A double antibody sandwich ELISA kit for detecting Rift Valley fever virus

Abstract

The present invention belongs to the field of virus detection, and particularly relates to a double-antibody sandwich ELISA detection kit for detecting Rift Valley fever virus; the antibody is a monoclonal antibody against RVFV NP, and the antibody name is MAb 5D8; it is obtained by secretion of a hybridoma cell line, and the hybridoma cell line is named RVFV NP-5D8. The method for detecting Rift Valley fever virus established by the present invention has the advantages of rapidity, stability, high specificity, etc., and is suitable for large-scale detection and analysis of Rift Valley fever virus samples.

Description

Technical Field

[0001] The invention belongs to the field of virus detection, and in particular relates to a double antibody sandwich ELISA detection kit for detecting Rift Valley fever virus. Background Art

[0002] Rift Valley Fever virus (RVF) is a mosquito-borne zoonosis caused by the Rift Valley Fever virus (RVFV). Infection can cause abortion in ruminants, high mortality in young animals, and hemorrhagic fever in humans. RVF was first discovered and reported on the African continent in 1930 and has now spread to many regions, such as Madagascar, the Comoros Islands, Saudi Arabia, and Yemen. RVF is listed as a notifiable disease by the World Organization for Animal Health. With increasingly close trade with Africa and the Middle East, the risk of importing Rift Valley fever cannot be ignored.

[0003] RVFV is a member of the genus Phlebovirus in the family Phenuiviridae of the order Bunyavirales. The genome size is about 12 kb. The RVFV genome is a single-stranded negative-strand RNA that can be divided into three segments: L (large), M (medium), and S (small). The S segment is 1690 bp long and encodes two proteins through an ambiguous translation mechanism, encoding nucleoglucapsid protein (NP) in a negative sense and non-structural protein S segment (NSs) in a positive sense. Non-structural protein NSs is a non-essential protein for viral replication and an important virulence factor of the virus. Its main functions include: interfering with the production of host interferon at the transcriptional and translational levels through multiple pathways, inhibiting the natural antiviral activity of host cells; forming a fibrotic structure in the cell nucleus, interacting with the host chromosome DNA, and causing defects in chromosome condensation and dissociation. RVFVNP is encoded by 735 nucleotides, with a molecular weight of about 27.4kDa. It is a highly conserved structural protein and the most abundant viral component in RVFV virus particles and virus-infected cells. It plays an important role in the replication and transcription of the virus. NP interacts with the vRNA of the L, M and S genomes to form ribonucleoprotein complexes (RNPs), which can protect the genomic vRNA from degradation.

[0004] Sheep are the most susceptible animals to infection. The incubation period of RVF is 24 to 36 hours, and the clinical manifestations are fever, listlessness, loss of appetite, abdominal pain and bloody diarrhea. Histopathology shows multifocal liver necrosis and occasional splenomegaly. The mortality rate of adult sheep after experimental infection is 20-30%; the mortality rate of newborn lambs can reach 95-100%; the chance of abortion in pregnant ewes with acute infection is 100%. The liver is the organ most obviously damaged after RVFV infection. Histopathological examination of the liver after virus infection showed that the sick animals showed multifocal lesions and necrotizing hepatitis. Liver necrosis is the most obvious lesion, which is manifested by a large loss of normal liver structure and the appearance of rod-shaped or oval eosinophilic nuclear inclusions. After detailed examination, a large amount of RVFVNSs protein can be found inside the liver. At the same time, the spleen will also show varying degrees of necrosis. Liver damage can lead to jaundice and hemorrhagic fever. Serum biochemical indicators show an increase in liver enzymes aspartate transaminase (AST) and alanine transaminase (ALT) (HARTMAN et al., 2014; SWANEPOEL et al., 1979; AL-HAZMI et al., 2003). Hemoglobin content and platelet count decrease as coagulation time increases. Patients with hemorrhagic fever usually have a low recovery rate and a high mortality rate, and die within one to two weeks after the onset of symptoms. After RVFV invades the body, it is transported to the peripheral lymph nodes through the lymphatic ducts. After replicating in the lymph nodes, it enters the circulatory system, produces initial viremia, and further infects important target organs such as the liver, spleen, kidneys, and brain. The virus continues to replicate in the target organs, causing high concentrations of viremia. In severe cases, characteristic bleeding and changes in serum biochemical indicators will occur. High viremia reaches a peak 2-3 days after infection, and then suddenly drops 4-5 days, which is a significant feature of acute RVFV infection in ruminants. Generally speaking, infected animals either die or recover completely in these days. During the infection process, the virus inhibits the host's natural antiviral immune response through the anti-interferon effect of the NSs protein. In the acquired immune response, humoral immunity plays an important role. 4-8 days after infection, the body produces neutralizing antibodies against glycoprotein Gn / Gc. NP has strong immunogenicity and can induce humoral and cellular immunity, but the antibodies produced do not have neutralizing activity. NP is an immunodominant antigen produced after RVFV infects the animal body. It is tightly bound to the genomic RNA in the virus particles and affects the assembly of the viral genome. Therefore, research on RVFVNP is very necessary.

[0005] At present, there is no approved commercial diagnostic kit at home and abroad. Antigen detection of RVF is mostly carried out by direct immunofluorescence technology to specifically identify RVFV in infected cells. In addition, Paweska et al. established a double antibody sandwich ELISA for detecting RVFV in cell culture (Paweska JT, Barnard BJ, Williams R J. The use of sucrose-acetone-extracted Rift Valley fever virus antigen derived from cell culture in an indirect enzyme-linked immunosorbent assay and haemagglutination-inhibition test [J]. 1995, 62 (4): 227.). Compared with antigen detection, nucleic acid and antibody detection are more widely used in the diagnosis of RVF. At present, the RVFV nucleic acid detection method recommended by WHO is reverse transcription-polymerase chain reaction (RT-PCR), but this method requires instruments and equipment and is not suitable for grassroots on-site diagnosis. Virus neutralization test is often used as the gold standard in antibody detection methods, but this method requires the use of live viruses for detection, and RVFV needs to be operated in a biosafety level III laboratory. The operating platform is limited and the biosafety risk is high. At present, enzyme-linked immunosorbent assay (ELISA) is a common method for import and export quarantine of animal products, and it is also the most widely used detection method in the world. In 1995, Paweska et al. used cell cultured viruses as antigens to establish an RVFV IgG capture ELISA antibody detection method, which has been recommended by OIE as one of the standard methods for detecting the virus. In 2013, Jackel et al. prepared RVFVeGn protein using a prokaryotic expression system and used this protein to establish an indirect ELISA detection method for detecting RVFV IgG in small ruminants.In 2018, Upreti et al. used recombinant NP protein as an antigen to establish a competitive ELISA antibody detection method for RVFV, with a sensitivity of 95.1% and a specificity of 91.8% (Upreti D, Cernicchiaro N, Richt JA, et al. Preliminary evaluation of diagnostic accuracy and precision of a competitive ELISA for detection of antibodies to Rift Valley fever virus in cattle and sheep sera [J]. J Virol Methods, 2018, 262: 6-11). In addition to the ELISA method, Van et al. used the insect expression vector pMT / BiP / V5-HisA to express eGn protein in 2012, and based on this, established a liquid chip detection method that can simultaneously detect RVFVNP protein and Gn protein. This method can distinguish whether the animal infection is natural infection or infection through vaccination.

[0006] Rift Valley fever is a severe zoonosis and is classified as a Class A infectious disease by the World Organization for Animal Health. Once imported into my country, it will cause huge economic losses to the livestock industry. At present, there is no commercial, rapid and accurate serological antigen detection kit in my country. Operations involving infectious viruses need to be carried out in laboratories with a biosafety level of three or above, so it is very necessary to develop methods and kits that are easy to operate, simple in equipment, and can quickly detect RVFV on site. After the Rift Valley fever virus infects the body, its specific IgM antibodies and IgG antibodies need to appear around 5 to 7 days of the disease course, and nucleic acid detection and virus isolation can usually only be detected around 4 days after onset, which is not conducive to the rapid diagnosis of RVF. Animal experiments have shown that specific viral antigens can be detected in rhesus monkeys infected with RVFV on the 1st to 2nd day, so the establishment of an RVFV antigen detection method can obtain diagnostic results more quickly, which is conducive to the rapid discovery and prevention and control of RVFV epidemics. Summary of the invention

[0007] Nucleoproteins with highly conserved amino acid sequences are ideal detection targets. To achieve the goal of rapid and quantitative detection of RVFV, the present invention uses monoclonal antibodies (MAb) and polyclonal antibodies (PcAb) against RVFVNP to establish a double antibody sandwich ELISA detection method for RVFVNP. Polyclonal antibodies are suitable for capturing as many antigens as possible, and monoclonal antibodies with higher affinity are suitable for detecting subtle differences in the number of antigens. The present invention was completed on this basis.

[0008] In the first aspect, the present invention provides a hybridoma cell line that secretes MAb 5D8 monoclonal antibody against RVFVNP. The hybridoma cell line is named RVFVNP-5D8 hybridoma cell, and the preservation unit is the General Microbiology Center of China National Microbiological Culture Collection Administration; the preservation number is CGMCC NO.45822, and the preservation time is March 1, 2024.

[0009] In the second aspect, a monoclonal antibody against RVFVNP, the antibody is named 5D8 MAb, the monoclonal antibody is obtained by secretion of the hybridoma cell described in the first aspect, the hybridoma cell line is named RVFVNP-5D8 hybridoma cell, and the preservation unit is the General Microbiology Center of China National Culture Collection Administration (No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing); the preservation number is CGMCCNO.45822, and the preservation time is March 1, 2024.

[0010] In a third aspect, the present invention provides a use of a monoclonal antibody in preparing a reagent for detecting or diagnosing Rift Valley fever virus infection, wherein the monoclonal antibody is obtained by secretion of the hybridoma cell described in the first aspect.

[0011] In a fourth aspect, the present invention provides a double antibody sandwich ELISA kit for detecting Rift Valley fever virus, characterized in that the kit comprises the monoclonal antibody MAb 5D8 described in the second aspect and the rabbit anti-RVFVNP PcAb polyclonal antibody, wherein the monoclonal antibody is labeled with HRP and used as a detection antibody (5D8-HRP), and the rabbit anti-RVFVNP PcAb polyclonal antibody is used as a capture antibody.

[0012] Furthermore, the kit also includes a blocking solution, a diluent, a washing solution, a color developing solution and a stop solution.

[0013] Furthermore, the coating amount of the rabbit anti-NP PcAb polyclonal antibody is 0-0.5 μg / well, preferably 0-0.2 μg / well; preferably 0.2 μg / well; the detection antibody is 5D8-HRP, preferably 0-2.24 ng / well, preferably 2.24 ng / well.

[0014] Beneficial Effects

[0015] The hybridoma cell line secreting the MAb 5D8 monoclonal antibody against RVFV NP used in the present invention is named RVFVNP-5D8 hybridoma cell, and the deposit unit is the General Microbiology Center of the China Microbiological Culture Collection Administration Committee; the deposit number is CGMCC NO.45822, and the deposit time is March 1, 2024; a double antibody sandwich ELISA detection method for RVFV NP is established using the monoclonal antibody MAb 5D8 against RVFV NP and the rabbit anti-RVFVNPPcAb polyclonal antibody, and the polyclonal antibody is suitable for capturing as many antigens as possible, and the monoclonal antibody with higher affinity is suitable for detecting subtle differences in the number of antigens. After being labeled with HRP, the monoclonal antibody 5D8 is used as a detection antibody (named 5D8-HRP). The application of the antibody in the kit has good specificity and sensitivity, with an intra-batch coefficient of variation of 1.158% to 3.827% and an inter-batch coefficient of variation of 0.681% to 7.011%, both of which are less than 8%. The method established by the invention has the advantages of being rapid, stable, highly specific, and the like, and is suitable for large-scale detection of Rift Valley fever virus samples and quantitative analysis of Rift Valley fever virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is an identification diagram of the RVFVNP eukaryotic expression plasmid and cell line (A: pCDNA3.1-RVFVNP-His plasmid enzyme digestion identification. 1: pCDNA3.1-RVFVNP-His plasmid; 2: plasmid enzyme digestion identification. B: Western blot detection and identification of the RVFVNP cell line. 3: RVFVNP cell line supernatant; 4: CHO-K1 cell supernatant negative control; 5: RVFVNP cell line lysate; 6: CHO-K1 cell lysate negative control C: IFA identification of the RVFVNP cell line).

[0017] Figure 2 To establish the concentration of elution / wash solution for purification of RVFVNP recombinant protein.

[0018] Figure 3 These are the titer determination results of mouse anti-NPMAb and rabbit anti-NPPcAb (A: ELISA titer of mouse anti-NP MAb; B: ELISA titer of rabbit anti-NPPcAb; C: Western blot titer of mouse anti-NPMAb; D: Western blot titer of rabbit anti-NPPcAb).

[0019] Figure 4Optimization results of the double antibody sandwich ELISA method (A: optimal working concentration of detection antibody 5D8-HRP; B: optimal coating concentration of capture antibody; C: capture antibody coating time; D: blocking time; E: selection of blocking solution; F: selection of sample diluent; G: sample incubation time; H: detection antibody incubation time; I: color development time)

[0020] Figure 5 This is the standard curve for detecting NP protein by double antibody sandwich ELISA.

[0021] Figure 6 The results are for the double antibody sandwich ELISA specificity test.

[0022] Figure 7 This is the sensitivity test result of double antibody sandwich ELISA. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0024] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0025] Example 1 Materials and Methods

[0026] 1.1 Plasmids, cells, viruses, proteins and experimental animals

[0027] pCDNA3.1(+) plasmid, CHO-K1 cells, SP2 / 0 cells, and Rift Valley fever replication-deficient inactivated virus were all preserved in our laboratory; the RVFVNP gene fragment was synthesized by Shanghai Jierui Bioengineering Co., Ltd.; SPF-grade BALB / c mice and New Zealand white rabbits were purchased from Beijing Weitonglihua Company; Congo fever virus (CCHFV) N protein, Lassa virus (LSV) N protein, RVFV Gn protein, and new coronavirus (SARS-CoV-2) N protein were preserved in our laboratory; 21 RVFV-negative serum samples and 11 RVFVNP-positive serum samples were preserved in our laboratory.

[0028] 1.2 Main Reagents

[0029] Rabbit anti-His tag antibody was purchased from GenScript Biotech Co., Ltd.; transfection reagent ExFect Transfection Reagent was purchased from Nanjing Novozyme Biotech Co., Ltd.; Protein A+G agarose antibody purification kit was purchased from Beyotime; purification prepacked column rProtein L 4FF Chromatography Column was purchased from Yisheng Biotechnology Co., Ltd.; PBS buffer powder, ELISA colorimetric solution, and Coomassie brilliant blue staining and decolorization kit were purchased from Beijing Solebow Technology Co., Ltd.; F12K culture medium powder was purchased from Wuhan Pronosai Life Science Co., Ltd.; DMEM culture medium and fetal bovine serum were purchased from Gibco, USA; restriction endonucleases were purchased from NEB, UK; antibody typing kit was purchased from Southern Biotech, USA; nickel column Ni Resin FF was purchased from GenScript Biotech Co., Ltd.

[0030] 1.3 Construction of eukaryotic expression plasmid of RVFV NP protein carrying His tag

[0031] According to the Rift Valley fever virus S segment NP protein nucleic acid sequence (GenBank: KX611607.1), the gene codon was optimized for Chinese hamsters, and a secretion signal peptide sequence (GAGACCGACACCCTGCTGCTGTGGGTGCTGCTGCTGTGGGTGCCCGGCTCCACCGG CGGCGGCTCCTCCGGCGGC) was designed and added to the N-terminus of the recombinant protein. A 6×His tag was added to the C-terminus of the recombinant protein, and two restriction sites, KpnI and EcoRI, were selected. After linearization of pCDNA3.1 (+), the gene fragment was cloned into the pCDNA3.1 vector to construct the pCDNA3.1-RVFVNP-His eukaryotic expression plasmid. The PCR amplification primers and nucleic acid sequences are shown in Table 1.

[0032] Table 1 Primer sequences

[0033]

[0034] The Rift Valley fever virus S segment NP protein nucleic acid sequence (RVFV NP) is:

[0035] Before optimization:

[0036] ATGGACAACTATCAAGAGCTTGCGATCCAGTTTGCTGCTCAAGCAGTGGACCGCAATGAGATTGAACAGTGGGTCCG

[0037] AGAGTTTGCTTATCAAGGATTTGATGCCCGTAGGGTTATCGAACTCTTGAAGCAGTATGGTGGGGCCGACTGGGAGAA

[0038] GGATGCCAAGAAAATGATTGTTCTGGCTCTAACTCGTGGCAACAAGCCCCGGAGGATGATGATGAAAATGTCAAAAG

[0039] AGGGCAAGGCTACTGTGGAGGCTCTCATCAACAAGTACAAGCTGAAGGAAGGGAATCCCTCCCGGGATGAGTTGAC

[0040] TCTATCACGAGTCGCTGCCGCCCTGGCTGGCTGGACATGCCATGCTTTGGTCGTCTTGAGTGAGTGGCTTCCTGTCAC

[0041] TGGGACTACCATGGACGGCCTATCCCCTGCATACCCGAGGCATATGATGCACCCCAGCTTTGCTGGCATGGTGGACCC

[0042] TTCTCTGCCAGAAGACTATCTAAGGGCGATATTGGATGCTCACTCTCTGTATCTGCTGCAGTTCTCCCGGGTCATCAAC

[0043] CCAAACCTCCGAGGTAGAACAAAAGAGGAGGTTGCTGCAACGTTCACGCAGCCAATGAATGCAGCAGTGAATAGCA

[0044] ACTTTATAAGCCATGAGAAGAGGAGAGAATTCTTGAAAGCCTTTGGACTTGTGGATTCCAATGGGAAGCCGTCAGCTGCTGTCATGGCAGCCGCTCAGGCTTACAAGACAGCAGCC。

[0045] Optimized:

[0046] ATGGACAACTACCAGGAGCTGGCCATCCAGTTCGCCGCCCAGGCCGTGGACAGGAACGAGATCGAGCAGTGGGTGA

[0047] GGGAGTTCGCCTACCAGGGCTTCGACGCCAGGAGGGTGATCGAGCTGCTGAAGCAGTACGGCGGCGCCGACTGGGA

[0048] GAAGGACGCCAAGAAGATGATCGTGCTGGCCCTGACCAGGGGCAACAAGCCCAGGAGGATGATGATGAAGATGTCC

[0049] AAGGAGGGCAAGGCCACCGTGGAGGCCCTGATCAACAAGTACAAGCTGAAGGAGGGCAACCCCTCCAGGGACGAG

[0050] CTGACCCTGTCCAGGGTGGCCGCCGCCCTGGCCGGCTGGACCTGCCACGCCCTGGTGGTGCTGTCCGAGTGGCTGCC

[0051] CGTGACCGGCACCACCATGGACGGCCTGTCCCCCGCCTACCCCAGGCACATGATGCACCCCTCCTTCGCCGGCATGGT

[0052] GGACCCCTCCCTGCCCGAGGACTACCTGAGGGCCATCCTGGACGCCCACTCCCTGTACCTGCTGCAGTTCTCCAGGG

[0053] TGATCAACCCCAACCTGAGGGGCAGGACCAAGGAGGAGGTGGCCGCCACCTTCACCCAGCCCATGAACGCCGCCGT

[0054] GAACTCCAACTTCATCTCCCACGAGAAGAGGAGGGAGTTCCTGAAGGCCTTCGGCCTGGTGGACTCCAACGGCAAGCCCTCCGCCGCCGTGATGGCCGCCGCCCAGGCCTACAAGACCGCCGCC。

[0055] 1.4 CHO-K1 G418 Sensitivity Test and Construction of CHO-K1 NP Stable Expression Cell Line

[0056] Due to the differences in tolerance of different eukaryotic cell lines to G418 drugs, the sensitivity of CHO-K1 cells used in this study to G418 needs to be determined to determine the G418 drug concentration for subsequent screening of stable expression cells. The cells to be tested were diluted to 10000 cell / mL and cultured in a 12-well cell culture plate, 1 mL per well. Different concentrations of G418 drugs were added to each well, namely 0μg / mL, 100μg / mL, 200μg / mL, 300μg / mL, 400μg / mL, 500μg / mL, 600μg / mL, 700μg / mL, 800μg / mL, 900μg / mL, 1000μg / mL, 1100μg / mL, and cultured for 14 days. The lowest concentration at which all cells died determined the G418 drug concentration used for screening stable expression cells.

[0057] The pCDNA3.1-RVFVNP-His eukaryotic expression plasmid was linearized by single restriction digestion using BsmI endonuclease, and CHO-K1 cells were plated in a six-well plate. When the cell density reached 80%, the recovered linearized plasmid was transfected into CHO-K1 cells using ExFect transfection reagent, and the cell culture medium was replaced after 8 hours. After transfection for 48 hours, the cells were digested and transferred into a 25 cm 2 Continue to culture in the cell culture flask, and continue to add G418 in the subsequent culture to pressure screen the cells. After about 7-10 days of pressure screening, the cells are identified by IFA. Use flow cytometry to sort the cells into a 96-well plate at 1 cell per well. After 7-14 days, select monoclonal cell colonies for Western blot experiments, select positive cell lines with target bands for continued passage, and freeze for later use.

[0058] 1.5 Preparation and purification of RVFV NP protein

[0059] The obtained CHO-K1 NP stable expression cell line was expanded and subcultured into a cell factory, cultured with F12K culture medium containing 1% FBS, and the cell supernatant was collected every 3 days. The protein was purified using a nickel column Ni Resin FF, and the purification steps were carried out according to the instructions. The protein purification washing / elution solution containing 20mM, 50mM, 100mM, 150mM, and 250mM imidazole was used for washing / elution, and the outflow liquid was collected for subsequent identification. The purified protein sample was detected by SDS-PAGE, and the protein purity was analyzed by Coomassie Brilliant Blue staining. Finally, the collected protein was desalted and concentrated by a gravity desalting column, and the concentration was determined using a BCA kit.

[0060] 1.6 Preparation, purification and HRP labeling of mouse anti-NPMAb

[0061] 1.6.1 Animal immunization

[0062] The NP prepared in step 1.5 was used as an immunogen and mixed with Freund's complete adjuvant in a ratio of 1:1 for emulsification, and four 6-week-old BALB / c female mice were immunized by multiple subcutaneous injections on the back. Immunization was performed once every three weeks, for a total of three times, with an immunization dose of 200 μg / mouse / time. Starting from the second immunization, Freund's incomplete adjuvant was used instead of complete adjuvant, and the immunization method was the same as the first immunization. On the 7th day after the third immunization, blood was collected from the tail tip of the mouse, and the serum was separated. The NP prepared in step 1.5 was used as the coating antigen, and the serum of the mice in the blank control group was used as the negative control. The specific operation steps are as follows:

[0063] (1) Coating: NPs were diluted to 0.2 μg / mL using coating solution (0.05 M carbonate buffer, pH 9.6), and 100 μL / well was added to the ELISA plate. The plates were coated overnight at 4°C, washed five times with PBST, and then patted dry.

[0064] (2) Blocking: Add blocking solution (0.01 M PBS with pH 7.2 containing 1% BSA) at 200 μg / well, block at 37°C for 2 h, wash 5 times with PBST and pat dry;

[0065] (3) Sample incubation: The serum to be tested and the mouse negative serum were diluted 2-fold starting from 1:100 with PBS, incubated at 37°C for 1 h, washed 5 times with PBST, and patted dry;

[0066] (4) Antibody incubation: dilute HRP-goat anti-mouse IgG at a ratio of 1:2000, incubate at 37°C for 1 h, wash five times with PBST, and pat dry;

[0067] (5) Color development: Add 100 μL of ELISA color development solution to each well and incubate at 37°C for 15 min.

[0068] (6) Determine OD450nm value: Add 50 μL ELISA stop solution and detect OD450nm value using an enzyme reader.

[0069] The lowest dilution with P / N ≥ 2 is the anti-NP antibody titer in the serum, and 4 replicate wells are designed for each dilution. According to the test results, mice that meet the fusion standard and have the highest serum antibody titer are selected for subsequent fusion experiments. 3 days before fusion, 100 μg of RVFVNP protein without adjuvant is injected intraperitoneally for booster immunization.

[0070] 1.6.2 Fusion and screening of hybridoma cells

[0071] Three days after booster immunization, blood was collected from the infraorbital sinus of the mice, and serum was separated and kept as a positive control. The specific steps of cell fusion are as follows:

[0072] (1) Preparation of feeder cells: Three 6-week-old female BALB / c mice were euthanized and the peritoneum of the mice was exposed aseptically. 1640 complete medium containing 10% FBS was injected, and the suspended macrophages were repeatedly rinsed. The rinsing fluid was collected and plated into a 96-well cell plate for later use;

[0073] (2) Recovery of S / P20 cells: Recover S / P20 cells frozen in liquid nitrogen and passage them for more than 3 times before use;

[0074] (3) Spleen removal: The mice were euthanized 3 days after booster immunization, and the spleens were removed aseptically. 10 mL of 1640 culture medium was drawn up with a sterile syringe needle and repeatedly rinsed on the spleen until the spleen turned white.

[0075] (4) Filtration: Filter the 1640 culture medium containing spleen cells through a 70 μm cell mesh and count the cells;

[0076] (5) Fusion: Blow apart the S / P20 cells, centrifuge and discard the supernatant, resuspend in 10 mL 1640 culture medium, and count the cells; mix spleen cells and S / P20 cells at a ratio of 9:1, centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend the cells in 1 mL 1640 culture medium. Add 1 mL PEG1450 cell fusion agent within 1 min, shake well while adding, and let stand for 90 s;

[0077] (6) Termination of fusion: Slowly add 10 mL of 1640 medium to terminate fusion, and shake well while adding. Centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend the cells in 10 mL of 1640 medium. Repeat 3 times;

[0078] (7) Plating: Mix the cells with pre-warmed 1640 complete culture medium containing 2% HAT, 10% FBS, and 1% penicillin-streptomycin, and add the cell suspension to the feeder layer cells of a 96-well plate at 200 μL / well;

[0079] (8) Screening: On the 5th day after fusion, replace the culture medium of hybridoma cells (1640 complete culture medium containing 2% HAT, 10% FBS, and 1% penicillin-streptomycin). On the 9th day after fusion, observe the cell growth, select wells with good growth conditions, and collect cell supernatants for ELISA experiments. Use RVFVNP as the coating antigen, and the steps are the same as described in 1.6.1. Use P / N>2 as the standard for screening positive results, continue to subculture and expand the culture, and replace the screening culture medium with 1640 complete culture medium containing 2% HT, 10% FBS, and 1% penicillin-streptomycin.

[0080] 1.6.3 Monoclonal Antibody Subtype Identification

[0081] The antibody typing identification kit was used to determine the subtype of the obtained monoclonal antibody for subsequent purification and use. The specific operation steps were carried out according to the instructions.

[0082] 1.6.4 Preparation of mouse ascites and purification, titer detection and HRP labeling of monoclonal antibodies

[0083] (1) Preparation of ascites: 500 μL of paraffin oil was injected intraperitoneally into mice. Three days later, 1×10 6 hybridoma cells, and ascites was collected on the 7th day after immunization;

[0084] (2) Purification of monoclonal antibodies: Antibodies were purified using rProtein L4FF protein purification prepacked columns. The specific operation steps were carried out according to the instructions. The antibody concentration was determined and the antibody titer was detected by Western blot and indirect ELISA. HRP labeling (named 5D8-HRP) was performed by Harbin Mule Biological Reagent Co., Ltd.

[0085] 1.7 Preparation and purification of rabbit anti-NPPc Ab

[0086] RVFVNP protein was mixed with Freund's complete adjuvant in a ratio of 1:1 and emulsified, and then immunized into 2-3 kg female New Zealand white rabbits. 1 mg / rabbit was injected subcutaneously at multiple points on the back for immunization. The second and third immunizations were performed two weeks after the first immunization. One week after the third immunization, blood was collected from the ear vein to measure the serum antibody titer, and blood was collected from the heart to purify the antibodies.

[0087] 1.8 Establishment of double antibody sandwich ELISA method

[0088] 1.8.1 Optimization of reaction conditions for double antibody sandwich ELISA method

[0089] The capture antibody rabbit anti-NP PcAb coating amount (2 μg / well, 0.2 μg / well, 0.02 μg / well) and the detection antibody 5D8-HRP dilution were optimized. 2and detection range to determine the optimal reaction conditions: the coating time of capture antibody (4℃ overnight, 37℃ 2h, 37℃ 2h + 4℃ overnight), blocking solution (10% FBS, 5% skim milk, 0.5% PVA, 1% BSA), blocking time (37℃ 0.5h, 37℃ 1h, 37℃ 1.5h, 37℃ 2h, 37℃ 3h), antigen reaction time (37℃ 1h, 37℃ 1.5h, 37℃ 2h, 37℃ 2.5h), sample diluent (10% FBS, 10% horse serum, 10% rabbit serum, 0.5% gelatin, 1% BSA, 2% BSA), detection antibody reaction time (37℃ 20min, 37℃ 30min, 37℃ 40min, 37℃ 50min, 37℃ 60min) and TMB substrate reaction time (1min, 5min, 10min) were optimized respectively, and the optimal reaction conditions were determined according to the P / N value.

[0090] 1.8.2 Establishment of the standard curve for NP protein determination using the double antibody sandwich ELISA method

[0091] The optimized reaction conditions were used to detect the RVFVNP protein with an initial concentration of 0.5 mg / ml and its 2-fold dilution (2 1 -2 12 ), the optimized double antibody sandwich ELISA method was used for detection, and OD 450nm The value is the horizontal axis, and the corresponding NP concentration is the vertical axis. Draw the NP protein standard curve (such as Figure 5 ).

[0092] 1.9 Determination of positive and negative critical values

[0093] 21 RVFVNP negative samples were tested by the optimized double antibody sandwich ELISA method, and the S / P value was calculated. S / P value = (sample OD 450nm - Negative sample OD 450nm ) / (positive sample OD 450nm - Negative sample OD 450nm ), calculate the average S / P value of each sample and standard deviation SD, when the sample S / P value When the sample S / P value> When , it is judged as positive; Sample S / P value Judged as suspected.

[0094] Example 2 Preparation and detection of monoclonal antibodies

[0095] 2.1 Construction and identification of RVFV NP eukaryotic expression plasmid and RVFV NP stable expression cell line

[0096] The recombinant plasmid pCDNA3.1-RVFV NP-His was constructed using homologous recombination technology. The purified plasmid was digested and identified using nucleases KpnI and EcoRI to obtain two nucleic acid fragments of approximately 5.4 kb and 0.75 kb, respectively. The plasmid construction was verified to be correct by sequencing. CHO-K1 cells all died within 14 days when the G418 concentration was 800-900 μg / ml, so 900 μg / ml of G418 was added as the pressure screening concentration for the CHO-K1 cell line.

[0097] After pCDNA3.1-RVFVNP-His was transfected into CHO-K1 cells, a RVFVNP stable expression cell line was obtained by the method described above. After expansion culture, Western blot experiments were performed using the screened CHO-K1 RVFV NP monoclonal cell line and CHO-K1 cell lysate and corresponding cell supernatant. The experimental results are shown in Figure 1 As shown. The RVFV NP protein is encoded by 735 nucleotides, with a molecular weight of approximately 27.4 kDa. The experimental sample bands were consistent with expectations, proving that the cell line was successfully constructed, the rNP cell line; the rNP cell line can express RVFV recombinant NP in the cell culture supernatant, named RVFV rNP.

[0098] 2.2 Preparation and purification of RVFV NP eukaryotic expression protein

[0099] The obtained RVFV rNP cell line was expanded to a cell factory, and the collected cell supernatant was filtered through 0.22μm and combined with a nickel column Ni Resin FF. The protein elution solution with different concentrations of imidazole was used for elution. It can be seen that the eluted target protein band is relatively single, with a size of about 27.4kDa, which is in line with expectations. In the process of protein purification, a 150mM imidazole washing solution was used for washing, and a 250mM imidazole protein elution solution was used for elution. The protein concentration was measured using a spectrophotometer. The target protein content in the supernatant of the eukaryotic expression cell line was about 2mg / L. After purification, the concentration reached 1mg / mL and was stored at -80℃ for later use.

[0100] 2.3 Preparation, purification and HRP labeling of mouse anti-rNP MAb

[0101] After cell sorting and ELISA screening, a hybridoma cell line secreting anti-RVFVNP monoclonal antibodies was obtained, named RVFVNP-5D8, and was identified as IgG1, kappa type by a monoclonal antibody typing identification kit. The obtained ascites was purified using rProtein L4FF protein purification prepacked columns, and the purified antibody concentration was 1.28 mg / mL. The CHO-K1 RVFV rNP cell line was lysed with cell lysis buffer to prepare protein samples, and the antibodies were incubated with gradient dilutions. The titer of the mouse anti-NP protein MAb obtained by Western blot was 1:2000 (see Figure 3 C); RVFV rNP was coated in an ELISA plate, and the titer of mouse anti-NP mouse anti-NP MAb was 1:51200 (see Figure 3 A). Mouse anti-rNP MAb was sent to the company for HRP labeling and named 5D8-HRP. The concentration after labeling was 1.17 mg / mL.

[0102] 2.4 Preparation and titer detection of rabbit anti-rNP PcAb

[0103] The antibody was purified from the rabbit serum immunized with RVFV rNP using protein A+G column, and the antibody concentration was 1.56 mg / mL. The CHO-K1 RVFV rNP cell line was lysed with cell lysis buffer to prepare protein samples, and the antibody was incubated with gradient dilutions. The titer of rabbit anti-rNP PcAb obtained by Western blot was 1:10000 (see Figure 3 D); RVFV rNP protein was coated in an ELISA plate, and the titer of rabbit anti-rNPcAb was measured by indirect ELISA method to be 1:51200, named rab NP-1PcAb (see Figure 3 B).

[0104] Example 3 Evaluation of double antibody sandwich ELISA method

[0105] 3.1 Specificity test

[0106] The optimized double-antibody sandwich ELISA method was used to detect the NP samples of LSV, SARS-CoV-2, CCHFV, as well as the RVFV rNP and RVFV Gn protein samples, and the specificity of the method was evaluated according to the S / P value.

[0107] 3.2 Sensitivity test

[0108] The RVFV replication-deficient inactivated virus sample was diluted 2-fold (2 1 ~2 15), and the optimized double-antibody sandwich ELISA method was used to detect and evaluate the sensitivity of this method.

[0109] 3.3 Intra-batch repeatability test

[0110] Take the ELISA plates coated with the same batch and detect the RVFV-positive serum samples according to the optimized double-antibody sandwich ELISA method. Use the RVFVNP standard diluted 1:200 as the positive control, dilute the negative serum sample 1:200 as the negative control, and use the antigen-antibody dilution as the blank control. Measure the OD450nm value and calculate the intra-batch coefficient of variation.

[0111] 3.4 Batch repeatability test

[0112] Take ELISA plates from different batches and detect RVFV-positive serum samples according to the optimized double monoclonal antibody sandwich ELISA method. Set up negative, positive and blank controls as described in 2.3, calculate the inter-batch coefficient of variation, and evaluate the repeatability of the method.

[0113] Experimental Results

[0114] 3.5 Establishment of standard curve for double antibody sandwich ELISA method

[0115] 3.5.1 Optimization results of reaction conditions of double antibody sandwich ELISA method

[0116] The ELISA method uses the obtained rabbit polyclonal antibody against RVFV NP as the capture antibody, with a coating amount of 0.2 μg / well; the MAb 5D8 against RVFVNP is used as the detection antibody, with an optimal concentration of 2.24 ng / well. The optimal reaction conditions are shown in Table 2 and Figure 3 .

[0117] Table 2 Optimization results of the best reaction conditions of double antibody sandwich ELISA

[0118]

[0119] 3.5.2 Establishment of standard curve for double antibody sandwich ELISA method

[0120] The optimized double antibody ELISA method was used for detection. The results showed that the RVFVNP protein standard content was in the range of 9.375 ng / mL to 150 ng / mL, and the standard curve was y=136.5x-4.967, R 2 =0.9636. (See Figure 5 ).

[0121] 3.6 Determination of positive and negative critical values

[0122] The double antibody sandwich ELISA method was used to detect 21 RVFV NP negative samples. After calculation, the average S / P value was The standard deviation of S / P value SD=0.056. When the sample S / P value is less than 0.199, it is judged as negative; when the sample S / P value is greater than 0.235, it is judged as positive; when the sample S / P value is 0.199≤sample S / P value≤0.235, it is judged as suspected (Table 3).

[0123] Table 3 ELISA test results of 21 serum negative samples

[0124]

[0125] 3.7 Specificity test results

[0126] The optimized double antibody sandwich ELISA method was used to detect NP protein samples of RVFV, EBOV, CCHFV, SARS-CoV-2, and LASV as well as RVFV Gn protein samples stored in several laboratories. The results showed that (e.g. Figure 6 ), only RVFV NP was positive, and the S / P values ​​of the other viral proteins were all below 0.287, which were negative and had no cross-reaction. This showed that the double antibody sandwich ELISA detection method established in this study had good specificity.

[0127] 3.8 Sensitivity test results

[0128] The RVFV replication-deficient inactivated virus sample was diluted 2-fold (2 1 ~2 15 ) and then tested by antibody sandwich ELISA method. The results showed that the ELISA method 14 The results showed that the method had good sensitivity (such as Figure 7 ).

[0129] 3.9 Repeatability test results

[0130] The double antibody sandwich ELISA method established in this study was used to conduct intra-batch and inter-batch repeatability tests on RVFV NP-positive samples, and the coefficient of variation of the intra-batch and inter-batch repeatability tests was calculated. The results showed that the intra-batch coefficient of variation was 1.158%-3.827%, and the inter-batch coefficient of variation was 0.681%-7.011%, both less than 8%, indicating that the method has good repeatability and stability.

[0131] Table 4 Double antibody sandwich ELISA repeatability test results (n=6)

[0132]

Claims

1. A hybridoma cell line that secretes a monoclonal antibody against Rift Valley fever virus (RVFV) NP, the hybridoma cell line being named RVFV NP-5D8 hybridoma cell, the depository unit being the General Microbiology Center of China Microbiological Culture Collection Administration; the deposit number being CGMCC NO.45822, and the deposit time being March 1, 2024.

2. A monoclonal antibody against RVFV NP, the monoclonal antibody is obtained by secretion of the hybridoma cell line described in claim 1, the antibody is named 5D8 MAb, the hybridoma cell line is named RVFV NP-5D8 hybridoma cell, and the depository unit is the General Microbiology Center of China Microbiological Culture Collection Administration; the deposit number is CGMCC NO.45822, and the deposit time is March 1, 2024.

3. Use of a monoclonal antibody in the preparation of a reagent for detecting or diagnosing Rift Valley fever virus infection, wherein the monoclonal antibody is obtained by secretion of the hybridoma cell according to claim 1.

4. A double antibody sandwich ELISA kit for detecting Rift Valley fever virus, characterized in that: The kit comprises the monoclonal antibody according to claim 2 and a rabbit anti-RVFV NP polyclonal antibody, wherein the monoclonal antibody is labeled with HRP and used as a detection antibody, the labeled detection antibody is named 5D8-HRP, and the rabbit anti-RVFV NP polyclonal antibody is used as a capture antibody.

5. The double antibody sandwich ELISA kit for detecting Rift Valley fever virus as claimed in claim 4, wherein the kit further comprises a blocking solution, a diluent, a washing solution, a color developing solution and a stop solution.

6. The double antibody sandwich ELISA kit for detecting Rift Valley fever virus as claimed in claim 4, wherein the coating amount of the rabbit anti-RVFV NP polyclonal antibody is 0-0.5 μg / well.

7. The double antibody sandwich ELISA kit for detecting Rift Valley fever virus as claimed in claim 4, wherein the coating amount of the rabbit anti-RVFV NP polyclonal antibody is 0-0.2 μg / well.

8. The double antibody sandwich ELISA kit for detecting Rift Valley fever virus as claimed in claim 4, wherein the detection antibody is 5D8-HRP, and the amount of the detection antibody is 0-2.24 ng / well.

Images