ELISA Kit for Detecting Triclosan Residue Based on Nanobody and Its Application

Through the ELISA kit based on anti-triclosan nanoantibodies, the problem of complex and high cost of triclosan residue detection in the prior art is solved, and a fast, accurate and economical detection effect is achieved.

CN115825424BActive Publication Date: 2025-06-17CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211021877.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-24
Publication Date
2025-06-17
Estimated Expiration
2042-08-24

AI Technical Summary

Technical Problem

The existing triclosan residue detection methods require professional laboratories and equipment, and the sample preprocessing is complex and costly, making it difficult to meet the needs of rapid on-site monitoring of large numbers of samples.

Method used

The enzyme-linked immunosorbent assay method based on anti-triclosan nanoantibodies was adopted to achieve rapid and simple detection through the ELISA kit. Nanobody has high specificity and affinity, and can be produced in large quantities in prokaryotic expression systems, reducing production costs.

Benefits of technology

Accurate and sensitive detection of triclosan residues in water, soil and vegetables, simple pre-processing of samples, and can detect a large number of samples at the same time, and the detection cost is much lower than that of traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115825424B_ABST
    Figure CN115825424B_ABST
Patent Text Reader

Abstract

The present invention provides an ELISA kit for detecting triclosan residues based on nanobody and its application. The kit includes a box body, a detachable enzyme-labeled plate disposed in the box body, and reagents disposed in the box body; wherein, each well of the enzyme-labeled plate is coated with a triclosan artificial antigen, and the reagents include the nanobody shown in SEQ ID NO:1, as well as a triclosan standard solution, an enzyme-labeled secondary antibody, a PBS buffer solution, a PBST washing solution, a chromogenic solution, a reaction termination solution, etc. The kit of the present invention can accurately and sensitively detect triclosan residues in environments such as water, soil, and vegetables. The sample pretreatment process is simple and time-consuming less, and a large number of samples can be detected simultaneously. The sample detection cost is much lower than the traditional instrument detection method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering, phage display technology and ELISA detection technology. Specifically, it relates to an ELISA kit for detecting triclosan residues based on nanobody and its application. Background Art

[0002] Triclosan (TCS), as a commonly used antibacterial agent, is widely used in personal care products and medical supplies. The widespread use of TCS has led to its presence in surface water, groundwater, soil and vegetables. Due to the characteristics of TCS such as lipophilicity, bioaccumulation and biotoxicity, it poses a threat to aquatic organisms, mammals and humans. Some studies have shown that TCS can interfere with human hormone secretion, inhibit the growth of algae, and generate harmful and toxic substances such as dioxins under conditions such as light. Therefore, it is necessary to strengthen the detection of triclosan residues to ensure ecological environment safety and human health.

[0003] Currently reported triclosan residue detection methods are mainly instrumental analysis methods, including high performance liquid chromatography (HPLC) and gas chromatography-mass spectrometry or liquid chromatography-mass spectrometry (GC-MS or LC-MS), etc. However, these methods require professional laboratories, dedicated instrument equipment and professional operators, and the sample pretreatment is complex, and the analysis cost is high, which is difficult to meet the need for rapid on-site monitoring of a large number of samples. Immunoassay technology has the advantages of simplicity, rapidity, low cost, high efficiency, strong specificity, high sensitivity, etc., and is widely used in the fields of diagnosis, environmental monitoring, food quality, agriculture, etc.

[0004] The enzyme-linked immunosorbent assay method based on conventional antibodies (polyclonal antibodies and monoclonal antibodies) has relatively low stability and specificity, while nanobodies have the advantages of high specificity, strong affinity, can be mass-produced in prokaryotic expression systems, low production cost, and strong resistance to harsh environments. Therefore, the present invention is based on anti-triclosan nanobodies to establish an enzyme-linked immunosorbent assay method. Summary of the Invention

[0005] The purpose of the present invention is to provide an ELISA kit for detecting triclosan residues based on nanobody and its application.

[0006] The enzyme-linked immunosorbent assay method for triclosan residues based on conventional antibodies (polyclonal antibodies and monoclonal antibodies) has relatively low stability. The present invention is based on anti-triclosan nanobodies and uses the enzyme-linked immunosorbent assay method to detect its residues.

[0007] To achieve the purpose of the present invention, in the first aspect, the present invention provides an anti-triclosan nanobody, and the nanobody comprises the following amino acid sequence or consists of the following amino acid sequence:

[0008] i) The amino acid sequence shown in SEQ ID NO: 1; or

[0009] ii) An amino acid sequence obtained by connecting a tag to the N-terminus and / or C-terminus of i); or

[0010] iii) An antibody with the same function obtained by substituting, deleting, and / or adding one or more amino acids to the amino acid sequence of i) or ii).

[0011] In a second aspect, the present invention provides a nucleic acid molecule encoding the nanobody.

[0012] In a third aspect, the present invention provides a biological material containing the nucleic acid molecule, and the biological material includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, or engineered bacteria.

[0013] In a fourth aspect, the present invention provides a triclosan detection reagent or kit, and its active ingredient is the nanobody.

[0014] In a fifth aspect, the present invention provides an ELISA kit for detecting triclosan residues based on nanobody. The kit includes a box body, a detachable enzyme-linked immunosorbent assay (ELISA) plate provided in the box body, and reagents provided in the box body; each well of the ELISA plate is coated with a triclosan artificial antigen, and the reagents include the nanobody, and at least one of a triclosan standard solution, an enzyme-labeled secondary antibody, a PBS buffer solution, a PBST washing solution, a chromogenic solution, and a reaction termination solution.

[0015] Further, the triclosan artificial antigen is obtained by conjugating the triclosan hapten shown in formula (I) with a carrier protein;

[0016]

[0017] Among them, the carrier protein can be selected from at least one of bovine serum albumin, keyhole limpet hemocyanin, ovalbumin, thyroglobulin, human serum albumin, etc., and preferably bovine serum albumin and keyhole limpet hemocyanin.

[0018] Further, the preparation method of the antigen coating solution for coating the ELISA plate includes:

[0019] (1) Dissolve 7.5 mg of the triclosan hapten shown in formula (I), 2.65 mg of N-hydroxysuccinimide, and 4.8 mg of N,N'-dicyclohexylcarbodiimide in 200 μL of anhydrous dimethylformamide, and stir overnight at room temperature; centrifuge the reaction solution, discard the precipitate, and collect the supernatant;

[0020] (2) Dissolve 20 mg of bovine serum albumin in 2 mL of 0.05 M carbonate buffer solution with a pH of 9.6, and gradually add the supernatant dropwise under stirring. After adding, continue to stir and react at room temperature for 4 h;

[0021] (3) After the reaction is completed, the reaction solution is filled into a dialysis bag and dialyzed with PBS solution; the solution is changed every 6 h, and the solution is changed 5 - 6 times in total; after dialysis, centrifuge, discard the precipitate, and collect the supernatant as the antigen coating solution.

[0022] Preferably, the enzyme - linked immunosorbent assay (ELISA) plate is a 96 - well ELISA plate, and the coating concentration of the coated antigen is 50 - 70 ng / mL.

[0023] Preferably, the concentration of the nanobody is 90 - 100 ng / mL.

[0024] Preferably, the enzyme - labeled secondary antibody is an anti - HA tag antibody labeled with horseradish peroxidase, and the concentration is 0.1 μg / mL.

[0025] Preferably, the chromogenic solution includes solution A and solution B. Solution A is prepared by dissolving 1 g of urea peroxide, 10.3 g of citric acid, 35.8 g of Na2HPO4·12H2O, 100 μL of Tween - 20 and 1000 mL of distilled water, and the pH value is 5; solution B is prepared by dissolving 700 mg of 3,3′,5,5′ - tetramethylbenzidine, 40 mL of DMSO, 10.3 g of citric acid and 1000 mL of distilled water, and the pH value is 2.4.

[0026] Preferably, the reaction termination solution is a 2M sulfuric acid solution.

[0027] In the sixth aspect, the present invention provides any one of the following applications of the nanobody:

[0028] 1) For the detection of triclosan;

[0029] 2) For the preparation of triclosan detection reagents or kits;

[0030] 3) For the enrichment and purification of triclosan;

[0031] 4) For the preparation of triclosan enrichment and purification reagents.

[0032] In the seventh aspect, the present invention provides the application of the detection reagent or kit, the ELISA kit, in the detection of triclosan residues in samples.

[0033] During the detection using the ELISA kit, the coated antigen adsorbed on the well wall of the ELISA plate and the triclosan to be detected compete with each other for reaction with the antibody, and the result is observed through a chromogenic reaction. By detecting triclosan with known concentrations and plotting a standard curve, the concentration of triclosan in the sample to be detected can be deduced.

[0034] The advantages of the present invention are that it can accurately and sensitively detect the residual triclosan in the environment such as water, soil and vegetables. The pretreatment process of the sample is simple and time-consuming less, and it can detect a large number of samples at the same time. The sample detection cost is much lower than the traditional instrument detection method. The present invention can realize the on-site monitoring of the residual triclosan in a large number of samples, and has broad application prospects. Brief Description of the Drawings

[0035] Figure 1 It is the standard inhibition curve of triclosan based on nanobody in the preferred embodiment of the present invention. Among them, the curve regression equation is y = 0.014 + 0.9932 / [1+(x / 7.56)^1.7672] (R 2 = 0.99), the inhibitory concentration of 50% is IC 50 = 7.7 ng / mL, and the lowest detection limit is IC 20 = 3.6 ng / mL. Detailed Description of the Invention

[0036] In view of the disadvantages of the current instrumental analysis methods for pesticide residues, such as high cost, complex pretreatment, poor specificity, low sensitivity and difficulty in on-site detection, the present invention provides an ELISA detection kit for analyzing the residual triclosan, which has high specificity, high sensitivity, high accuracy, high precision, simple operation method, and can be used for rapid detection of a large number of samples. It is suitable for the rapid determination of the residual triclosan in samples such as water, soil and vegetables.

[0037] The present invention adopts the following technical solutions:

[0038] In the first aspect, the present invention provides a nanobody against triclosan, and the nanobody comprises the following amino acid sequence or consists of the following amino acid sequence:

[0039] i) the amino acid sequence shown in SEQ ID NO:1; or

[0040] ii) the amino acid sequence obtained by connecting a tag at the N-terminus and / or C-terminus of i); or

[0041] iii) the antibody with the same function obtained by substituting, deleting and / or adding one or more amino acids to the amino acid sequence of i) or ii).

[0042] The nanobody can be prepared by the following method: Synthesize the triclosan hapten T1 shown in formula I), 4-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)butyric acid, by chemical reaction. After conjugating the hapten with keyhole limpet hemocyanin as the immunogen, immunize the experimental animal camel, extract the total RNA of peripheral blood lymphocytes, clone the nanobody heavy chain (VHH) gene fragment through reverse transcription and nested PCR, clone the gene fragment into a phagemid vector by restriction enzyme digestion and ligation, electrotransform it into Escherichia coli efficiently, and construct a phage nanobody library through helper phage rescue. Screen out the anti-triclosan nanobody, express and purify it to obtain a highly sensitive anti-triclosan nanobody. The prepared nanobody has a small molecular size, strong solubility, high temperature resistance, easy purification, and easy expression.

[0043] In a second aspect, the present invention provides a nucleic acid molecule encoding the nanobody.

[0044] In a third aspect, the present invention provides a biological material containing the nucleic acid molecule, and the biological material includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, phage vector, viral vector, or engineered bacteria.

[0045] In a fourth aspect, the present invention provides a triclosan detection reagent or kit, and the active ingredient is the nanobody.

[0046] In a fifth aspect, the present invention provides a triclosan hapten T1, which is 4-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)butyric acid. The structural formula is shown in formula I):

[0047]

[0048] In a sixth aspect, the present invention provides a triclosan artificial antigen obtained by conjugating the triclosan hapten with a carrier protein.

[0049] Among them, the carrier protein is selected from bovine serum albumin and keyhole limpet hemocyanin. The carrier protein is conjugated to the carboxyl group of the triclosan hapten by the active ester method.

[0050] In a seventh aspect, the present invention provides an ELISA detection kit for analyzing triclosan residues, including a box body, a detachable enzyme-linked immunosorbent assay (ELISA) plate arranged in the box body, and reagents arranged in the box body. Among them, each well of the ELISA plate is coated with triclosan antigen T1, and the reagents include at least one of the nanobody, triclosan standard solution, enzyme-labeled secondary antibody, buffer PBS, washing solution PBST, chromogenic solution (solution A), chromogenic solution (solution B), and reaction termination solution, etc.

[0051] Among them, the triclosan hapten T1 can be prepared by the following method:

[0052] A mixture of triclosan (400 mg, 1.38 mmol), tert-butyl 4-bromobutyrate (399 mg, 1.79 mmol) and potassium carbonate (286 mg, 2.07 mmol) in 2 mL of anhydrous DMF was reacted at 100 °C for 3 h. The resulting mixture was filtered to remove the excess K2CO3 and HBr generated during the reaction. The filtrate diluted with 20 mL of ethyl acetate was washed twice with 20 mL of distilled water. The organic layer was dried over anhydrous sodium sulfate and the solvent was removed by rotary evaporation. The residue was chromatographed on silica gel and eluted with a mixture of ethyl acetate / hexane (1:2, v / v). The fraction containing the pure product was stripped by thin layer chromatography under high vacuum to give 179 mg of a transparent oily compound.

[0053] 0.5 mL of trifluoroacetic acid (TFA) was added to the above transparent oily compound, and the mixture was allowed to stand at ambient temperature for 30 min. After adding 50 mL of distilled water and acidifying to pH 2 with 6N HCl, the mixture was extracted twice with 50 mL of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and the solvent was removed by rotary evaporation. The concentrate was recrystallized from a mixture of ethyl acetate and hexane to give the triclosan hapten T1.

[0054] The triclosan-coated antigen is a conjugate complex of the hapten T1 and bovine serum albumin, and the preparation method of the coated antigen is as follows: (1) 7.5 mg of the hapten, 2.65 mg of N-hydroxysuccinimide and 4.8 mg of N,N'-dicyclohexylcarbodiimide were dissolved in 200 μL of anhydrous dimethylformamide and stirred overnight at room temperature. The reaction solution was centrifuged (5000 rpm, 10 min), the precipitate was discarded, and the supernatant was collected. The supernatant contained the active ester. (2) 20 mg of bovine serum albumin was dissolved in 2 mL of 0.05 M carbonate buffer at pH 9.6, and the supernatant was added dropwise with stirring. The addition was slow, and it took about 20 min to add. Then the reaction was continued to stir at room temperature for 4 h. (3) After the reaction was completed, the reaction solution was placed in a dialysis bag and dialyzed with PBS (0.01 mol / L, pH 7.4); the solution was changed every 6 h, and a total of 5 - 6 times of solution change were performed. After dialysis, it was centrifuged, the precipitate was discarded, and the supernatant was collected as the antigen coating solution.

[0055] The enzyme-linked immunosorbent assay (ELISA) plate is a 96-well ELISA plate, and the coating concentration of the coated antigen is 60 ng / mL.

[0056] The concentration of the nanobody is 100 ng / mL.

[0057] The enzyme-labeled secondary antibody is a horseradish peroxidase-labeled anti-HA tag antibody with a concentration of 0.1 μg / mL. It is purchased from Abcam, and the product number is ab1265.

[0058] The chromogenic solution A is prepared from 1 g of urea peroxide, 10.3 g of citric acid, 35.8 g of Na2HPO4·12H2O, 100 μL of Tween-20 and 1000 mL of distilled water, with a pH value of 5.

[0059] The chromogenic solution B is prepared from 700 mg of tetramethylbenzidine, 40 mL of DMSO, 10.3 g of citric acid and 1000 mL of distilled water, with a pH value of 2.4.

[0060] The reaction termination solution is a 2M sulfuric acid solution.

[0061] In an eighth aspect, the present invention provides the use of the polypeptide in detecting triclosan residues in a sample by ELISA.

[0062] In a ninth aspect, the present invention provides a triclosan ELISA detection reagent, the active ingredient of which is the said nanobody.

[0063] In a tenth aspect, the present invention provides the use of the said kit or the said reagent in detecting triclosan residues in a sample by ELISA.

[0064] During analysis and detection, the sample to be detected for triclosan and the said nanobody are sequentially added to each well of the enzyme-linked immunosorbent assay (ELISA) plate coated with the triclosan-coated antigen. The solid-phase coated antigen and the triclosan to be detected compete with each other for reaction with the nanobody. Since the content of the solid-phase antigen and the added single-chain antibody in each well is the same, when the concentration of the triclosan to be detected is high, the amount of antibody bound to the solid-phase antigen is small, and the amount of the added enzyme-labeled secondary antibody bound to the immobilized antibody is small. Finally, the substrate solution and the chromogenic solution are added, and the chromogenic reaction is light, and the OD value detected by the microplate reader is low, indicating a high inhibition rate; conversely, when the concentration of the triclosan to be detected is low, the measured OD value is high and the inhibition rate is low. According to the standard curve plotted by detecting with a triclosan standard solution of known concentration, the concentration of the triclosan to be detected can be deduced.

[0065] The present invention further provides a triclosan ELISA detection reagent, the active ingredient of which is the anti-triclosan nanobody.

[0066] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the examples are carried out under conventional experimental conditions, such as those described in the Molecular Cloning Experiment Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Example 1 Preparation of Triclosan-Coated Antigen

[0067] The conjugate complex was prepared with the hapten 4-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)butyric acid and bovine serum albumin as the coating antigen. The preparation method is as follows:

[0068] (1) Dissolve 7.5 mg of 4-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)butyric acid, 2.65 mg of N-hydroxysuccinimide and 4.8 mg of N,N'-dicyclohexylcarbodiimide in 200 μL of anhydrous dimethylformamide, and stir overnight at room temperature; centrifuge the reaction solution, discard the precipitate, and collect the supernatant;

[0069] (2) Dissolve 20 mg of bovine serum albumin in 2 mL of 0.05 M carbonate buffer solution with pH 9.6, and add the supernatant dropwise with stirring. After adding, continue to stir and react at room temperature for 4 h;

[0070] (3) After the reaction is completed, place the reaction solution in a dialysis bag and dialyze it with PBS solution; change the solution every 6 h, and change the solution 5-6 times in total; after dialysis, centrifuge, discard the precipitate, and collect the supernatant as the antigen coating solution.

[0071] Example 2 Construction of the triclosan nanobody library

[0072] The hapten of Example 1 was conjugated with keyhole limpet hemocyanin by the active ester method. The specific method is as follows:

[0073] Dissolve equimolar amounts of 4-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)butyric acid, NHS and DCC in DMF, and stir overnight at room temperature. Centrifuge the reaction solution to discard the precipitate, and the supernatant is the active ester. Add the supernatant to the keyhole limpet hemocyanin solution with stirring, and continue to stir and react at room temperature for 4 h. Place the reaction solution in a dialysis bag and dialyze it with PBS. Centrifuge and collect the supernatant. After freeze-drying, the conjugate of 4-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)butyric acid and keyhole limpet hemocyanin is obtained.

[0074] Dissolve 1 mg of the conjugate in 1 mL of physiological saline, mix it with 1 mL of complete Freund's adjuvant, fully emulsify it and inject it into the camel. Then, boost the immunity every two weeks, change to incomplete Freund's adjuvant and mix it with the immunogen, and immunize subcutaneously at multiple points on the back of the neck. Immunize a total of 5 times. Starting from the third immunization, collect blood from the jugular vein one week after each immunization to detect the serum titer.

[0075] Isolate white blood cells from the peripheral blood after the 5th immunization, extract total RNA, clone the VHH gene fragment by reverse transcription PCR and nested PCR, modify the sticky ends with the restriction enzyme SfiI, and ligate the VHH gene fragment to the phagemid pComb3x through T4 ligase, and electrotransform it into Escherichia coli ER2738 efficiently to construct the phage nanobody library of triclosan. After measurement, the primary library capacity reaches 108 cfu, add helper phage (multiplicity of infection is 20:1) M13KO7 for rescue to obtain a phage nanobody library with a library capacity of 10 12 pfu / mL, and the diversity of the library is good.

[0076] Reverse transcription PCR:

[0077] The reverse transcription kit uses PrimeScript TM RT-PCR Kit, purchased from TaKaRa, product number: AK2701.

[0078] The reverse transcription system is as follows:

[0079]

[0080]

[0081] React at 65°C for 5 min. Take out and place on ice, add samples according to the following system for the first-strand cDNA synthesis.

[0082]

[0083] Reaction conditions: 30°C for 10 min; 42°C for 1 h; 72°C for 5 min.

[0084] Nested PCR:

[0085] The first round of PCR:

[0086] The reaction system is as follows:

[0087]

[0088] The reaction program is as follows: Pre-denature at 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, 72°C for 50 s, 25 cycles; 72°C for 5 min.

[0089] The second round of PCR:

[0090] The reaction system is as follows:

[0091]

[0092]

[0093] The reaction program is as follows: Pre-denature at 94°C for 3 min; 94°C for 30 s, 62°C for 40 s, 72°C for 40 s, 25 cycles; 72°C for 5 min.

[0094] The primer sequences for nested PCR are as follows (5′-3′):

[0095] GSP-RT: CGCCATCAATRTACCAGTTGA

[0096] LP-leader: GTGGTCCTGGCTGCTCTW

[0097] F: CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC

[0098] R: CATGCCATGACTCGCGGCCGGCCTGGCCTGGTTGTGGTTGTGGTTGT

[0099] Among them, R represents base A / G, W represents base A / T, and K represents base G / T.

[0100] Example 3 Screening of triclosan nanobody

[0101] Coat the coated antigen prepared in Example 1 in the first well of a 96-well ELISA plate at a coating concentration of 50 ng / mL and incubate overnight at 4°C. The next day, pour out the coating solution, wash 3 times with PBST, block the first and second wells of the ELISA plate with BSA, and incubate at 37°C for 1 h. Pour out the blocking solution and wash 3 times with PBST. Add the phage antibody library of Example 2 to the first well and react for 2 h. Pour out the liquid, pat dry on a clean absorbent paper, and wash 5 times with PBST. Add 100 μL of triclosan standard to the first well and react for 1 h. Aspirate the liquid in the first well and add it to the second well and react for 1 h to remove the phage bound to BSA. Collect the eluate, take 5 μL for titer determination, and use the rest for amplification.

[0102] Add the phage eluate to the fresh Escherichia coli ER2738 bacterial solution and let it stand at 37°C for 15 min. Add carbenicillin and SB medium, and culture at 37°C and 220 rpm for 2 h. Add helper phage M13KO7 (multiplicity of infection MOI = 20:1) and kanamycin and culture overnight. The next day, centrifuge and take the supernatant, and add PEG-NaCl solution to precipitate and purify the phage.

[0103] Perform the next round of screening on the amplification product, ensure that the addition amount is the same in each round of screening, and the coating concentration of the antigen and the competitive elution concentration of the triclosan standard are decreased by 2-fold. Calculate the titer of each round, pick monoclonal colonies for amplification and ELISA identification. Positive monoclonal colonies are obtained after 4 rounds of panning.

[0104] Example 4 Expression of triclosan nanobody

[0105] The positive monoclonal plasmid was extracted and transformed into competent Escherichia coli TOP10F' cells. After recovery, the cells were spread on solid medium and cultured overnight. The next day, single colonies were picked and cultured in SB-carbenicillin medium, and IPTG was added to induce overnight expression. The next day, the cells were lysed with an ultrasonic cell disruptor, filtered through a membrane, and purified using a nickel column. That is, the nanobody was separated and purified by the affinity chromatography of the histidine tag and nickel chloride in the nickel column to obtain a high-purity anti-triclosan nanobody. After amino acid sequencing analysis, the amino acid sequence of the obtained nanobody was as shown in SEQ ID NO: 1.

[0106] Example 5 Cross-reactivity of Anti-Triclosan Nanobody

[0107] Triclosan structural analogs were selected to determine and evaluate the specificity of the VHH-ELISA method. The triclosan hapten T1-BSA was diluted and coated on a 96-well ELISA plate, 100 μL per well, and reacted overnight at 4 °C. The next day, the liquid in the wells was discarded, and the plate was washed 3 times with PBST containing 0.05% Tween, and then inverted on absorbent paper to dry. Blocking solution was added and incubated at 37 °C for 30 minutes. The liquid in the wells was discarded, and the plate was washed 3 times with 0.05% PBST and then inverted on absorbent paper to dry. Standard solutions of triclosan structural analogs (Table 1) with concentrations of 0 ng / mL, 1 ng / mL, 4 ng / mL, 12 ng / mL, 37 ng / mL, 111 ng / mL, 333 ng / mL, and 1000 ng / mL were prepared respectively. 50 μL of the standard sample was added to each well, and 2 - 4 replicates were performed. 50 μL of the diluted antibody was added and incubated at 37 °C for 30 minutes. The liquid in the wells was discarded, and the plate was washed 3 times with PBST and then inverted on absorbent paper to dry. The enzyme-labeled secondary antibody was added and incubated at 37 °C for 30 minutes. The liquid in the wells was discarded, and the plate was washed 3 times with PBST and dried. Solution A and solution B were mixed in equal volume, 100 μL was added to each well, and the reaction was developed in the dark for 10 - 15 minutes. The reaction was terminated by adding the stop solution, and the OD value of each well at a wavelength of 450 nm was measured using an ELISA reader. The IC 50 value of each test analog was calculated using the following formula: Cross-reactivity = [IC 50 (triclosan) / IC 50 (analog)] × 100%, and the cross-reactivity (Table 1) could be calculated.

[0108] Table 1

[0109]

[0110] Example 6 Construction and Application of an ELISA Detection Kit for Analyzing Triclosan Residue

[0111] The kit includes a box body, a detachable 96-well enzyme-linked immunosorbent assay (ELISA) plate disposed within the box body, and reagents disposed within the box body. Among them, each well of the ELISA plate is coated with the triclosan-coated antigen of Example 1. The reagents include anti-triclosan nanobody (SEQ ID NO: 1), triclosan standard solution, enzyme-labeled secondary antibody, buffer PBS, washing solution PBST, substrate solution (Solution A), chromogenic solution (Solution B), and reaction termination solution, etc.

[0112] The concentration of the nanobody is 100 ng / mL.

[0113] The enzyme-labeled secondary antibody is a horseradish peroxidase-labeled anti-HA tag antibody with a concentration of 0.1 μg / mL. It is purchased from Abcam, and the product number is ab1265.

[0114] Solution A is prepared from 1 g of urea peroxide, 10.3 g of citric acid, 35.8 g of Na2HPO4·12H2O, 100 μL of Tween-20, and 1000 mL of distilled water, with a pH value of 5.

[0115] Solution B is prepared from 700 mg of 3,3',5,5'-tetramethylbenzidine, 40 mL of DMSO, 10.3 g of citric acid, and 1000 mL of distilled water, with a pH value of 2.4.

[0116] The reaction termination solution is 2 M sulfuric acid solution.

[0117] Coat the coated antigen on the 96-well ELISA plate, with a coating concentration of 60 ng / mL for each well, and react overnight at 4°C; the next day, discard the liquid in the wells, wash 3 times with PBST containing 0.05% Tween, invert the ELISA plate on the absorbent paper and pat dry; add the blocking solution, incubate at 37°C for 30 minutes, discard the liquid in the wells, wash 3 times with 0.05% PBST, invert the ELISA plate on the absorbent paper and pat dry; prepare triclosan standard solutions of 0 ng / mL, 1 ng / mL, 4 ng / mL, 12 ng / mL, 37 ng / mL, 111 ng / mL, 333 ng / mL, and 1000 ng / mL, add 50 μL of the standard sample or the processed sample to each well, make 2 - 4 replicates for the standard sample and the sample, add 50 μL of the diluted antibody, incubate at 37°C for 30 minutes; discard the liquid in the wells, wash 3 times with PBST, invert the ELISA plate on the absorbent paper and pat dry; add the enzyme-labeled secondary antibody, incubate at 37°C for 30 minutes; discard the liquid in the wells, wash the ELISA plate 3 times with PBST and pat dry; mix equal volumes of Solution A and Solution B, add 100 μL to each well, develop color in the dark for 10 - 15 minutes, add the termination solution to terminate the reaction, and measure the OD value of each well at a wavelength of 450 nm on an enzyme-linked immunosorbent assay analyzer.

[0118] Subtract the OD value of the well containing the 0 ng / mL standard from the OD value of the well containing the standard at the maximum concentration and define it as B0. The OD values of the remaining wells after correction by the same method are defined as B. Using the B / B0 value as the ordinate and the corresponding standard concentration as the abscissa, plot the standard inhibition curve of triclosan ( Figure 1 ). According to the regression equation of the curve, the concentration of the corresponding sample can be calculated, and the median inhibitory concentration IC 50 (B / B0 = 50%) and the minimum detection limit IC 20 (B / B0 = 80%) of triclosan can also be obtained.

[0119] During the detection of actual samples, the coated antigen adsorbed on the well wall of the microplate (coating concentration is 60 ng / mL) and the triclosan to be detected compete with each other for reaction with the antibody, and the competition result is shown through a color reaction. By detecting triclosan at known concentrations and plotting a standard curve, the concentration of triclosan in the sample to be detected can be deduced.

[0120] The advantages of the present invention are that it can accurately and sensitively detect the residues of triclosan in water, soil and vegetables. The sample pretreatment process is simple and time-consuming less. It can detect a large number of samples at the same time, and the sample detection cost is much lower than the traditional instrumental detection method.

[0121] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. Nanobody against triclosan, characterized in that The nanobody comprises the following amino acid sequence or consists of the following amino acid sequence: i) the amino acid sequence shown in SEQ ID NO:1; or ii) the amino acid sequence obtained by connecting a tag to the N-terminus and / or C-terminus of i); or iii) an antibody with the same function obtained by substituting, deleting and / or adding one or more amino acids to the amino acid sequence of i) or ii).

2. Nucleic acid molecule encoding the nanobody according to claim 1.

3. Biological material containing the nucleic acid molecule according to claim 2, wherein the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacterium.

4. Triclosan detection reagent or kit, characterized in that The active ingredient is the nanobody described in claim 1.

5. ELISA kit for detecting triclosan residue based on nanobody, characterized in that The kit comprises a box body, a removable enzyme-linked immunosorbent assay (ELISA) plate arranged in the box body, and a reagent arranged in the box body; each well of the ELISA plate is coated with a triclosan artificial antigen, and the reagent comprises the nanobody described in claim 1, and at least one of a triclosan standard solution, an enzyme-labeled secondary antibody, a PBS buffer solution, a PBST washing solution, a chromogenic solution and a reaction termination solution.

6. The ELISA kit according to claim 5, characterized in that The triclosan artificial antigen is obtained by conjugating the triclosan hapten shown in formula (I) with a carrier protein; wherein, the carrier protein is selected from at least one of bovine serum albumin, keyhole limpet hemocyanin, ovalbumin, thyroglobulin, human serum albumin.

7. The ELISA kit according to claim 6, characterized in that The carrier protein is selected from bovine serum albumin, keyhole limpet hemocyanin.

8. The ELISA kit according to claim 6, characterized in that The preparation method of the antigen coating solution for coating the ELISA plate comprises: (1) Dissolve 7.5 mg of the triclosan hapten shown in formula (I), 2.65 mg of N-hydroxysuccinimide and 4.8 mg of N,N'-dicyclohexylcarbodiimide in 200 μL of anhydrous dimethylformamide, and stir overnight at room temperature; centrifuge the reaction solution, discard the precipitate, and collect the supernatant; (2) Dissolve 20 mg of bovine serum albumin in 2 mL of 0.05 M carbonate buffer solution with pH 9.6, and dropwise add the supernatant under stirring. After adding, continue to stir and react at room temperature for 4 h; (3) After the reaction is completed, put the reaction solution into a dialysis bag and dialyze with PBS solution; change the solution every 6 h, and change the solution 5 - 6 times in total; after dialysis, centrifuge, discard the precipitate, and collect the supernatant as the antigen coating solution; Preferably, the ELISA plate is a 96-well ELISA plate, and the coating concentration of the coated antigen is 50 - 70 ng / mL.

9. The ELISA kit according to any one of claims 5-8, characterized in that The concentration of the nanobody is 90 - 110 ng / mL; and / or The enzyme-labeled secondary antibody is a horseradish peroxidase-labeled anti-HA tag antibody, and the concentration is 0.1 μg / mL; and / or The chromogenic solution comprises solution A and solution B. Solution A is prepared from 1 g of urea peroxide, 10.3 g of citric acid, 35.8 g of Na2HPO4·12H2O, 100 μL of Tween-20 and 1000 mL of distilled water, and the pH value is 5; Solution B is prepared from 700 mg of tetramethylbenzidine, 40 mL of DMSO, 10.3 g of citric acid and 1000 mL of distilled water, and the pH value is 2.4; and / or The reaction termination solution is a 2 M sulfuric acid solution.

10. Any of the following applications of the nanobody according to claim 1: 1) For triclosan detection; 2) For preparing triclosan detection reagent or kit; 3) For enrichment and purification of triclosan; 4) For preparing enrichment and purification reagent of triclosan.

11. Application of the detection reagent or kit according to claim 4 or the ELISA kit according to any one of claims 5-9 in detecting triclosan residue in a sample.

Citation Information

Patent Citations

  • Enzyme linked immunosorbent assay kit for detecting dicofol and application of enzyme linked immunosorbent assay kit

    CN114002434A

  • Native immunoglobulin binding reagents and methods for making and using same

    US20050142609A1