Application of rice OsNAL12 gene in regulating high temperature resistance of rice

By identifying and regulating the OsNAL12 gene, the high-temperature resistance of rice was regulated using the CRISPR/Cas9 system, solving the problem of insufficient high-temperature resistance in rice in existing technologies, and realizing the improvement or reduction of rice's survival ability under high-temperature conditions.

CN118291522BActive Publication Date: 2025-11-07HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410448458.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-15
Publication Date
2025-11-07
Estimated Expiration
2044-04-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the high-temperature resistance of rice, thus affecting its yield and stability.

Method used

By identifying and cloning the OsNAL12 gene, the heat resistance of rice can be regulated. The CRISPR/Cas9 system can be used to knock out or overexpress the OsNAL12 gene to regulate the heat resistance of rice, thereby improving or weakening its heat resistance.

Benefits of technology

Significantly improve or weaken the high-temperature resistance of rice, cultivate new varieties that are resistant to or sensitive to high temperatures, and enhance or weaken the survival ability of rice under high-temperature stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004791815400000011
    Figure HDA0004791815400000011
  • Figure HDA0004791815400000012
    Figure HDA0004791815400000012
  • Figure HDA0004791815400000021
    Figure HDA0004791815400000021
Patent Text Reader

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically involving OsNAL12 Application of a gene in regulating heat resistance in rice. This invention identifies a gene that regulates heat resistance in rice. OsNAL12 The aforementioned OsNAL12 The protein encoded by the gene is shown in SEQ ID NO.2. Analysis of its heat resistance phenotype using mutant materials confirmed that it is a gene that positively regulates rice heat resistance, demonstrating its function and application value in regulating rice heat resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to application of an OsNAL12 gene in regulating high-temperature resistance of rice. The present application identifies a gene OsNAL12 for regulating high-temperature resistance of rice. By constructing a mutant material of the gene and analyzing a high-temperature resistance phenotype, it is proved that the gene is a positive gene for regulating high-temperature resistance of rice, and the function and application value of the gene in regulating high-temperature resistance of rice are also proved. BACKGROUND

[0002] Plants are affected by many environmental factors during growth, and abiotic stress can lead to large-scale yield reduction of crops, affecting China's food security. Breeding stress-tolerant crop varieties has been one of the main goals of agricultural science and technology research. In order to resist or adapt to these adverse factors, plants sense changes in extracellular environmental conditions and transmit them to the cell through various pathways, inducing the expression of some response genes, producing some functional proteins and osmotic adjustment substances to protect cells from stress damage and adapt to adverse growth environments (Xiong et al. Cell signaling during cold, drought and salt stress. Plant Cell. 14(suppl), S165-S183, 2002). Previous studies have found that transgenic rice plants using SNAC1 can increase the seed setting rate by about 30% under field drought conditions, while the yield is not affected under normal conditions and there is no other phenotypic change. The transgenic plants also have significantly improved resistance to drought and high salt during the vegetative growth period (Hu et al. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc Natl Acad Sci U S A, 2006, 103: 12987-12992). In recent years, some genes with application prospects for salt resistance in rice have been identified, such as a salt-induced OsSIRP2 gene, which can target OsTKL1 for degradation through the ubiquitination degradation pathway, and it was also found that overexpression of the OsSIRP2 gene in transgenic plants enhances salt tolerance (Chapagain et al. Oryza sativa salt-induced RING E3 ligase 2 (OsSIRP2) acts as a positive regulator of transketolase in plant response to salinity and osmotic stress. Planta, 2018, 247: 925-939).A rice heat-tolerance gene was identified by forward genetics, named heat tolerance 3 (TT3), which is composed of two genes TT3.1 and TT3.2. When rice is under heat stress, the plasma membrane-localized E3 ubiquitin ligase TT3.1 translocates to the endosome, ubiquitinates the chloroplast precursor protein TT3.2 and mediates its degradation, indicating that TT3.1 may act as a potential temperature sensor in breeding practice (Zhang et al. A genetic module at one locus in rice protects chloroplasts to enhance thermotolerance. Science, 2022, 376, 1293-1300).

[0003] Rice is an important food crop and model organism. In today's world where extreme weather conditions occur frequently, it is of great scientific significance to increase rice reserves by improving rice stress resistance to cope with yield reduction caused by adverse weather, and it is also the cornerstone of social stability.

[0004] The OsNAL12 involved in the present application is a new gene for regulating rice stress resistance, and is a positive regulator of rice heat resistance, which has functions and application values in regulating rice heat resistance. SUMMARY

[0005] The present application provides the application of OsNAL12 gene in rice in controlling rice heat resistance, and the protein encoded by the OsNAL12 gene is shown as SEQ ID NO. 2.

[0006] The present application provides the application of OsNAL12 gene in rice in creating heat-tolerant rice, and the protein encoded by the OsNAL12 gene is shown as SEQ ID NO. 2.

[0007] In order to achieve the above purpose, the present application adopts the following technical measures:

[0008] The present application locates, identifies and clones an OsNAL12 gene by leaf width GWAS, and the deletion of the gene causes the heat resistance of rice to be weakened under high temperature stress, and the overexpression of the fragment causes the heat resistance of rice to be enhanced under high temperature stress. The protein encoded by the OsNAL12 gene is shown as SEQ ID NO. 2.

[0009] The protection scope of the present application includes:

[0010] The application of OsNAL12 gene in rice in controlling rice heat resistance, and the protein encoded by the OsNAL12 gene is shown as SEQ ID NO. 2;

[0011] The application is specifically as follows:

[0012] Increasing the expression amount of OsNAL12 gene in rice to improve the high temperature resistance of rice;

[0013] The increasing method includes introducing a substance that increases the expression amount of OsNAL12 gene in rice into rice.

[0014] In the application, the substance is preferably a nucleic acid molecule containing OsNAL12 gene, an expression frame thereof, a recombinant vector, or a recombinant microorganism.

[0015] Decreasing the expression amount of OsNAL12 gene in rice to weaken the high temperature resistance of rice.

[0016] Knocking out, inhibiting, or silencing OsNAL12 gene in rice to weaken the high temperature resistance of rice.

[0017] In the application, the knockout is preferably performed by using a CRISPR / Cas9 system, and the target site of gRNA in the system is: CCGCCGCCGTCGTCGCCGGT.

[0018] In the application, the obtained rice after the knockout contains a gene shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0019] The OsNAL12 gene is shown in SEQ ID NO. 1.

[0020] Compared with the prior art, the application has the following advantages:

[0021] The applicant first discloses that OsNAL12 gene in rice is related to the high temperature resistance of rice, and the gene can be transformed into various plants including rice to cultivate new varieties of high temperature resistant plants.

[0022] The application will be further described below in combination with the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 OsNAL12 CRISPR mutant gene editing of rice;

[0024] osnal12-1 and osnal12-14 are two OsNAL12 CRISPR mutant homozygous Cas9 families.

[0025] Figure 2 High temperature stress phenotype of rice osnal12 CRISPR mutant hydroponic seedling stage

[0026] osnal12-1, osnal12-14 are two OsNAL12 CRISPR mutant lines homozygous without Cas9, Zhonghua 11 (ZH11) as control.

[0027] Figure 3 High temperature stress phenotype of rice OsNAL12 overexpression transgenic rice in hydroponic seedling stage

[0028] osnal12-1, osnal12-14 are two OsNAL12 overexpression transgenic rice, Zhonghua 11 (ZH11) as control. DETAILED DESCRIPTION

[0029] The following examples define the present application and describe the methods of constructing osnal12 CRISPR mutant, OsNAL12 overexpression transgenic rice, cloning DNA fragments containing the complete coding segment of OsNAL12 gene, and verifying the function of OsNAL12 gene. Based on the following description and these examples, those skilled in the art can determine the essential characteristics of the present application, and can make various changes and modifications to the present application without departing from the spirit and scope of the present application, so as to make it suitable for different uses and conditions.

[0030] The technical solutions described in the present application are all conventional solutions in the art unless otherwise specified, and the reagents or materials described are all from commercial channels unless otherwise specified.

[0031] Example 1: Construction of osnal12 CRISPR mutant and OsNAL12 overexpression transgenic rice

[0032] The gene sequence of OsNAL12 gene is obtained from the rice gene database Rice Data (http: / / www.ricedata.cn / gene / ), as shown in SEQ ID NO. 1, and the encoded protein is shown in SEQ ID NO. 2. According to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), a target site is selected. The vector construction of CRISPR mutant lines can refer to the related literature (Xie Kabin et al. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. PNAS. 2015, 112:3570-3575.), which is not described in detail due to the limited space. The target site selected in the CRISPR-P v2.0 website is as follows:

[0033] Target site 1: CCGCCGCCGTCGTCGCCGGT

[0034] The constructed CRISPR vector OsCRKD1-CRISPR was introduced into rice variety Zhonghua 11 by Agrobacterium-mediated rice genetic transformation method, and the transgenic plants were obtained through pre-culture, infection, co-culture, selection of hygromycin-resistant callus, differentiation, rooting, seedling, transplanting. The above-mentioned Agrobacterium-mediated rice (Zhonghua 11) genetic transformation method (system) was improved on the basis of the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994).

[0035] According to the above-mentioned gene editing target site, the primers were designed to detect the editing of the OsNAL12 gene in the mutant. The OsNAL12 gene was specifically amplified by primers (OsNAL12-CR-F: 5'-ACGAGAGCCTAATTAAGGC-3' and OsNAL12-CR-R: 5'-AGTCGAACGGGTCCTTCCT-3'), and the amplified PCR product was sequenced to detect whether it contained Cas9. The sequencing results showed that in the osnal12-1 CRISPR homozygous Cas9-free mutant family, 2 bases were deleted in the OsNAL12 gene (the sequence after mutation is shown in SEQ ID NO. 3), and in the osnal12-14 CRISPR homozygous Cas9-free mutant family, 47 bases were deleted in the OsNAL12 gene at the target site (the sequence after mutation is shown in SEQ ID NO. 4) Figure 1 OsNAL12 gene in the two mutant families was mutated.

[0036] The gene sequence of OsNAL12 was obtained from the rice gene database Rice Data (http: / / www.ricedata.cn / gene / ). The primers OE-NAL12-F (5'-GGGGTACCATGAGCCACTACACAATGCATG-3') and OE-NAL12-R (5'-ATTTGCGGCCGCTCACAGGTGTCCTCGGATCCACAG-3') were designed to amplify the gene sequence of rice OsNAL12. The amplified fragment was digested by KPN1 and NOT1 and then ligated to the overexpression vector pCAMBIA1301U (a commonly used plasmid (vector), UBQ10 drives the expression of the target gene, and the HA tag is fused to the target gene). Finally, the correctly sequenced vector was electroporated into the Agrobacterium competent cell EHA105, and the positive clones were detected. The transformation process was the same as the method of mutant genetic transformation.

[0037] The proteins of the overexpression plants grown for 12 days were extracted, and the signal of the fused HA tag in the target gene expression protein was detected by WB experiment. It was found that the protein expression level of OsNAL12 in OE-6 and OE-15 lines was significantly increased compared with wild type ZH11 Figure 1 B) in the middle.

[0038] Example 2: Identification of rice osnal12 CRISPR mutant hydroponic seedling stage high temperature stress phenotype

[0039] The homozygous mutant (osnal12) and Zhonghua 11 (ZH11) with identified genotypes were germinated and then spotted on a 96-well PCR plate. The mature rice seeds were evenly scattered in a round culture dish and labeled, and water was added to immerse the seeds, which were cultured in the dark at 28°C. After 2-3 days, the rice seeds were transferred to a 96-well PCR plate with a bottom. A black box with appropriate size was used to place the PCR plate and fill it with water, and the culture was performed at 30°C. The experiment was repeated 3 times.

[0040] Healthy growing 4-leaf stage plants were subjected to 45°C high temperature stress for 2-3 days, followed by 30°C recovery for 5-7 days. Photographs were taken and the survival rate of the plants was investigated. Compared with ZH11 control, the CRISPR homozygous mutant plants showed a high temperature sensitive phenotype Figure 2 ).

[0041] Example 3: Identification of rice OsNAL12 overexpression transgenic rice hydroponic seedling stage high temperature stress phenotype

[0042] The identified OsNAL12 overexpressing transgenic rice and Zhonghua 11 (ZH11) were germinated and then sown on 96-well PCR plates. Mature rice seeds were evenly scattered in round culture dishes and labeled, then submerged in water and cultured in the dark at 28℃. After 2-3 days, when the rice seeds showed signs of sprouting, they were transferred to 96-well PCR plates with the bottom removed. The PCR plates were placed in appropriately sized black boxes filled with water and cultured at 30℃. The experiment was repeated three times. Healthy plants at the 4-leaf stage were subjected to 45℃ high-temperature stress for 2-3 days, followed by recovery at 30℃ for 5-7 days. Photographs were taken and plant survival rates were assessed. Compared to the ZH11 control, the overexpressing transgenic rice plants exhibited a high-temperature tolerance phenotype. Figure 3 ).

Claims

1. In rice OsNAL12 The application of genes in controlling rice's resistance to high temperatures, as described above OsNAL12 The gene encodes the protein shown in SEQ ID NO.2, and its application process includes improving the quality of rice. OsNAL12 The expression level of genes can be used to improve the heat resistance of rice.

2. Use according to claim 1, characterized in that, The methods of improvement include increasing the content of rice. OsNAL12 Substances that increase gene expression levels are introduced into rice.

3. Use according to claim 2, characterized in that, The substance is a nucleic acid molecule comprising OsNAL12 a nucleic acid molecule of a gene, or an expression cassette thereof, a recombinant vector, a recombinant microorganism.

4. Use according to claim 1, characterized in that, The OsNAL12 OsNAL12 The gene is shown as SEQ ID NO. 1.

Citation Information

Patent Citations

  • Rice root regulation function and application of E3 ubiquitin ligase gene OsPIW

    CN104774853A

  • Application of rice gene OsNAL12 in regulation and control of rice grain shape and improvement of thousand grain weight

    CN116286893A