A self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system.

Abstract

This invention relates to the field of microbial metabolic engineering, providing a self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system, aiming to achieve green and clean production of D-allulose. This invention utilizes the xylose-inducible promoter Pxyl and the constitutive promoter Pdc to control the transcription of the translation control system components A01 and S01, respectively, enabling cells to automatically regulate the silencing and expression of the formaldehyde detoxification operator FrmRAB in response to xylose. Based on this, the system was transformed into the recombinant strain *E. coli* LMM asRNA100G, which synthesizes D-allulose from xylose and methanol, yielding *E. coli* LMMGQ. Shake-flask culture and real-time quantitative PCR experiments confirmed that the translation control system effectively solves the methanol residue problem in the later stages of fermentation, providing an optimized solution for the green and clean production of D-allulose.

Description

Technical Field

[0001] This invention belongs to the field of microbial metabolic engineering, specifically relating to a self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system. Background Technology

[0002] D-Allulose is a rare, naturally occurring hexose found in extremely low amounts in vegetables and fruits. Due to its nearly 70% sucrose sweetness and relatively low calorie content, it is considered a commendable sweetener. Furthermore, research has confirmed the significant effects of D-Allulose in lowering blood lipids, preventing obesity, and protecting the nervous system. Enzymatic production of D-Allulose offers several advantages, including high substrate conversion rates, rapid reaction speeds, and easy product purification. However, the manufacture and immobilization of the enzyme significantly increases the overall economic burden. In contrast, fermentation may be a promising alternative, as it can combine enzyme production and D-Allulose synthesis in a single bioreactor.

[0003] Xylose is the second most abundant monosaccharide in lignocellulose hydrolysate, making its utilization in microbial fermentation for chemical production a subject of considerable interest. Xylose is transported to the cytoplasm via xylose transporters (Xyl FGH and Xyl E), then enters the pentose phosphate (PP) pathway to generate glyceraldehyde-3-phosphate (G-3-P) and fructose-6-phosphate (F-6-P). In a previous study, a recombinant *E. coli* strain was constructed to produce D-allulose from xylose and methanol by introducing the AlsE, A6PP, and methanol assimilation pathways. This is an excellent example of promoting the use of C5 and C1 substrates for C6 product synthesis in the biochemical industry. However, the residual methanol in the later stages of fermentation raises serious concerns. Methanol is widely considered toxic to humans, and its concentration in food and beverages is strictly limited. Residual methanol poses a challenge to product separation, and artificially controlling the amount of methanol added cannot effectively solve this problem. Summary of the Invention

[0004] Therefore, to address the aforementioned problems, this invention provides a self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system. By constructing a translation control system, the silencing and expression of the formaldehyde detoxification operator FrmRAB in recombinant E. coli were established in response to xylose, thereby achieving self-induced detoxification. After being introduced into a cell factory for D-allulose synthesis, the green and clean production of D-allulose is ultimately realized.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system is disclosed. The method utilizes the xylose-inducible promoter Pxyl and the constitutive promoter Pdc to control the transcription of translation control system components A01 and S01, respectively, to construct the translation control system and achieve self-induced detoxification in response to xylose. The xylose isomerase gene xylA and the formaldehyde detoxification operator gene frmRAB of wild-type *E. coli* JM109(DE3) were knocked out, and the methanol dehydrogenase gene mdh was expressed. The translation control system was introduced to verify the cell's ability to consume methanol. *E. coli* JM109(DE3) is a commercially available strain purchased from Shanghai Zeye Biotechnology Co., Ltd. Finally, the system was transformed into the recombinant strain *E. coli* LMM asRNA100G to obtain *E. coli* LMMGQ. Shake-flask fermentation and real-time quantitative PCR confirmed that the translation control system effectively removes methanol residues from the culture medium, achieving green and clean production of D-allulose.

[0007] The above-mentioned self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system includes the following steps:

[0008] (1) The gene sequences of Pxy l, Pdc, A01 and S01 were artificially synthesized, and the specific sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. Overlap PCR was performed using two pairs of primers Pxy lF / Pxy lA01-R and A01-F / A01-R to obtain the fusion gene fragment Pxy l-A01; overlap PCR was performed using two pairs of primers Pdc-F / PdcS01f-R and frmRAB-F / frmRAB-R to obtain the fusion gene fragment Pdc-S01-SD-frmRAB; the primer sequences are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.

[0009] (2) Using enzyme digestion and ligation, Pxy l-A01 and Pdc-S01-SD-frmRAB were sequentially inserted between Nde I and Kpn I, and between Kpn I and Avr II of pACYCDuet* plasmid to obtain the recombinant vector pACYC-ASF, thus completing the construction of the translation control system.

[0010] (3) The xy lA gene and frmRAB gene on the genome of E. coli JM109(DE3) were knocked out sequentially by λ-red homologous recombination; the mdh gene sequence was artificially synthesized as shown in SEQ ID NO.13, and the mdh gene was inserted into the Nco I and Hind III of the pETDuet-1 plasmid by enzyme digestion and ligation to obtain the recombinant vector pET-M. pET-M and pACYC-ASF in (1) were transformed into cells to obtain the recombinant strain AS01FX.

[0011] (4) The recombinant strain AS01FX was cultured in 50 mL of LB medium containing 30 mg / L chloramphenicol, 100 mg / L ampicillin, 100 mM phosphate buffer and 100 mM methanol. The shake flask fermentation was divided into two groups, one group with 20 mM xylose added and the other group without xylose added.

[0012] (5) pACYC-ASF was transferred into the recombinant strain E. coli LMM asRNA100G to obtain E. coli LMMGQ. The culture medium in (4) was used and 50 mM xylose was added for shake-flask fermentation. Samples were taken at 24 hours and 72 hours respectively for real-time fluorescence quantitative PCR detection.

[0013] The specific process of step (1) above is as follows: PCR is performed using primer pairs Pxy lF / Pxy lA01-R and A01-F / A01-R with Pxy l and A01 genes as templates. The two PCR products are then mixed and PCR is performed using Pxy lF and A01-R to obtain the fusion product Pxy l-A01. PCR is also performed using primer pairs Pdc-F / PdcS01f-R and frmRAB-F / frmRAB-R with Pdc and frmRAB genes as templates. The two PCR products are then mixed and PCR is performed using Pdc-F and frmRAB-R to obtain the fusion product Pdc-S01-SD-frmRAB.

[0014] The preparation process of the pACYCDuet* plasmid in step (2) above is as follows: PCR was performed using primers pACYC-F and pACYC-R, with pACYCDuet-1 plasmid as a template. The plasmid was then ligated using HindIII to obtain the pACYCDuet* plasmid without the T7 promoter. The primer sequences are shown in SEQ ID NO.14 and SEQ ID NO.15.

[0015] The specific process of step (3) above is as follows: First, using pKD13 plasmid as a template, gene amplification is performed using primers xy lA-F / xy lA-R or frmRAB-F / frmRAB-F. The amplification product is then transformed into the cells to be knocked out containing pKD46 plasmid. L-arabinose is used to induce recombinant protein expression. After incubation at 37℃, the resistance marker is eliminated using pcp20 plasmid. Primer sequences are shown in SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19.

[0016] The specific process of step (4) above is as follows: activate cells overnight, and inoculate them at a seeding rate of 2% into a 250mL Erlenmeyer flask containing 50mL LB medium. The culture temperature is 37℃, the shaker speed is 220rpm, and the inducing agent IPTG is 0.2mM.

[0017] In step (5) above, the recombinant strain *E. coli* LMM asRNA100G is an artificially modified wild-type *E. coli* JM109(DE3), with the specific genotype being ΔfrmRAB,Δrp iA,ΔpfkA,ΔpfkB,Δgal E,sumo,al sE,a6PP,asRNA100. The specific process of real-time quantitative PCR in this step is as follows: total RNA is extracted from the fermentation broth cells using an RNA extraction kit, then the corresponding cDNA is obtained using a reverse transcription kit, and finally, qPCR is performed using a probe method.

[0018] The above-mentioned self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system is applied in the green and clean production of D-allulose.

[0019] Compared with existing technologies, this invention has the following advantages: The successfully constructed translation control system, introduced into a cell factory for producing D-allulose via methanol and xylose fermentation, effectively solves the problem of methanol residue after fermentation. Theoretically, the cells respond to changes in xylose in the culture medium, automatically regulating carbon metabolism flux, achieving not only maximum efficiency in substrate-to-product conversion but also significantly simplifying product separation and fermentation process design, ultimately realizing green and clean production of D-allulose. Attached Figure Description

[0020] Figure 1 This is a metabolic diagram of the recombinant strain E. coli LMMGQ.

[0021] Figure 2 This is a schematic diagram of the translation control system.

[0022] Figure 3The diagram shows the metabolism and fermentation results of the recombinant strain AS01FX; A: Metabolic diagram; B: Fermentation results of LB medium with and without 20mM xylose (solid line).

[0023] Figure 4 The fermentation results are for the recombinant strain E. coli LMMGQ.

[0024] Figure 5 The results of real-time quantitative PCR experiments on recombinant strain E. coli LMMGQ are shown in Figure 1; I represents the sample after 24 hours of fermentation; and II represents the sample after 72 hours of fermentation. Detailed Implementation

[0025] The present invention will be further illustrated below with reference to specific embodiments. It should be noted that these embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0026] A metabolic diagram illustrating the synthesis of D-allulose from xylose and methanol by the recombinant strain E. coli LMMGQ in this invention is shown below. Figure 1 As shown in the diagram, the translation control system is operating as follows: Figure 2 As shown.

[0027] Example 1

[0028] In wild-type Escherichia coli, the xylose isomerase gene xy lA and the formaldehyde detoxification operator gene frmRAB were sequentially knocked out. Then, the recombinant strain was transformed with pET-M and pACYC-ASF recombinant plasmids, resulting in the recombinant strain AS01FX. A metabolic diagram is shown below. Figure 3 As shown in Figure A. The purpose of knocking out the xylose isomerase gene xy lA was to block xylose metabolism in cells. 30 mg / L chloramphenicol, 100 mg / L ampicillin, 100 mM phosphate buffer, and 100 mM methanol were added to 50 mL of LB medium. In addition, 20 mM xylose was added to the experimental group, while no xylose was added to the control group. The AS01FX strain was inoculated into the medium at a 2% inoculum and cultured for 60 h. Methanol consumption in both experimental groups was observed.

[0029] Experimental results are as follows Figure 3As shown in Figure B, when xylose is absent in the culture medium (dashed line), A01 mRNA cannot be formed, and the frmRAB gene proceeds with normal transcription and translation. Methanol is continuously consumed under the catalysis of Mdh and FrmRAB. Conversely, in the xylose-added experimental group (solid line), A01 mRNA in the translation control system is continuously released and binds to S01 mRNA, preventing the frmRAB gene from being translated normally. In this case, the cells cannot consume methanol. However, we also observed that a small portion of methanol was consumed, likely due to other unknown methanol metabolic pathways within the cells. The experiment demonstrates that the translation control system is effective and can dynamically regulate methanol metabolism in response to xylose.

[0030] Example 2

[0031] pACYC-ASF was transformed into recombinant strain E. coli LMM asRNA100G to obtain recombinant strain E. coli LMMGQ. 30 mg / L chloramphenicol, 100 mg / L ampicillin, 100 mM phosphate buffer, 51.4 mM xylose, and 98.4 mM methanol were added to 50 mL of LB medium. E. coli LMMGQ was inoculated into the above medium at a 2% inoculum and cultured for 96 h. The results are as follows: Figure 4 As shown. The entire fermentation process was divided into two stages: D-allulose production and methanol detoxification. During the D-allulose production stage (0-60 h), xylose was completely consumed, leaving 39.9 mM of methanol. The yield of D-allulose was 33.2 mM, with a yield of 0.646 mM / mM on xylose and 0.547 mM / mM on methanol. After 60 h, methanol was continuously consumed until depleted, indicating that the methanol detoxification stage of the LMMGQ strain had begun.

[0032] Example 3

[0033] Cells were extracted at 24h (I) and 72h (II) respectively. Figure 4 We then reverse transcribed the mRNA of mdh, A01, and frmRAB into cDNA fragments. Next, we analyzed the relative amounts of mdh, A01, and frmRAB mRNA using qPCR. Figure 5 The production of mdh and frmRAB mRNA was observed in both samples. The difference was that the amount of A01 mRNA decreased significantly after xylose loss, thereby triggering the translation of FrmRAB. These results indicate that the recombinant strain E. coli LMMGQ underwent self-induced detoxification, achieving clean D-allose production without methanol residue.

[0034] Although the invention has been specifically shown and described in conjunction with preferred embodiments, those skilled in the art should understand that various changes in form and detail may be made to the invention without departing from the spirit and scope of the invention as defined in the appended claims, all of which shall be within the scope of protection of the invention.

[0035] sequence list

[0036] SEQ ID NO.1:

[0037] AGTATTTGCCAACAACGTAATAGGTTTATACACCGTCATAGTTTGCGTACCG

[0038] GCAGCAATACGTTTAATAACCTGCGAGATCCGCATCCTGGCCGGAGATTGCTA

[0039] CTTTCCCTGATAAACCTTGCGCCGCTTAATGCCTGAATTGCCCCACCTGCGGT

[0040] GGCATCGTTTGAGGCAACTACAGCATCAATTTTGTTATTATTGGCGGTTAGC

[0041] GCGTTTTCCATAATTTTCAATGCGTTTTCCGGTAACCAGCCATCAACCCATT

[0042] GGTCACCAACGACTTTAATTTTTCCGGAATCAACGTAAGGTTTTAACACTTT

[0043] CATTTGTCCGGCGCGGAACAGCTTGGCGTTGTTATCTACCGGCGAGCCGCC

[0044] CATCAGGAAGTAATTACCTTGCGGAACAATATCGACCAGGGCTTTTGCCTG

[0045] CAGTTCACCGACTTTTTCGTTATCGAAAGAAATATAAAAATCGATATCCGCA

[0046] TCGTTAATCATACGGTCGTAAGCTAATACTTTAATGCCTTCTTGTTTGGCTTC

[0047] TTTTACAACGTTACTTAATACCTGACCGTTATACGGAATAATGACAAGAACA

[0048] TCGACACCCCGGTTTATCATGTTTTCAATCTGCGACATTTGTGTTTCTTCATT

[0049] GCCATTTGCAGACTGTACAAATACTTTCGCGCCGAGAGATTCTGCCTTTTTC

[0050] ACAAAGATATCTCGATCTTTTTGCCAGCGTTCAAGACGGAGATCATCAATCG

[0051] CCATACCTATTTTGACTTCTTTGGCGTGTGCAGCAACGTTGGTAAGCAGGA

[0052] GTGAGGTGCAAAGGGTGAGTAGAATGTTCTTTATTTTCATGGTGTAGGGCC

[0053] TTCTGTAGTTAGAGGACAGTTTTAATAAGTAACAATCACCGCGATAAACGTA

[0054] ACCAATTTTTAGCAACTAAACAGGGGAAAACAATTACAGATTTTTATCTTTC

[0055] GATTACGATTTTTGGTTTATTTCTTGATTTATGACCGAGATCTTACTTTTGTTG

[0056] CGCAATTGTACTTATTGCATTTTTCTCTTCGAGGAATTACCCAGTTTCATCAT

[0057] TCCATTTTATTTTGCGAGCGAGCGCACACTTGTGAATTATCTCAATAGCAGT

[0058] GTGAAATAACATAATTGAGCAACTGAAAGGGAGTGCCCAATATTACGACAT

[0059] CATCCATCACCCGCGGCATTACCTGATTAT

[0060] SEQ ID NO.2:

[0061] CGCTCATGATCGCGGCATGTCCTGATATTTTTCCTCTAAAAAAGATAAAAAG

[0062] TCTTTTCGCTTCGGCAGAAGAGGTTCATCATGAACAAAAATTCGGCATTTTT

[0063] AAAAATGCCTATAGCTAAATCCGGAACGACACTTTAGAGGTTTCTGGGTCA

[0064] TCCTGATTCAGACATAGTGTTTTGAA

[0065] SEQ ID NO.3:

[0066] TCGCACATCTTGTTGTCTGATTATTGATTTTTCGCGAAACCATTTGATCATAT

[0067] GACAAGATGTGTATCCACCTTAACTTAATGATTTTTACCAAAATCATTAGGG

[0068] GATTCATCAG

[0069] SEQ ID NO.4:

[0070] GCGAAAAATCAATAAGGAGACAACAAGATGTGCGAACTCGATSEQ ID NO.5:

[0071] GGAATTCCATATGAGTATTTGCCAACAACG

[0072] SEQ ID NO.6:

[0073] TGATCAAATGGTTTCGCGAAAAATCAATAATCAGACAACAAGATGTGCGAA

[0074] TAATCAGGTAATGCCGCGG

[0075] SEQ ID NO.7:

[0076] AGTGCCCAATATTACGACATCATCCATCACCCGCGGCATTACCTGATTATTCG

[0077] CACATCTTGTTGTCTGATTATTG

[0078] SEQ ID NO.8:

[0079] CGGGGTACCCAAAAAACCCCTCAAGACCCG

[0080] SEQ ID NO.9:

[0081] CCGGGTACCCGCTCATGATCGCGGC

[0082] SEQ ID NO.10:

[0083] TATAGGATCCAAGGAGATATACCGCGAAAAATCAATAAGGAGACAACAAGSEQ ID NO.11:

[0084] GTGTTTTGAATATAGGATCCAAGGAGATATACCGCGAAAAATCAATAAGGA

[0085] GACAACAAGCCCAGTACTCCGGAAGAG

[0086] SEQ ID NO.12:

[0087] CAATAAACTGAATATGCGTTGACCTAGGGGG

[0088] SEQ ID NO.13:

[0089] ATGACCCACCTGAACATCGCTAATCGCGTCGACAGCTTCTTCATTCCCTGCG

[0090] TGACCCTCTTCGGTCCGGGCTGCGTTCGCGAAACGGGCGTGCGCGCCAGA

[0091] TCACTCGGGGCCAGGAAGGCTCTCATCGTCACGGATGCAGGCTTGCACAA

[0092] GATGGGGCTCTCCGAAGTCGTCGCGGGGCACATTCGCGAAGCCGGGCTCC

[0093] AGGCCGTCATCTTTCCGGGTGCCGAGCCCAATCCCACCGACGTTAACGTTC

[0094] ACGACGGCGTCAAGTTGTTCGAGCGGGAAGAATGCGACTTCATCGTTTCG

[0095] CTCGGCGGCGGCTCATCGCACGACTGCGCGAAAGGCATCGGCCTCGTTACC

[0096] GCCGGAGGCGGACATATCCGCGACTACGAAGGCATCGACAAATCAACGGT

[0097] GCCAATGACGCCGCTGATTTCGATCAACACGACCGCTGGCACTGCTGCGGA

[0098] AATGACACGCTTTTGCATCATCACTAATTCGAGCAATCATGTGAAGATGGTG

[0099] ATCGTCGACTGGCGTTGCACGCCATTAATCGCCATCGACGATCCGAGCCTG

[0100] ATGGTCGCGATGCCGCCCGCCTTGACGGCGGCGACCGGCATGGACGCGTT

[0101] GACTCACGCCATCGAGGCATACGTTTCCACCGCCGCCACGCCAATTACCGA

[0102] TGCCTGTGCGGAGAAGGCGATCGTGCTGATCGCCGAATGGCTGCCCAAAG

[0103] CTGTCGCGAACGGGGACTCGATGGAAGCACGCGCGGCCATGTGCTACGCC

[0104] CAATACCTTGCCGGCATGGCCTTCAACAACGCATCACTCGGTTACGTGCAC

[0105] GCGATGGCCCATCAACTCGGCGGCTTCTACAATTTGCCCCACGGCGTGTGC

[0106] AACGCGATCCTGCTGCCGCACGTGTCGGAATTCAACCTCATTGCCGCGCCG

[0107] GAGCGCTACGCGAGAATCGCCGAACTGCTAGGCGAGAACATTGGGGGCTT

[0108] GAGCGCGCATGACGCCGCCAAAGCTGCCGTCTCGGCGATCCGGACCCTTT

[0109] CCACGTCGATTGGCATTCCGGCGGGTCTGGCGGGCCTGGGCGTCAAGGCG

[0110] GACGACCATGAAGTGATGGCAAGCAATGCGCAAAAGGATGCTTGCATGCT

[0111] GACGAATCCGCGCAAGGCCACGCTGGCGCAAGTCATGGCAATCTTCGCTG

[0112] CGGCGATGTAA

[0113] SEQ ID NO.14:

[0114] GGAATTCCATATGGCGGCCGCATAATGCTTA

[0115] SEQ ID NO.15:

[0116] GGAATTCCATATGATTTCCTAATGCAGGAGTC

[0117] SEQ ID NO.16:

[0118] TATGCAAGCCTATTTTGACCAGCTCGATCGCGTTCGTTATGAAGGCTCAAGT

[0119] GTAGGCTGGAGCTGCTTCG

[0120] SEQ ID NO.17:

[0121] GTTATTTGTCGAACAGATAATGGTTTACCAGATTTTCCAGTTGTTCCTGGATT

[0122] CCGGGGATCCGTCGACC

[0123] SEQ ID NO.18:

[0124] TAGCTGTGATCATAACCCTCGTGATAACGGATTAACGTCTTGATATTCATGTG

[0125] TAGGCTGGAGCTGCTTCG

[0126] SEQ ID NO.19:

[0127] CTTACTCGAGTTCGTCGTATTCGGGGGCAGATTGATGCTCTGGAACGGTCAT

[0128] TCCGGGGATCCGTCGACC

Claims

1. A self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system, characterized in that, Specifically, the following steps are included: (1) Gene sequences of Pxyl, Pdc, A01 and S01 were artificially synthesized, and the specific sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4; overlap PCR was performed using two pairs of primers Pxyl-F / PxylA01-R and A01-F / A01-R to obtain the fusion gene fragment Pxyl-A01; overlap PCR was performed using two pairs of primers Pdc-F / PdcS01f-R and frmRAB-F / frmRAB-R to obtain the fusion gene fragment Pdc-S01-SD-frmRAB; The primer sequences are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively. (2) Using enzyme digestion and ligation, Pxyl-A01 and Pdc-S01-SD-frmRAB were sequentially inserted between Nde I and Kpn I, Kpn I and Avr II of pACYCDuet* plasmid to obtain the recombinant vector pACYC-ASF, thus completing the construction of the translation control system. The pACYCDuet* plasmid evolved from the pACYCDuet-1 plasmid. Using primers pACYC-F and pACYC-R, PCR was performed using the pACYCDuet-1 plasmid as a template. The plasmid was then digested and ligated with Hind III to obtain the pACYCDuet* plasmid without the T7 promoter. The primer sequences are shown in SEQ ID NO.14 and SEQ ID NO.

15. (3) pACYC-ASF was transformed into recombinant strain E. coli LMM asRNA100G to obtain E. coli LMMGQ. The culture medium was used and 50 mM xylose was added for shake-flask fermentation. Samples were taken at 24 hours and 72 hours respectively for real-time fluorescence quantitative PCR detection. The culture medium contained 30 mg / L chloramphenicol, 100 mg / L ampicillin, 100 mM phosphate buffer and 100 mM methanol. The recombinant strain E. coli LMM asRNA100G was artificially modified from wild-type Escherichia coli E. coli JM109 (DE3). The modification method was to knock out the frmRAB, rpiA, pfkA, pfkB and galE genes, insert the sumo, alsE and a6PP genes, and use antisense RNA to inhibit the expression of RPiB.

2. The self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system, as described in claim 1, is characterized in that: Step (1) is as follows: PCR is performed using primer pairs Pxyl-F / PxylA01-R and A01-F / A01-R with Pxyl and A01 genes as templates. The two PCR products are then mixed and PCR is performed using Pxyl-F and A01-R to obtain the fusion product Pxyl-A01. PCR is also performed using primer pairs Pdc-F / PdcS01f-R and frmRAB-F / frmRAB-R with Pdc and frmRAB genes as templates. The two PCR products are then mixed and PCR is performed using Pdc-F and frmRAB-R to obtain the fusion product Pdc-S01-SD-frmRAB.

3. The self-induced detoxification method for the synthesis of D-allulose from xylose and methanol in a cell factory using a translation control system, as described in claim 1, is characterized in that: The specific process of real-time quantitative PCR in step (3) is as follows: total RNA is extracted from the fermentation broth cells using an RNA extraction kit, then the corresponding cDNA is obtained using a reverse transcription kit, and finally qPCR is performed using the probe method.

4. The application of the method as described in any one of claims 1 to 3 in the green and clean production of D-allulose.

Images