, it is indicated that the to-be-tested substance contains Pestalosphaeria sp. BRIEF DESCRIPTION OF DRAWINGS
[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.
[0028] Figure 1 The DNA extraction results of Pestalosphaeria sp. Ps. theae ), Botrytis cinerea on tea ( B. cineria ) and Mycosphaerella tashiroi on tea ( A. altanata ) are shown, M=DL15000 DNA marker (Takara);
[0029] Figure 2 The RAPD primer is shown to amplify Pestalosphaeria sp. Ps. theae ), Botrytis cinerea on tea ( B. ) and Mycosphaerella tashiroi on tea (cineria ) and tea chain cell (Streptomyces sp. A. altanata ) produced polymorphic DNA fragments; lane M: DNA marker;
[0030] Figure 3 The primer Ppos1F / R, Ppos2F / R respectively detects Ps. theae 、 B. cineria and A. altanata The case is shown.
[0031] Figure 4 The effect of different concentrations of DNA samples of strain WH2 on Ps. theae specific primer PCR amplification is shown. Ps. theae M=DL1000 DNA marker (Takara); C+ contains 40 ng of sample DNA in the system as a positive control, C- does not add any sample DNA as a blank control. DETAILED DESCRIPTION
[0032] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme of the present application will be described in detail below. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of the present application.
[0033] Example 1 Extraction of fungal DNA
[0034] The mycelium blocks of tea leaf alternaria (Alternaria alternata) Ps. theae ), tea leaf botrytis (Botrytis cinerea) B. cineria ) and tea chain cell (Streptomyces sp. A. altanata ) were inoculated on PDA medium covered with sterile glass paper, and after 2 days, the mycelium was collected. The Omega fungal DNA extraction kit was used to extract fungal genomic DNA, and the DNA quality was detected by 0.8% agarose gel electrophoresis, and the DNA concentration was detected by Nanodrop nucleic acid detector.
[0035] As shown in Figure 1 , the electrophoresis results show that the DNA quality is good, and the DNA concentration determination results show that the DNA concentrations of 2 Ps. theae strains, 2 B. cineria strains and 1 A. altanata strain are 143.9 ng / μL, 147.5 ng / μL, 67.6 ng / μL, 181.8 ng / μL and 84.6 ng / μL, respectively.
[0036] Example 2 RAPD amplification of different fungi
[0037] SCAR marker of Pestalotiopsis theae was obtained by RAPD technology. Ps. theae Among them, the RAPD primer can amplify specific bands, as shown in the figure, the fragments indicated by "*" were recovered, TA cloned and sequenced, and specific primers were designed according to the sequence to screen primers that can specifically and stably amplify Pestalotiopsis theae. Ps. theae Figure 2 Pseudopestalotiopsis theae
[0038] Example 3 Design of Pestalotiopsis theae specific primer
[0039] According to the RAPD amplification results of Pestalotiopsis theae, Ps. theae Botrytis cinerea and Mycosphaerella tassiana, B. cineria specific bands A and B were isolated and recovered, and TA cloning and sequencing were performed on the two bands. According to the measured sequence, specific primers were designed for specific and sensitive PCR amplification, and finally the primers with better sensitivity were selected for subsequent experiments. The nucleotide sequence (473 bp) of the target sequence selected is as follows: A. altanata
[0040] AAGACGCCAGCACGAGAACAGCGTGTCCGCTATAGGTAATTTGTTCAGGGGCAGAGCTGAACCCAGGCCAAGCTATTAGGCGTTTAATTTTAAGGTTAGATCGGATCGTCGCTCGGGCTGCCCCAGTGCCATGATGTAGTTTTCGTCCTTGTTGAAGAGAATCACTACATAGTAGCAGCTCGGTTCGCAGTAGATTAATTTTTTTATCATGTCGCTTGGAATCACTTACTTTCTCTTCATTGATATGTTCGTTGTGACTTCAAAGATGCTCTGTGCTTTAGCCCCCAAGATATTGTCGATTGGCACCTTTTGTTGTATCGGAGTGACGAGGGTTTTAGATTGAACTCAACACAATTGTCGGTCATTGACATGTCAATTCGACTGCAGGTCTCAGCCAACCGGAATTCGTAAATATGATGGAATGGAAGTTCCAAACAGGAAAACTTTTCCAAGCAACTGATACGCACCAAGGG.
[0041] According to the sequencing result, 31 random primers (see Table 2) were designed to amplify the genomic DNA of different pathogenic bacteria on tea leaves (see Table 1). According to the gel electrophoresis results of the amplified bands, the specific band of P. panniculata was the clearest and most stable, which was the desired RAPD primer Figure 2 . Finally, RAPD primer R4 was selected, and the specific fragment of P. panniculata was recovered. The specific sequence is shown in SEQ ID NO: 1, and the amplification primer pair Ppos2F / R was designed:
[0042] Table 2 RAPD primer number and sequence
[0043]
[0044] Table 3 Specific primer sequence designed for Pseudocercospora vitis (Pseudocercospora theae) Ps. theae
[0045] Primer Sequence (5'→3') Fragment size Ppos2FPpos2R F: 5'-AAGACGCCAGCACGAGAAC-3' R: 5'-CCCTTGGTGCGTATCAGTT-3' 473 bp
[0046] Using the primers in Table 3 for PCR amplification, a pair of specific primers was finally selected, which could amplify the DNA of Pseudocercospora theae, but not the DNA of Botrytis cinerea and Mycosphaerella tefispora.
[0047] Example 4 Investigation of the specificity of the primer
[0048] Using the primers, 5 strains of 3 genera in Table 1 were detected. The DNA of the 5 strains was extracted, and the DNA concentration was adjusted to 40 ng / μL for primer specificity test. The primer sequences are as follows:
[0049]
[0050] The reaction conditions for PCR amplification were as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1 min, 32 cycles; 72℃ extension for 5 min; cooling to 16℃ for 5 min.
[0051] The results are shown in Figure 3 . Using primers Ppos2F / R, only the DNA of 2 strains of Pseudocercospora theae Ps. theae was amplified, and the DNA of other strains of B. cinerea and A. alternata was not amplified, which indicated that the primers could be used for specific detection of Pseudocercospora theae. The amplification results of primers ITS1 / 4 confirmed the reliability of the test.
[0052] Example 5 Investigation of the sensitivity of the primer
[0053] The selectedPs. theae For strain WH2, seven 25 μL PCR reaction systems were set up, with template DNA amounts of 0, 0.04, 0.4, 0.8, 4.0, 20.0, and 40.0 ng in each system, respectively. The amounts of other components in the system were the same as in conventional PCR.
[0054] The C+ system contained 40 ng of sample DNA and served as a positive control, while the C- system contained no sample DNA and served as a blank control.
[0055] The PCR amplification reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1 min, 27 cycles; 72℃ extension for 5 min; and cooling to 16℃ and holding for 5 min.
[0056] The PCR products were also detected by 1% agarose gel electrophoresis.
[0057] like Figure 4 As shown, the amount of template DNA from strain WH2 directly affects the primer amplification results. As the amount of template DNA gradually decreases in each reaction, from 40 ng to 0.04 ng, the amplification results show... Ps. theae The DNA markers also gradually faded. PCR detection Ps. theae At all DNA concentrations, the sensitivity of primer Ppos2F / R was 40 pg per reaction. However, compared with primer ITS1 / 4, primer Ppos2F / R had better sensitivity. At all DNA concentrations, the amplification product band of primer Ppos2F / R was brighter than that of the control primer ITS1 / 4. This indicates that primer Ppos2F / R has better specificity and sensitivity and is suitable for the specific molecular detection of *Tetranychus pyrenoidosa*.
[0058] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A method for detecting *Tea chamaedorea*, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the sample; (2) PCR amplification of the DNA extracted in step (1) was performed using specific primers; The specific primers are: SEQ ID NO.1: 5'-AAGACGCCAGCAGAGAAC-3'; SEQ ID NO.2: 5'-CCCTTGGTGCGTATCAGTT–3'; (3) Perform electrophoretic separation on the amplification product obtained in step (2). If a band of 473bp is obtained, it is determined that the analyte contains *Tea discus polychaete*.
2. The method for detecting *Tea spores* according to claim 1, characterized in that, In step (2), the PCR amplification reaction system is as follows: 12.5 μl Taq PCR Master Mix, 1 μl each of specific primers, 1 μl template DNA, 9.5 μl ddH2O, and the total reaction volume is 25 μl.
3. The method for detecting *Tea discus* according to claim 1, characterized in that, In step (2), the PCR amplification reaction conditions are: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1 min, 27 cycles; 72℃ extension for 5 min; and cooling to 16℃ and holding for 5 min.
4. The method for detecting *Tea chamaedorea* according to claim 1, characterized in that, In step (3), the amplification products are separated by electrophoresis using a 1.0% agarose gel.
Citation Information
Patent Citations
Carmine spider mite SCAR (sequence characterized amplified region) mark and specificity PCR (polymerase chain reaction) detection method thereof
CN102181551A