A canine distemper virus monoclonal antibody derived from whole dogs and its application

Abstract

The present invention discloses a monoclonal antibody, which is a monoclonal antibody of canine distemper virus (CDV) of all canine origin screened by using single B cell antibody technology, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 5, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 6. The monoclonal antibody can specifically react with CDV virus hemagglutinin protein, so it can be used for the identification and clinical diagnosis of CDV, and the monoclonal antibody has neutralizing activity against CDV virus, which is of great significance for the prevention and control of CDV.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a canine distemper virus (CDV) monoclonal antibody obtained by using single B cell antibody technology and its application. Background Art

[0002] After a specific antigen enters the animal's body, it will be recognized by the corresponding specific B cells. After the specific B cells that recognize the antigen are activated, they proliferate and differentiate into plasma cells to secrete antibodies. Antibodies reach all parts of the body through blood circulation. The basic structure of mammalian antibodies includes two heavy chains and a light chain. The heavy chain and the light chain are combined to form a variable region (V region) and a constant region (C region). The functions of the variable region of the antibody include specific recognition of antigens, neutralization effects, and promotion of phagocytosis by phagocytes. The functions of the constant region of the antibody include activation of the complement system, mediation of immune cell activity, and crossing the placenta and mucosa.

[0003] CDV infection causes acute, highly contagious diseases in animals such as canines, mustelids, and raccoons, and is currently prevalent worldwide. Hemagglutinin protein is a type II glycoprotein with host tropism and is located on the surface of the viral envelope. H protein is one of the important factors that determine the pathogenicity of CDV and is also a key protein in CDV-related research.

[0004] The preparation of monoclonal antibodies has mainly gone through three stages: hybridoma monoclonal antibody technology, phage display technology, and single B cell antibody technology. Among them, hybridoma monoclonal antibody technology has low cost and mature technology, but long cycle, low fusion rate, and long-term genetic instability; phage display technology does not require animal hosts, and the screening of a large number of clones increases the chance of producing good monoclonal antibodies, but the heavy chain and light chain of phage display technology are not naturally paired, the display efficiency is biased, and functional verification is required again; single B cell antibody technology has been developed in recent years. This method relies on various types of single cell separation and identification such as magnetic beads, flow cytometry, and microfluidics, combined with PCR, DNA sequencing, and antibody recombinant expression technology to achieve the separation and expression of naturally paired specific antibodies from single B lymphocytes.

[0005] Single B cell antibody technology achieves high-throughput screening of antibodies, overcomes the shortcomings of display technology and hybridoma technology in preparing antibodies, retains the original pairing of heavy and light chains, and can screen out antibodies with high affinity and high specificity. Single B cell antibody technology has the potential to separate functional monoclonal antibodies with conformational determinants that are difficult to simulate outside of antibodies, so it has unique value in the development of antibodies for viral infectious diseases. Summary of the invention

[0006] The purpose of the present invention is to provide a monoclonal antibody of canine CDV virus screened by using single B cell antibody technology, and the present invention also provides the application of the monoclonal antibody in diagnosing and preventing CDV.

[0007] The objective of the present invention is achieved through the following technical solutions:

[0008] The inventors isolated peripheral blood from immunized dogs, isolated mononuclear cells (PBMCs) from the peripheral blood, further obtained specific B cells capable of recognizing CDV hemagglutinin protein (Hemagglutinin protein) by flow sorting, then designed nested PCR primers to amplify antibody heavy chain variable region and light chain variable region sequences from B cells, connected the obtained heavy chain variable region and light chain variable region with the heavy chain constant region and the light chain constant region, respectively, constructed a heavy chain full-length expression vector and a light chain full-length expression vector, and finally co-transfected the heavy chain plasmid and the light chain plasmid into HEK 293 cells to express monoclonal antibodies.

[0009] The amino acid sequence of the heavy chain variable region of the obtained monoclonal antibody is shown in SEQ ID NO: 5, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 6. The monoclonal antibody can specifically react with the hemagglutinin protein of canine distemper virus.

[0010] Furthermore, the amino acid sequence of the heavy chain constant region of the monoclonal antibody is shown in SEQ ID NO:7, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO:8.

[0011] The present invention also provides a DNA fragment encoding the monoclonal antibody, wherein the heavy chain variable region DNA fragment is shown in SEQ ID NO: 1, the light chain variable region DNA fragment is shown in SEQ ID NO: 2, the heavy chain constant region DNA fragment is shown in SEQ ID NO: 3, and the light chain constant region DNA fragment is shown in SEQ ID NO: 4.

[0012] The monoclonal antibody obtained by the present invention can react with CDV hemagglutinin protein, and thus can be used for identification and clinical diagnosis of canine distemper virus, and for preparing a diagnostic kit for canine distemper virus. The monoclonal antibody does not react with common canine viruses such as CPV (canine parvovirus), CCV (canine coronavirus), and CAV (canine adenovirus), and has high specificity.

[0013] The monoclonal antibody obtained by the present invention has neutralizing activity against CDV virus, and is therefore also a neutralizing antibody, which can reduce the pathogenicity of CDV virus by neutralizing CDV virus, and is used for preventing and treating diseases caused by CDV virus and preparing related drugs. The minimum neutralizing effective concentration of the antibody is 1.25ug / ml.

[0014] The beneficial effects of the present invention are:

[0015] The present invention can quickly obtain canine antigen-specific B cells and shorten the antibody research and development cycle. Antibodies prepared by traditional technology are generally rabbit-derived or mouse-derived antibodies, while antibodies prepared by the present invention are fully canine-derived antibodies, which exhibit good neutralizing effects on CDV-infected VERO cells and have high application value in CDV diagnosis and treatment.

[0016] For more detailed technical solutions, please refer to the specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the result of biotin labeling of Hemagglutinin protein.

[0018] Figure 2 This is a flow cytometry diagram of antigen-specific memory B cells in the present invention.

[0019] Figure 3 This is a graph showing the PCR amplification results of a single B cell.

[0020] Figure 4 It is the electrophoresis diagram of monoclonal antibody protein.

[0021] Figure 5 It is the result of the reactivity test of monoclonal antibodies. DETAILED DESCRIPTION

[0022] The present invention is based on flow sorting technology and single B cell amplification technology to screen canine antigen-specific B cells and efficiently amplify the variable region of the antibody genome, purify and express antibodies, and verify their reactivity. Unless otherwise specified, the materials and reagents used in the experimental examples are reagents and materials that can be obtained from commercial channels, which are described in detail below in conjunction with specific embodiments.

[0023] Example 1. Preparation of monoclonal neutralizing antibodies against canine distemper

[0024] 1. Isolation of Canine Peripheral Blood Mononuclear Cells

[0025] Draw 5ml of blood from dogs immunized with canine distemper vaccine, add it to an EDTA anticoagulant tube, dilute it with 5ml sterile PBS, take a sterile centrifuge tube, add 5ml of separation liquid (Tianjin Haoyang), and then slowly add 5ml of diluted blood sample. Carefully add blood sample or fresh anticoagulated blood to the separation liquid interface, centrifuge at 500g for 25min at 20℃. After centrifugation, the centrifuge tube is divided into four layers from top to bottom. The first layer is the plasma layer, the second layer is the ring-shaped milky white canine mononuclear cell layer, the third layer is the transparent separation liquid layer, and the fourth layer is the red blood cell layer. Carefully aspirate the plasma layer and discard it, carefully aspirate the ring-shaped milky white canine mononuclear cell layer in the centrifuge tube and transfer it to a new centrifuge tube, add 10 ml of washing solution to the centrifuge tube containing canine mononuclear cells, mix the cells, centrifuge at 250g for 10 minutes, discard the supernatant, use a pipette to aspirate 5 ml of washing solution to resuspend the obtained cells, centrifuge at 250g for 10 minutes, discard the supernatant, repeat the washing twice, discard the supernatant, and resuspend the obtained cells with 0.5 ml of flow cytometry solution.

[0026] 2. Flow Cytometry Antibody Conjugation and Labeling

[0027] Take out the EZ-Link Sulfo-NHS-LC-Biotin (Thermo) stored at 4°C, equilibrate to room temperature, unscrew the bottle cap before use, add 180 μL of ultrapure water, gently blow and mix, vortex briefly, and successfully prepare a 10 mM biotin solution. Add the above-prepared biotin solution to the purified Hemagglutinin protein and incubate on ice for 2 hours. Purify the biotin-labeled Hemagglutinin protein: add the labeled Hemagglutinin protein to a 30 KDa ultrafiltration tube, add 1 ml of sterile PBS, centrifuge at 3000 rpm for 8 minutes, repeat three times, transfer the labeled protein in the ultrafiltration tube to a new EP tube and store it at -20°C. The western blot results of the labeled Hemagglutinin protein are as follows Figure 1 shown.

[0028] Anti Dog IgM labeling: Add 1.25 μL reaction buffer c (AAT Bioquest) to 25 μL 1 mg / ml IgM (Bio-Rad) antibody, pipette to mix, and then add 2.5 μL Buccutite TM MTA working solution, incubate at room temperature for 60 min. TM FOL-Activated PE-Cy7 was mixed by pipetting, incubated at room temperature for 60 min, and then stored at 4°C.

[0029] 3. Flow cytometry sorting of single hemagglutinin antigen-specific memory B lymphocytes

[0030] 200 μL of canine peripheral blood mononuclear cells were dispensed into each flow tube for flow staining. 1 μL Dog IgGFitc, 2 μL Pe-cy7 IgM, 2 μL H protein biotin were added, mixed, incubated at 4°C for 1 hour, 400g for 3 minutes, supernatant was discarded, 2 ml of flow sorting solution was added to resuspend, 400g for 3 minutes, supernatant was discarded, 2 ml of flow sorting solution was added to resuspend, 400g for 3 minutes, supernatant was discarded, 200 μL of flow sorting solution was resuspended, 2 μL of anti-biotin antibody was added to mix, incubated at 4°C for 1 hour, and after repeated washing steps, 500 μL of ...

[0031] Use BD FACSAri SORP flow cytometry to sort canine distemper Hemagglutinin protein-specific single B cells. The instrument parameters are set as: nozzle size: 100 microns; sorting mode: single cell mode; sorting speed: 5000 cells / second. After adjusting the above parameter settings, turn off the Sweat button, use Accudrop delay microspheres to calculate the liquid delay time, adjust the position of the 96-PCR well plate in the sorting chamber until the sorted cells fall accurately into the center of the plate well, and draw a gate to circle out lymphocytes and monocytes. Sorting IgM - IgG + Hemagglutinin + Cells are the corresponding antigen-specific single B cells. The flow cytometry results are as follows Figure 2 As shown, first mononuclear cells were delineated, and secondly PE-Cy7 negative cells, i.e. IgM - Cells, among which IgG and Hemagglutinin double positive cells are the desired cells.

[0032] 4. Expansion of Single Hemagglutinin Antigen-Specific Memory B Lymphocytes

[0033] (1) Prepare the single-cell lysis and reverse transcription system on ice according to the following table and add 10 μL per well of the 96-well PCR plate after single-cell sorting.

[0034] Element volume Random 6mers 1μL dNTP mixture 1μL 1% triton 100 2μL <![CDATA[Rnase free H2O]]> 6μL

[0035] Heat the 96-PCR well plate at 65°C for 5 minutes, then cool it quickly on ice. Prepare the solution according to the following table and add 10 μL to each well of the 96-PCR well plate.

[0036] Element volume 5*prime scriptbuffer 4μL Prime script Rtase 1μL Inhibitor 1μL <![CDATA[Rnase free H2O]]> 4μL

[0037] The 96-well PCR reaction program was 30°C for 10 min and 42°C for 60 min. After the reaction, the single antigen-specific memory B lymphocyte cDNA was stored at -80°C.

[0038] (2) Nested PCR amplification of canine single antigen-specific memory B lymphocytes:

[0039] Configure the PCR reaction system according to the following table and perform the first round of amplification.

[0040] Element volume dNTP mixture 2μL 5*prime buffer 5μL Polymerase 1μL F (upstream primer) 1μL R (downstream primer) 1μL <![CDATA[ddH2O]]> 13μL cDNA 2μL

[0041] The primers required for the first round of amplification are the designed and optimized canine heavy chain and light chain variable region primers. The primers are shown in the table below.

[0042] Primer name Primer sequences IGHV1 (heavy chain forward) ATGGAGTSTGYGCTYNGC IGHV2 (heavy chain forward) ATGGARTCTTTCSTTGGCTG IGKV1 (Kappa chain positive) ATGARRTTYCCWTCTCWGCT IGLV1 (light chain forward) ATGACCTYCACCRTGGGMTG IGLV2 (light chain forward) ATGGCYTGGACSBHSYTYCT IGHC1 (heavy chain reverse) GCCAGTGGGAAAACCGAG IGKC1 (Kappa chain reverse) TTGGAACAAATAGACGGCTG IGLC1 (light chain reverse) GGGAAGAGTGTGACYRARGGG

[0043] Merge primer correspondence: R=G+A, Y=C+T, W=A+T, S=C+G, M=A+C, B=C+G+T, D=S+G+T, H=A+C+T, V=A+C+G, N=A+C+G+T

[0044] The PCR reaction program was: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 2 min, 35 cycles; and extension at 72°C for 8 min.

[0045] Configure the PCR reaction system according to the following table and perform the second round of amplification.

[0046]

[0047]

[0048] The template for the second round of amplification is the product of the first round of amplification. The primers required for the second round of amplification are the canine heavy chain and light chain variable region primers that have been designed and optimized. The primers are shown in the table below.

[0049] Primer name Primer sequences IGHV1-1 (heavy chain forward) TCRCTAYTTTAMAAGGHGTCCA IGHV2-1 (heavy chain forward) CTAYTTTAAAAGGTBTCCAGNGTGA IGKV1-1 (Kappa chain positive) CTCCTGGGGCTGCTGAT IGLV1-1 (light chain forward) CCCTYTCCTCCTVVCVCT IGLV2-1 (light chain forward) TGGGMTGGTYCCCTCTCMTC IGHC1-1 (heavy chain reverse) AGGGGGCCGTGGTGG IGKC1-1 (Kappa chain reverse) TTGGAACAAATAGACGGCTG IGLC1-1 (light chain reverse) GGGAAGAGTGTGACYRARGGG

[0050] Merge primer correspondence: R=G+A, Y=C+T, W=A+T, S=C+G, M=A+C, B=C+G+T, D=S+G+T, H=A+C+T, V=A+C+G, N=A+C+G+T

[0051] The PCR reaction program was: 95°C for 5 min; 95°C for 30 s, 55°C for 40 s, and 72°C for 2 min, for 35 cycles; and extension at 72°C for 8 min for the second round of amplification.

[0052] Take 5 μL of the PCR product from the second round of amplification and perform electrophoresis on 1% agarose gel to observe the amplification results ( Figure 3 ). The samples of VH and VL genes were successfully amplified, and the remaining 45 μL of product was subjected to DNA sequencing. The gene sequence of the antibody heavy chain variable region (VH) amplified by PCR is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 5; the gene sequence of the light chain variable region (VL) is shown in SEQ ID NO: 2, and the amino acid sequence is shown in SEQ ID NO: 6.

[0053] 5. Eukaryotic Expression of Canine Monoclonal Antibodies from Single Memory B Cells

[0054] The VH and VL of a single memory B cell were connected to the heavy chain constant region and the light chain constant region, the heavy chain constant region (CH) gene sequence is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 7; the light chain constant region (CL) gene sequence is shown in SEQ ID NO: 4, and the amino acid sequence is shown in SEQ ID NO: 8. Through signal peptide and codon optimization, the heavy chain full-length expression vector and the light chain full-length expression vector were constructed on the plasmid pCDNA3.4, respectively, and the plasmids were extracted using an endotoxin-free plasmid extraction kit.

[0055] Prepare two 15ml centrifuge tubes, add 5ml KPM, 50μg heavy chain plasmid and 50μg light chain plasmid to one of them, take the other centrifuge tube, add 5ml KPM and 500μL TA-293 transfection reagent, transfer all the liquid in the centrifuge tube containing the transfection reagent to the centrifuge tube containing the plasmid, gently blow and mix, let it stand at room temperature for 10 minutes, and then add the above mixed liquid to 100ml of 2×10 6 HEK 293 cells were cultured at 37°C in a CO 2 The cells were shaken and cultured in a constant temperature shaker. After 24 hours, 600 μL KE-293 and 2 ml KT-Feed were added. On the sixth day, the cell supernatant was collected by centrifugation. The transfection reagent used for expression was purchased from Zhuhai Kairui.

[0056] 6. Antibody Purification and Validation

[0057] The cell supernatant sample expressing the antibody was filtered through a 0.22μM filter before purification, and then the antibody was purified using a ProteinA column. The specific steps are as follows: First, 5 column volumes of ddH2O and binding buffer (20mM sodium phosphate buffer at pH = 7.2) were used to balance the ProteinA column, the flow rate was adjusted to 0.3mL / min, and the sample was loaded. After the loading was completed, the flow rate was adjusted to 1mL / min, and 5 column volumes of binding buffer were used for washing. The target protein was eluted with an elution buffer (0.1M citric acid at pH = 3.0), and the eluted protein was collected with a 1.5mL EP tube. The eluted protein was dialyzed and replaced into PBS buffer. -20℃ was stored for future use. After the antibody was subjected to protein electrophoresis, two bands appeared ( Figure 4 ), one is about 55KD, which is the heavy chain, and the other is about 25KD, which is the light chain.

[0058] Example 2: Reactivity of canine monoclonal antibodies

[0059] 1.ELISA to detect antibody reactivity

[0060] The canine distemper Hemagglutinin protein was coated on the ELISA coated plate at a concentration of 5 μg / mL at 4°C overnight. After washing 3 times with PBST, 5% skim milk powder was added to block at 37°C for 2 hours. After washing 3 times with PBST, 2-fold diluted canine antibody was added and incubated at 37°C for 2 hours. After washing 3 times with PBST, 1:2000 diluted anti-canine IgG-HRP antibody was added and incubated at 37°C for 1 hour. After washing 3 times with PBST, the colorimetric solution was added and incubated at 37°C for 10 minutes. Then, the stop solution was added and the OD630nm value was read with an enzyme reader. The results are as follows: Figure 5 As shown in A, it indicates that the prepared antibody can react with Hemagglutinin protein.

[0061] 2. Indirect immunofluorescence detection of antibody reactivity

[0062] Common canine viruses CPV (canine parvovirus), CCV (canine coronavirus), CAV (canine adenovirus), and CDV (canine distemper virus) were propagated in 12-well plates. After infection, when the cells showed pathological changes, they were washed 3 times with PBST, fixed with 4% paraformaldehyde for 15 minutes, washed 3 times with PBST, permeabilized with 0.1% Triton-100 for 10 minutes, washed 3 times with PBST, added with 25 μg / mL of full canine antibody, incubated at 37°C for 2 hours, washed 3 times with PBST, added with 1:200 diluted anti-canine IgG-FITC antibody, incubated at 37°C for 1 hour, washed 3 times with PBST, and observed and photographed with an inverted fluorescence microscope ( Figure 5 B), the whole canine monoclonal antibody reacts specifically with canine distemper virus and has no reaction with other canine viruses.

[0063] Example 3: Neutralizing activity of canine monoclonal antibodies

[0064] The TCID 50 Canine distemper virus (PS, 3, BT strains) was diluted to contain 100×TCID 50 The canine monoclonal neutralizing antibody was diluted 2-fold with DMEM medium, from a starting concentration of 40 μg / mL to 0.625 μg / mL; 50 μL of each dilution of antibody was mixed evenly with the diluted virus solution, and incubated at 37°C for 60 min; the virus and antibody mixture was added to a 96-well culture plate that was about to be covered with a monolayer of Vero cells, and then placed in a 37°C incubator for culture observation. Each dilution of antibody was repeated 3 times, and the cell pathological changes were observed and recorded for 72 hours, and the effective concentration of the neutralizing antibody was calculated (the results are shown in the table below).

[0065]

[0066] The above examples are general descriptions and detailed descriptions of the present invention. It is pointed out again that those skilled in the art can make some improvements and enhancements based on the principles, methods and related operations described in the present invention, and these improvements and enhancements all fall within the scope of protection claimed by the present invention.

[0067] Description of sequence listing:

[0068] SEQ ID NO: 1: Nucleotide sequence of the heavy chain variable region (VH) of a monoclonal antibody;

[0069] SEQ ID NO: 2: Nucleotide sequence of the light chain variable region (VL) of a monoclonal antibody;

[0070] SEQ ID NO: 3: Nucleotide sequence of the heavy chain constant region (CH) of a monoclonal antibody;

[0071] SEQ ID NO: 4: Nucleotide sequence of the monoclonal antibody light chain constant region (CL);

[0072] SEQ ID NO: 5: amino acid sequence of the heavy chain variable region (VH) of a monoclonal antibody;

[0073] SEQ ID NO: 6: amino acid sequence of the light chain variable region (VL) of a monoclonal antibody;

[0074] SEQ ID NO: 7: amino acid sequence of the constant region (CH) of the heavy chain of a monoclonal antibody;

[0075] SEQ ID NO: 8: Amino acid sequence of the monoclonal antibody light chain constant region (CL).

Claims

1. A monoclonal antibody against canine distemper virus (CDV) of all canine origin, characterized in that: The amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO: 5, and the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID NO:

6. The monoclonal antibody can specifically react with the hemagglutinin protein of canine distemper virus.

2. The monoclonal antibody according to claim 1, characterized in that: The amino acid sequence of the heavy chain constant region of the monoclonal antibody is shown in SEQ ID NO:7, and the amino acid sequence of the light chain constant region of the monoclonal antibody is shown in SEQ ID NO:

8.

3. A DNA fragment encoding the monoclonal antibody according to claim 1 or 2.

4. Use of the monoclonal antibody according to claim 1 or 2 in the preparation of a diagnostic kit for canine distemper virus.

5. A kit, which is an immune kit for diagnosing canine distemper virus, and contains the monoclonal antibody according to claim 1 or 2.

6. Use of the monoclonal antibody according to claim 1 or 2 in the preparation of drugs for preventing and treating canine distemper virus.

7. A medicine capable of neutralizing canine distemper virus, the medicine comprising the monoclonal antibody according to claim 1 or 2.

Images