Primer set for identifying alternative splicing isoforms of Ganoderma lucidum laccase Gllac7 gene and its application

Abstract

The present invention discloses a primer set for identifying alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene and its application. The primer set comprises Aslac7_1 and Aslac7_2. The present invention uses the Ganoderma lucidum cDNA to be identified as a template, uses the Aslac7_1 and Aslac7_2 primer sets to amplify, judges whether Gllac7 has alternative splicing according to the Ct value, and judges whether Gllac7 has alternative splicing according to 2 Ct差值 Determine the expression ratio of splicing isoforms. The primer set provided by the present invention has the advantages of high amplification efficiency, good stability, and high sensitivity. The method of the present invention is simple and easy to use, shortens the identification time and simplifies the identification steps, and has high accuracy. It is applicable to the study of alternative splicing of the Gllac7 gene in Ganoderma lucidum under different culture conditions.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a primer set suitable for identifying alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene and an application thereof. Background Art

[0002] Alternative splicing of genes refers to the process by which mRNA is converted from precursors to mature mRNA, through different splicing modes (selecting different splice site combinations), resulting in different mRNA splice isoforms, which are ultimately translated into different proteins. Alternative splicing is an important mechanism for regulating gene expression and generating proteomic diversity. The identification of alternative splicing is generally performed using transcriptome data or full-length transcript data and relevant data analysis software. This process requires the use of a server and experience or ability in big data analysis, which places high demands on the operator.

[0003] Real-time quantitative PCR (qPCR) uses primers designed to specific sequences to detect the expression of target genes in a template. The effectiveness of qPCR analysis depends largely on primer design. Therefore, designing primers with high specificity, high amplification efficiency, high sensitivity, and good stability for gene expression detection is of great significance.

[0004] The Ganoderma lucidum laccase gene, Gllac7, undergoes alternative splicing, resulting in two splice isoforms, Gllac7.1 and Gllac7.2. These two splice isoforms differ only in their 5' regions, with Gllac7.2 containing 441 bases more than Gllac7.1. Because the majority of their sequences are identical, full-length transcript data are currently required for effective identification of Gllac7.1 and Gllac7.2. However, obtaining full-length transcript data is time-consuming, expensive, and challenging to analyze. Therefore, developing primers for qPCR identification of Gllac7.1 and Gllac7.2 is of great importance. Summary of the Invention

[0005] The purpose of the present invention is to screen a primer set suitable for identifying alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene, wherein the primer set includes Aslac7_1 and Aslac7_2; the primer set Aslac7_1 includes two pairs of primers, the sequences of which are as follows:

[0006] 7.2_1F:CCGCTTCATTCACTTCCATTCT(SEQ ID NO.1);

[0007] 7.2_1R:CAATGTAGGAGAGCAACGACTG(SEQ ID NO.2);

[0008] 7_F:GTCGTTGCTCTCCTACATTGC(SEQ ID NO.3);

[0009] 7_R:CATCGTGTGGTTCGTCATCTG(SEQ ID NO.4);

[0010] The primer set Aslac7_2 comprises two pairs of primers, the sequences of which are as follows:

[0011] 7.2_2F:GCTAGTAGGATCCGCTGCTCAG(SEQ ID NO.5);

[0012] 7.2_2R:GAGGACGAGATGGTCTTGGTAG(SEQ ID NO.6);

[0013] 7_F:GTCGTTGCTCTCCTACATTGC(SEQ ID NO.3);

[0014] 7_R:CATCGTGTGGTTCGTCATCTG(SEQ ID NO.4);

[0015] Among them, 7_F / R in the primer sets Aslac7_1 and Aslac7_2 are the same.

[0016] The present invention also provides a kit comprising the above primer sets Aslac7_1 and Aslac7_2.

[0017] The present invention also provides the use of the primer set or kit in identifying alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene.

[0018] Furthermore, the Ganoderma lucidum laccase Gllac7 gene (article source: Gllac7 is induced by agricultural and forestry residues and exhibits allelic expression bias in Ganoderma lucidum) has two alternative splicing isoforms, Gllac7.1 and Gllac7.2. The nucleotide sequence of Gllac7.1 is shown in SEQ ID NO.7, and the nucleotide sequence of Gllac7.2 is shown in SEQ ID NO.8.

[0019] >Gllac7.1

[0020]

[0021] >Gllac7.2

[0022] ATGACGCCAACGCCGCCATCCAGGTCCCAGATGGAAGGATTCCATCACTTTCTCCAAGGGTATCTCCCACCGGTTCCGACGCACATCCATCCAGCGGGACTTCGACGTCGTCCACTGACGCTCAACGCGCCGCGCAAGCAACGTTTCGGGACGTCTGCTGCGCCGAAAGAAGCTCTCACGCGTACTGCAAGACTCACGCGACGACCGCCTTTCAGGGCCAACGGCATTCAATGGGGTCCAGCGCCATGGCCGTACTGGCTAGTA

[0023] GGATCGCTGCTCAGCCAACATCGGCGACCGGCAGACATACCCGCTTCATTCACTTCCATTCTACTCT

[0024] CTGGCGCGCCGGCTTCGGTGGAGGGGTATAAAGGTCGGGCTACCAAGACCATCTCGTCCTCATCCG

[0025] AAGTCGCATTCGAATCTTCAGAGCCCCCTTCACCTTTCATCCCAATGGCCAGGTTCCAGTCGTTGCT

[0026] CTCCTACATTGCCCTTCTTTTCGCCGCCTCAGCGTACGCAGGCATCGGGCCCACGACCGACCTCACC

[0027] ATTTCGAATGCGAACATCTCTCCCGATGGCTTCACTCGTGCTGCCGTCGTGGTCAATGGTGTCTTCC

[0028] CCGGGCCTCTGATTACAGGGAACCAGGGTGACCGCTTCCAACTCAATGTCATCGACCAGATGACGA

[0029] ACCACACGATGTTGAAGACCACCAGCATCCACTGGCACGGCTTCTTCCAAAAGGGCACGAACTGG

[0030] GCAGACGGCCCGGCTTTCGTCAATCAGTGCCCGATTGCCAGCGGAAACTCGTTCCTGTACGACTTC

[0031] CAAGTCCCCGACCAGTCCGGTACCTACTGGTATCACAGCCATCTCTCCACTCAGTACTGCGATGGCC

[0032] TCAGGGGCCCCTTCGTGGTGTATGACCCCAACGACCCGCACCAGAGTCTCTACGACGTCGACGATG

[0033] ATACGACGGTGATTACCTTGGCCGATTGGTACCACACGGCCGCCAGGCTTGGGCCACGCTTCCCGCT

[0034] CGGGTCGGATTCGACTCTCATCAACGGTCTGGGCCGCAGCACCGAGACTCCCACAGCTAGCCTCGC

[0035] CGTTATCAGCGTCACCCAGGGCAAGCGCTACCGCTTCCGCCTGATCTCGCTGTCGTGCGACCCCAA

[0036] CTACGTGTTCAGCATTGATGGTCATGACTTGACAGTCATTGAGGCGGACGGCATCGAGACCGAGCC

[0037] TGTCACCGTCAACGCCATCCAGATCTTCTCGGCTCAGCGTTACTCGTTCGTGCTCACTGCAAACCAG

[0038] ACCATCGACAACTACTGGGTCCGGGCCAACCCGAACTTTGGTAACGTCGGTTTCACGGATGGCATC

[0039] AACTCCGCCATCCTGCGCTACGACACCGCGGACCCGATCGAGCCCGTGACGACTCAACAAACGAC

[0040] GCAGAACCTGCTCCTGGAGACCGACCTCCACCCTCTTGTGCCAAGAGCCATGCCCGGCAACCCCAC

[0041] TCAGGGAGGTGTCGACAAGGCTATCAACTTCGTCTTCAACTTCAACGGCACCAACTTCTTCATCAA

[0042] CAACGAGTCCTTCTCCCCGCCCACCGTGCCCGTCCTCCTCCAGATCCTGAGCGGCGCCCAGACCGC

[0043] CCAGGACCTCCTGCCGTCCGGGAGCGTCTACGAGCTCCCCATCAACTCCTCCATCGAGCTCACCTTC

[0044] CCCGCCACGGCCAACGCCCCCGGCGCTCCTCATCCGTTCCATCTTCACGGTCACGCCTTCGCCGTCG

[0045] TCCGCAGCGCCGGCTCGACCGTCTACAACTACGACAACCCCGTCTGGCGCGACGTCGTCTCCACCG

[0046] GAACCCCCGCCGCGGGCGACAACGTGACGATCCGCTTCGAGACCAACAACCCCGGCCCGTGGTTC

[0047] CTCCACTGCCACATCGACTTCCACCTCGAGGCCGGCTTCGCCGTCGTCATGGCCGAGGACTCGCCC

[0048] GAGGCGAGCGCGGCGAACCCCGTGCCGCAGGCGTGGTCGGACCTCTGCCCGACGTACAACGCGCTCTCCCGATGACCAGTGA.

[0049] The present invention also provides a method for detecting alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene, comprising the following steps:

[0050] (1) Collect Ganoderma lucidum mycelium, extract RNA, and reverse transcribe it into cDNA;

[0051] (2) The above-mentioned cDNA was amplified by qPCR using the primer sets Aslac7_1 and Aslac7_2, respectively, and the presence of Gllac7.1 and Gllac7.2 splicing isoforms was determined by the Ct value; gapdh was used as an internal reference to calculate the expression ratio of Gllac7.1 and Gllac7.2.

[0052] Furthermore, the qPCR amplification reaction system is as follows: 10 μL of 2×ChamQ Universal SYBR qPCR MasterMix, 0.4 μL of each of 10 μmol / L forward and reverse primers, 8.2 μL of double-distilled water, and 1 μL of cDNA; the reaction procedure is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 3 s, annealing at 60°C for 32 s, and extension at 72°C for 30 s, for 40 cycles.

[0053] Furthermore, the detection primers for the internal reference gapdh are:

[0054] F:5'-GGTGCCAAGAAGGTGGTCAT-3'; R:5'-CGAGAGGAGCCAGACAGTTG-3'.

[0055] The present invention has the following beneficial effects:

[0056] The primer sets Aslac7_1 and Aslac7_2 developed in the present invention can quickly identify whether the Ganoderma lucidum laccase Gllac7 gene has alternative splicing and detect the expression ratio of different splicing isoforms. The developed primers have the advantages of high amplification efficiency, good stability, and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 The melting curves of the corresponding primer amplifications are shown in Figure 7. In the figure, 7 represents the primer pair 7_F / R; 7.2_1 represents the primer pair 7.2_1F / R; and 7.2_2 represents the primer pair 7.2_2F / R.

[0058] Figure 2 Agarose gel electrophoresis of the amplified products using the corresponding primers. In the figure, 7 represents the primer pair 7_F / R; 7.2_1 represents the primer pair 7.2_1F / R; and 7.2_2 represents the primer pair 7.2_2F / R.

[0059] Figure 3 The primer set Aslac7_1 was used to detect the expression levels of Gllac7.1 and Gllac7.2 isoforms of Ganoderma lucidum strain GL0102 under different carbon sources.

[0060] Figure 4The primer set Aslac7_2 was used to detect the expression levels of Gllac7.1 and Gllac7.2 isoforms of Ganoderma lucidum strain GL0102 under different carbon sources. DETAILED DESCRIPTION

[0061] In order to make the above-mentioned purpose of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are further described in detail below in conjunction with specific examples, but the protection scope of the present invention is not limited to the following examples.

[0062] Example 1

[0063] 1. Primer design: Primers for simultaneous amplification of Gllac7.1 and Gllac7.2 were designed based on the consensus sequences of Gllac7.1 and Gllac7.2 of Ganoderma lucidum strain GL0102 (the same as the new Ganoderma lucidum variety 'Ganoderma 102' from Fujian Agriculture and Forestry University). Primers for single amplification of Gllac7.2 were designed based on the unique sequence of Gllac7.2.

[0064] 2. Primer selection: Gllac7.1 and Gllac7.2 cDNA full-length fragments were obtained by amplification of Ganoderma lucidum mycelium cDNA. After gel extraction and purification, the fragments were serially diluted 10-fold as templates for subsequent qPCR amplification. The primers for simultaneous amplification of Gllac7.1 and Gllac7.2 used the full-length cDNA of Gllac7.1 as template, and the primers for amplification of Gllac7.2 alone used the full-length cDNA of Gllac7.2 as template. According to the melting curve ( Figure 1 ), amplification efficiency (Table 1), detection limit (Table 1), detection accuracy (Table 2) and other indicators to screen out the optimal primer set.

[0065] The information of the primer sets screened is shown in Table 1. The agarose gel electrophoresis of the primer amplification products is shown in Table 1. Figure 2 .

[0066] Table 1 Primer information

[0067]

[0068] 3. Determination of the detection limit of primers:

[0069] The full-length cDNA fragments of Gllac7.1 and Gllac7.2 were tested for their initial concentrations, and then serially diluted 10-fold as templates for subsequent qPCR amplification. The changes in Ct values ​​were observed. When the Ct value no longer increased with the increase in template concentration, this concentration was the lowest detection concentration of the target primers. The results showed that the detection limit of each primer was 9×10 －7ng / μL (Table 1). When the detection limit was reached, the corresponding Ct value for each primer pair was 33. Therefore, in qPCR experiments, when the amplification Ct value of 7.2_1F / R or 7.2_2F / R was greater than 33, it was considered that the Gllac7.2 splice isoform was not present in the template. When the amplification Ct value of 7_F / R was greater than 33, it was considered that the Gllac7 gene was not expressed or expressed at very low levels in the template, and the presence and expression of the Gllac7.1 and Gllac7.2 splice isoforms could not be determined.

[0070] 4. Primer detection accuracy verification:

[0071] 1) Prepare the full-length cDNA fragments of Gllac7.1 and Gllac7.2 at different molar concentration ratios as templates for subsequent reactions: 1:1, 1:2, 1:5, 1:10, 1:20, 2:1, 5:1, 10:1, and 20:1;

[0072] 2) performing qPCR amplification on the above templates using the primer sets Aslac7_1 and Aslac7_2 of the present invention in Table 1;

[0073] 3) The reaction system was as follows: 10 μL of 2× ChamQ Universal SYBR qPCR Master Mix, 0.4 μL of each 10 μmol / L forward and reverse primer, 8.2 μL of double-distilled water, and 1 μL of cDNA. The reaction procedure was as follows: 95°C initial denaturation for 3 min; 40 cycles of denaturation at 95°C for 3 s, annealing at 60°C for 32 s, and extension at 72°C for 30 s.

[0074] 4) According to 2 (7.2_1Ct-7Ct) and 2 (7.2_2Ct-7Ct) The ratio of Glac7.1 to Glac7.2 in the template was calculated.

[0075] 5) The amplification results of templates with different ratios are shown in Table 2. The initial template ratios calculated after amplification with the two primer sets were close to the expected ratios.

[0076] Table 2 Accuracy test results

[0077]

[0078] Example 2

[0079] Primer set application: cDNA from Ganoderma lucidum mycelium cultured with different carbon sources was used as a template for amplification. The presence of Gllac7.1 and Gllac7.2 splicing isoforms was determined based on the Ct value, and the expression levels of Gllac7.1 and Gllac7.2 were calculated using gapdh as an internal reference. The specific process is as follows:

[0080] 1) Ganoderma lucidum strain GL0102 was cultured on four different carbon source media: glucose, lignin, bagasse, and oak wood chips for 5 days;

[0081] 2) Collect mycelia, extract RNA, and reverse transcribe it into cDNA;

[0082] 3) The cDNA was amplified using primer sets Aslac7_1 and Aslac7_2, respectively. The Ct values ​​of the 7_F / R primer pair in all four samples were less than 23, and the Ct values ​​of the 7.2_1F / R and 7.2_2F / R primer pairs in all four samples were less than 29, confirming the presence of both Gllac7.1 and Gllac7.2 splicing isoforms in all four samples.

[0083] 4) Using gapdh (F: 5'-GGTGCCAAGAAGGTGGTCAT-3', R: 5'-CGAGAGGAGCCAGACAGTTG-3') as an internal reference, the expression ratio of Gllac7.1 and Gllac7.2 was calculated;

[0084] 5) The results are as follows Figure 3 and Figure 4 As shown: The expression ratios of Gllac7.1 and Gllac7.2 calculated by the primer sets Aslac7_1 and Aslac7_2 were relatively close: when cultured on the four carbon sources, the expression level of Gllac7.1 was higher than that of Gllac7.2; when cultured on the medium with glucose as the carbon source, the ratio of Gllac7.1:Gllac7.2 was the lowest; when cultured on the medium with lignin as the carbon source, the ratio of Gllac7.1:Gllac7.2 was the highest.

[0085] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer set for identifying alternatively spliced ​​isoforms of the Ganoderma lucidum laccase Gllac7 gene, characterized in that: The primer set includes Aslac7_1 and Aslac7_2; the primer set Aslac7_1 includes two pairs of primers, the sequences of which are as follows: 7.2_1F:CCGCTTCATTCACTTCCATTCT; 7.2_1R:CAATGTAGGAGAGCAACGACTG; 7_F:GTCGTTGCTCTCCTACATTGC; 7_R:CATCGTGTGGTTCGTCATCTG; The primer set Aslac7_2 comprises two pairs of primers, the sequences of which are as follows: 7.2_2F:GCTAGTAGGATCCGCTGCTCAG; 7.2_2R:GAGGACGAGATGGTCTTGGTAG; 7_F:GTCGTTGCTCTCCTACATTGC; 7_R:CATCGTGTGGTTCGTCATCTG.

2. A kit, characterized in that Comprising the primer set according to claim 1.

3. Use of the primer set according to claim 1 or the kit according to claim 2 in identifying alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene.

4. The use according to claim 3, characterized in that The alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene include two splicing isoforms, Gllac7.1 and Gllac7.

2. The nucleotide sequence of the Gllac7.1 is shown in SEQ ID NO.7, and the nucleotide sequence of the Gllac7.2 is shown in SEQ ID NO.

8.

5. A method for detecting alternative splicing isoforms of the Ganoderma lucidum laccase Gllac7 gene, characterized in that: The following steps are involved: (1) Collect Ganoderma lucidum mycelium, extract RNA, and reverse transcribe it into cDNA; (2) Using the primer sets Aslac7_1 and Aslac7_2 described in claim 1, respectively, the above cDNA was amplified by qPCR, and the presence of Gllac7.1 and Gllac7.2 splicing isoforms was determined by Ct value; gapdh was used as an internal reference to calculate the expression ratio of Gllac7.1 and Gllac7.

2.

6. The detection method according to claim 5, characterized in that The qPCR amplification reaction system was as follows: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL of each 10 μmol / L forward and reverse primer, 8.2 μL of double-distilled water, and 1 μL of cDNA; the reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 3 s, annealing at 60°C for 32 s, and extension at 72°C for 30 s, for 40 cycles.

7. The detection method according to claim 5, characterized in that The detection primers of the internal reference gapdh are: F:5'-GGTGCCAAGAAGGTGGTCAT-3'; R:5'-CGAGAGGAGCCAGACAGTTG-3'.

Images