A reporter vector for target gene 3'UTR splicing and its application

Abstract

The present invention provides a target gene 3'UTR splicing reporter vector and its application. The reporter vector of the present invention can sensitively detect and report the target gene 3'UTR splicing situation.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a reporter vector for target gene 3'UTR splicing and application thereof. Background Art

[0002] Alternative splicing refers to the process in which the same precursor mRNA (pre-mRNA) produces different forms of mRNA through different splicing methods. In the growth and development of eukaryotic organisms, the pre-mRNA of most genes needs to undergo a series of processing processes such as 5' nucleotide capping, 3' polyadenylic acid tail addition and intron splicing to produce mature mRNA. Alternative splicing of RNA plays an important role in regulating the growth and development of organisms. Alternative splicing can not only increase the complexity of gene expression in higher organisms, but also some byproducts of the alternative splicing process will also process a variety of non-coding RNAs and participate in the growth and development of organisms. Studies have found that 3' non-coding region (3'UTR) splicing is widely present in cancer, especially in genes related to tumor invasion; 3'UTR splicing is upregulated in cancer and is associated with poor prognosis.

[0003] Take the CTNNB1 gene as an example. It encodes β-catenin 1, a protein that plays a vital role in cell adhesion and signal transduction. β-catenin is a multifunctional protein that participates in processes such as cell-cell adhesion, cell-cell signal transduction and transcriptional regulation. Its structure includes a cross-linking domain at the N-terminus, 12 catenin domains in the middle, and a regulatory domain at the C-terminus. It also participates in the Wnt signaling pathway, which is a key pathway for regulating embryonic development and maintenance of adult biological tissues. In an inactivated state, β-catenin is degraded, but when the Wnt signal is activated, β-catenin is stabilized and enters the nucleus, interacts with transcription factors, and affects gene transcription. β-catenin also participates in the regulation of cell-cell adhesion and cell polarity by binding to cell-cell adhesion molecules such as E-cadherin. Mutations or overexpression of the CTNNB1 gene are associated with the occurrence and development of a variety of cancers. This includes liver cancer, colorectal cancer, etc. Abnormal β-catenin activity may lead to disordered cell growth and the formation of cancer. Splicing of the CTNNB1 3'UTR is widely present in liver cancer, breast cancer, colon cancer, kidney cancer, lung cancer, and other cancers. In a mouse liver cancer model, blocking the 3'UTR splicing of CTNNB1 using antisense oligonucleotides can inhibit the expression of β-catenin 1 and lead to tumor regression. Therefore, therapies that inhibit splicing of the CTNNB1 3'UTR may have broad applicability in cancer patients.

[0004] However, there is a lack of relevant reporter vectors in the field of 3'UTR splicing research in cancer, which seriously limits the functional research of important proteins regulated by 3'UTR splicing and the research on the mechanism of action of alternative splicing. Therefore, developing a new type of reporter vector based on 3'UTR alternative splicing is an effective way to accelerate the research on the mechanism of action of 3'UTR alternative splicing. At the same time, the development of 3'UTR splicing reporter vectors for related oncogenes can also help us screen new anti-cancer small molecule drugs.

[0005] Therefore, there is an urgent need in the art to develop a reporter vector that can sensitively detect and report the splicing status of the 3'UTR of a target gene. Summary of the invention

[0006] In order to solve the above problems, in the first aspect, the present invention aims to provide a reporter vector for gene 3'UTR splicing, wherein the reporter vector comprises a nucleic acid construct having a structure of formula I from the 5' end to the 3' end:

[0007] P1-X1-L1-X2-X3-X4 Formula I

[0008] in,

[0009] P1 is the promoter;

[0010] X1 is the internal reference fluorescent protein;

[0011] L1 is the target gene fragment T and the partial sequence U of its 3'UTR;

[0012] X2 is a reporter fluorescent protein, preferably the reporter fluorescent protein is a d2-modified fluorescent protein;

[0013] X3 is the RNA nuclear export signal;

[0014] X4 is a polyA signal; and

[0015] Each "-" is independently a bond or a nucleotide linking sequence;

[0016] Among them, L1

[0017] The target gene fragment T does not contain a stop codon;

[0018] When the partial sequence U of the 3'UTR does not undergo splicing, the number of bases in L1 is not a multiple of 3 or the partial sequence U of the 3'UTR contains a stop codon; and

[0019] When the partial sequence U of the 3'UTR is spliced, the number of bases of the spliced ​​L1 is a multiple of 3 and does not contain a stop codon.

[0020] In some embodiments, when the target gene fragment T contains a stop codon, n bases are inserted at the stop codon (-7 to -1) position to shift the stop codon, where n is an integer that is not a multiple of 3, for example, n is 1, 2, 4, 5, 7, 8, 10 or 11.

[0021] In some embodiments, the target gene fragment T in L1 in the reporter vector of the present invention is a full-length sequence. In some preferred embodiments, the target gene fragment T in L1 in the reporter vector of the present invention is one or more exons and the last exon thereof, or a fragment thereof containing a stop codon. In some preferred embodiments, the target gene fragment T in L1 in the reporter vector of the present invention is the last exon of the target gene, or a fragment thereof containing a stop codon.

[0022] In some embodiments, the internal reference fluorescent protein X2 and the reporter fluorescent protein X3 in the reporter vector of the present invention are fluorescent proteins of different colors. In some embodiments, the internal reference fluorescent protein and the reporter fluorescent protein in the reporter vector of the present invention are respectively selected from, but not limited to, green fluorescent protein, yellow fluorescent protein, red fluorescent protein and blue fluorescent protein. In an exemplary embodiment, the green fluorescent protein is EGFP or d2EGFP. In an exemplary embodiment, the yellow fluorescent protein is Venus or d2Venus. In an exemplary embodiment, the red fluorescent protein is mCherry, mKate2, DsRed, d2mCherry, d2mKate2 or d2DsRed. In an exemplary embodiment, the blue fluorescent protein is BFP, mTagBFP, d2BFP or d2mTagBFP.

[0023] In a preferred embodiment, the reporter fluorescent protein in the reporter vector of the present invention is a D2-modified fluorescent protein. The D2-modified fluorescent protein refers to the addition of mouse ornithine decarboxylase (MODC) 422-461 amino acid residues at the C-terminus of the fluorescent protein. The D2-modified fluorescent protein is an unstable enhanced fluorescent protein, which can ensure that the fluorescent signal of the reporter fluorescent protein can respond more quickly to the splicing changes of the 3'UTR of the transcript. For example, the D2-modified EGFP refers to the addition of mouse ornithine decarboxylase 422-461 amino acid residues at the C-terminus of EGFP, and its sequence is shown in SEQ ID No: 3.

[0024] In some exemplary embodiments, the reporter fluorescent protein is green fluorescent protein, preferably d2EGFP. In some exemplary embodiments, the internal reference fluorescent protein is red fluorescent protein, preferably mCherry.

[0025] In some embodiments, the promoter P1 in the reporter vector of the present invention is selected from the following group: CMV promoter, CAG promoter, PGK promoter, EF1α promoter or a combination thereof.

[0026] In some embodiments, the polyA signal X4 in the reporter vector of the present invention is selected from the following group: polyA of BGH, polyA of SV40, polyA of PGK or a combination thereof.

[0027] In some embodiments, the RNA nuclear export signal X3 in the reporter vector of the present invention is selected from MPMV-CTE, HIV-RRE or a combination thereof.

[0028] In some exemplary embodiments, the target gene fragment T in the reporter vector of the present invention is the CTNNB1 encoding gene, preferably the last exon fragment of the CTNNB1 encoding gene.

[0029] In some exemplary embodiments, the L1 in the reporter vector of the present invention has a sequence shown in SEQ ID No: 1. In some exemplary embodiments, the nucleic acid construct in the reporter vector of the present invention has a sequence shown in SEQ ID No: 5.

[0030] In some embodiments, the reporter vector of the present invention is a plasmid. In some embodiments, the reporter vector of the present invention is a plasmid constructed from a PB6-CMV plasmid.

[0031] In a second aspect, the present invention provides a method for using the reporter vector as described in the first aspect, the method comprising: transfecting the reporter vector into cells and expressing it; and judging the splicing regulation of the 3'UTR of the target gene by the fluorescence intensity of the internal reference fluorescent protein and the reporter fluorescent protein.

[0032] In some embodiments, in the method of using the reporter vector of the present invention, the cell is an animal embryonic cell or an animal cancer cell, such as embryonic kidney cell HEK-293T, human breast cancer cell MCF-7, liver cancer cell HepG2, or liver cancer cell BEL-7404.

[0033] In a third aspect, the present invention provides a method for preparing the reporter vector as described in the first aspect, characterized in that the method comprises:

[0034] (1) amplifying and obtaining gene fragments of X1, L1', X2, X3 and X4 respectively, wherein the difference between the nucleotide sequences of L1' and L1 is that n bases are not inserted in the stop codon (-7 to -1) of L1'; and

[0035] (2) The gene fragments of X1, L1, X2, X3 and X4 are sequentially integrated into the vector from the 5' end to the 3' end through homologous recombination.

[0036] In an optional embodiment, when the target gene fragment T in L1 of the present invention contains a stop codon, the method further comprises inserting n bases at the stop codon (-7 to -1) position to shift the stop codon, wherein n is an integer that is not a multiple of 3, for example, n is 1, 2, 4, 5, 7, 8, 10 or 11.

[0037] Beneficial effects:

[0038] (1) The present invention constructs a reporter vector for studying the splicing regulation of the 3'UTR of a target gene. The reporter vector can be used to simply and directly determine the splicing status of the 3'UTR by the change in the intensity of different fluorescent proteins.

[0039] (2) The reporter vector of the present invention cleverly utilizes the characteristics of different fluorescence, especially red and green fluorescence, which are long-lasting, stable and easy to detect. It can not only discover new factors that can regulate splicing, but also help to further study the regulatory mechanism of cancer-related 3'UTR splicing, and at the same time, it can screen out drug-like small molecules with potential anti-cancer activity.

[0040] (3) The reporter vector in some embodiments of the present invention specifically uses d2EGFP as a reporter fluorescent protein, so that the reporter fluorescent signal can quickly respond to the splicing changes of the 3'UTR of the transcript.

[0041] (4) The reporter vector of the present invention is simple and easy to use, takes a short time, has a high throughput, and has high repeatability and accuracy.

[0042] (5) The reporter vector in some embodiments of the present invention specifically uses the MMPV-CTE element that helps RNA to export from the nucleus, thereby making the reporter fluorescence signal stronger and more sensitive. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Shown is the structural map of the CTNNB1 3'UTR splicing reporter vector PB6-CTNNB1-3UTR-Reporter.

[0044] Figure 2 The structure and working principle of the CTNNB1 3'UTR splicing reporter vector are shown; Figure 2 a is the structure of the nucleic acid construct in the reporter vector; Figure 2 b is a schematic diagram of how the reporter vector characterizes the splicing status of CTNNB1 3'UTR.

[0045] Figure 3Shows the splicing of the 3'UTR of the reporter vector after adding antisense oligonucleotides, where Figure 3 a is the splicing status of the 3'UTR of the reporter vector detected by RT-PCR technology (FL: no splicing, 3'SP: splicing); Figure 3 b is the expression of green fluorescent protein (FITC-A) and red fluorescent protein (PE-Texas Red-A) reporter vectors analyzed by flow cytometry.

[0046] Figure 4 The splicing of the 3'UTR of the reporter vector after treatment with different concentrations of Pladienolide B for 24 hours is shown. Figure 4 a is the splicing status of the 3'UTR of the reporter vector detected by RT-PCR technology after 24 hours of treatment (FL: no splicing, 3'SP: splicing); Figure 4 b is the correspondence between the ratio of green and red fluorescence intensities of the reporter vector and the ratio of unsplicing and splicing transcript contents in the 3'UTR of the reporter vector after 24 hours of treatment.

[0047] Figure 5 The results of analyzing 5120 drug-like small molecules using high-content cell imaging technology are shown. Figure 5 a shows a scatter plot of the red fluorescence / green fluorescence ratio of the quantitative analysis reporter cells after treatment with 5120 drug-like small molecules, Figure 5 b is the expression of red and green fluorescence after the reporter vector was treated with the positive small molecule Hit 1 screened by high-content cell imaging technology.

[0048] Figure 6 The function of the screened drug-like small molecule Hit 1 was verified, Figure 6 a shows that Hit 1 can inhibit the splicing of endogenous CTNNB1 3'UTR, Figure 6 b shows that the translation of the encoded protein is inhibited. Figure 6 c shows that cell proliferation was inhibited. DETAILED DESCRIPTION OF THE INVENTION

[0050] The present invention constructs a reporter vector for studying the splicing regulation of 3'UTR of a target gene. The reporter vector can be used to simply and directly judge the splicing status of 3'UTR through the changes in the intensity of different fluorescent proteins.

[0051] Taking the CTNNB1 gene as a target gene as an example, the structure of the reporter vector of the present invention is briefly described by describing the preparation method of the CTNNB1 target gene 3'UTR reporter vector of the present invention (see Figure 1), the preparation method comprises: using human genomic DNA as a template, using Primer1 and Primer2 to amplify sequence fragment 1 of CTNNB1 exon 15 and part of the 3' non-coding region. Using Primer3 and Primer4 to amplify mCherry fragment 2, using Primer5 and Primer 6 to amplify d2EGFP fragment 3. Using restriction endonucleases NheI / NotI to double-digest the PB6-CMV plasmid. Purify and recover the enzyme-digested product fragments 1, 2, and 3 through agarose gel, and recover the vector fragment at the same time. The obtained fragments are homologously recombined, the assembled products are transferred into competent cells, and single clones are picked for colony PCR, gel running, and sequencing identification to obtain the vector PB6-CTNNB1-3UTR_1. Using Primer7 and Primer8 to amplify MPMV-CTE fragment 4, the MPMV-CTE element is essential to the entire reporter vector, which increases the expression amount of the reporter vector in the cell and increases the sensitivity. Then use NotI / BshTI to digest PB6-CTNNB1-3UTR_1 to obtain the vector fragment. At the same time, connect the MPMV-CTE sequence to the vector to obtain the plasmid PB6-CTNNB1-3UTR_2. Use Primer9 and Primer10 to amplify the vector to insert a single base C at the -7 position of the CTNNB1 stop codon. Obtain the final PB6-CTNNB1-3UTR-Reporter.

[0052] As can be seen from the preparation process above, the concept of the present invention is to integrate the internal reference fluorescent protein, the target gene fragment and its 3'UTR fragment and the reporter gene in sequence into an expression vector (such as a plasmid), and make it so that in L1, when the partial sequence U of the 3'UTR is not spliced, the number of bases of L1 is not a multiple of 3 or the partial sequence U of the 3'UTR contains a stop codon, the internal reference fluorescent protein and the reporter fluorescent protein are not in the same open reading frame, the internal reference fluorescent protein can be expressed but the reporter fluorescent protein cannot be expressed normally, then only the internal reference fluorescent protein fluoresces; and when the partial sequence U of the 3'UTR is spliced, the number of bases of the spliced ​​L1 is a multiple of 3 and does not contain a stop codon, at this time the internal reference fluorescent protein and the reporter fluorescent protein are in the same open reading frame, both can be expressed normally, then both the internal reference fluorescent protein and the reporter fluorescent protein can fluoresce.

[0053] When the target gene segment T in L1 contains a stop codon (see Figure 2 ), in order to prevent the stop codon from being included in L1 after splicing when the partial sequence U of the 3'UTR is spliced, n bases can be inserted at the (-7 to -1) position of the stop codon to shift the stop codon, where n is an integer that is not a multiple of 3, for example, n is 1, 2, 4, 5, 7, 8, 10 or 11.

[0054] Since the fluorescence intensity of the reporter fluorescent protein in the reporter vector can change with the splicing of the partial sequence U of the 3'UTR, the regulation of 3'UTR splicing can be studied by the intensity change of the reporter fluorescent protein and potential drug-like small molecules with anti-cancer activity can be screened. DETAILED DESCRIPTION

[0055] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.

[0056] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work shall fall within the scope of protection of the present invention.

[0057] The technical solution of the present invention is further described below with reference to the accompanying drawings and through specific implementation methods.

[0058] Example 1: Construction of CTNNB1 3'UTR splicing reporter vector

[0059] 1. Purpose:

[0060] Obtain the recombinant plasmid of CTNNB1 3'UTR splicing reporter vector.

[0061] 2. Methods:

[0062] 1. PCR amplify the sequences of CTNNB1 exon 15 and part of the 3' non-coding region, mCherry and d2EGFP sequences.

[0063] (1) HEK293 cell genomic DNA was extracted using a cell genome extraction kit, and the genomic DNA was used as a template using the primer pair shown in Primer1 and Primer2 to amplify the sequence fragment 1 of exon 15 and part of the 3' non-coding region of CTNNB1 by PCR. The specific sequence is shown in SEQ ID NO.1 in the attached table;

[0064] The cell genome extraction kit was purchased from Tiangen Biochemical Company, product number DP304;

[0065] (2) Using plasmid pmCherry-C1 as a template, Primer3 and Primer4 were used to amplify mCherry fragment 2, the specific sequence of which is shown in the attached table SEQ ID NO.2; wherein plasmid pmCherry-C1 was purchased from Clontech, product number 632524;

[0066] (3) Plasmid pd2EGFP-N1 was used as a template and Primer5 and Primer 6 were used to amplify d2EGFP fragment 3. The specific sequence is shown in the attached table SEQ ID NO.3; plasmid d2EGFP-N1 was purchased from Beijing Tian En Ze Gene Technology Co., Ltd., product number 60908-7778.

[0067] 2. Use restriction endonucleases NheI / NotI to double-digest the PB6-CMV plasmid to obtain the vector fragment. PB6-CMV is a self-synthesized plasmid of the company, and the specific sequence is shown in the attached table SEQ ID NO.6.

[0068] 3. Purify and recover PCR product fragments 1, 2, and 3 by agarose gel, and recover the vector fragment at the same time. Assemble the obtained fragments using the rapid cloning kit, transfer the assembled products into competent cells, pick single clones for identification and sequencing according to conventional identification and sequencing methods, and name the correctly sequenced plasmid PB6-CTNNB1-3UTR_1. The rapid cloning kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd., product number C113.

[0069] 4. Using the synthetic gene MPMV-CTE as a template, the specific sequence is shown in the attached table SEQ ID NO.4, using Primer7 and Primer8 to amplify MPMV-CTE fragment 4, and then using restriction endonucleases NotI and BshTI to double-digest fragment 4;

[0070] The gene MPMV-CTE was synthesized by Anshengda Company;

[0071] The restriction endonucleases were purchased from Thermo Fisher, product number FD0593 (NotI) and product number FD1464 (BshTI).

[0072] 5. Double digest the plasmid PB6-CTNNB1-3UTR_1 with restriction endonucleases NotI and BshTI, and run gel purification to obtain the vector fragment. Then, use T4 DNA ligase to connect the digested fragment 4 into the vector, transfer the ligation product into competent cells, pick a single clone and perform identification and sequencing according to the conventional identification and sequencing method, and name the correctly sequenced plasmid PB6-CTNNB1-3UTR_2. T4 DNA ligase was purchased from Thermo Fisher, product number EL0014.

[0073] 6. Use the point mutation kit, Primer9 and Primer10 to perform PCR amplification on the vector PB6-CTNNB1-3UTR_2. After the reaction, add DpnI to digest the plasmid template, and then recombinant to achieve in vitro circularization of linear DNA. The recombinant product was transferred into competent cells, and single clones were picked for identification and sequencing according to conventional identification and sequencing methods. The correctly sequenced plasmid was named PB6-CTNNB1-3UTR-Reporter, and its sequence is shown in the attached table SEQ ID NO.5. The point mutation kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd., product number C214;

[0074] The above PCR amplification conditions were: 95°C pre-denaturation for 5 min; 95°C for 30 s; 58°C for 30 s; 72°C for 1 min; 30 cycles; 72°C for 5 min; and storage at 4°C. The high-fidelity DNA polymerase used in PCR was purchased from Nanjing Novozyme Biotechnology Co., Ltd., product number P520.

[0075] 7. Use liposome transfection reagent Lipofectamine TM 3000 PB6-CTNNB1-3UTR-Reporter and pCAGPBase vector were co-transfected into HEK293T cells. After 24 hours, cells were screened with 10μg / ml blasticidin, and the medium was changed every other day. After 7 days, the monoclonal clones with high red fluorescence expression were sorted into 96-well plates using a flow cytometer. After a week of monoclonal amplification, CTNNB1 3'UTR splicing reporter cells were obtained. The pCAGPBase vector was purchased from Addgene, product number #54285; the liposome transfection reagent Lipofectamine TM 3000 was purchased from Thermo Fisher, product number L3000015; blasticidin was purchased from Thermo Fisher, product number A1113903.

[0076] 3. Results and Conclusions

[0077] The CTNNB1 3'UTR splicing reporter vector PB6-CTNNB1-3UTR-Reporter was successfully constructed (its structure is shown in Figure 2 ) and transformed them into HEK293T cells.

[0078] The primer sequences used are as follows:

[0079] Primer1:TCAGATCCGCTAGCCACCATGGTGAGCAAGGGCGAGG

[0080] Primer2:CTTGTACAGCTCGTCCATGCCG

[0081] Primer3:

[0082] GGCATGGACGAGCTGTACAAGCCTAGCTATCGTTCTTTTCACTCTGG

[0083] Primer4:

[0084] GCTCCTCGCCCTTGCTCACGGGTTGATAAATTCCATCTTGTGATCCATTC

[0085] Primer5:GTGAGCAAGGGCGAGGAGC

[0086] Primer6:

[0087] TGTTCGAATGGGTGACCTCGAGCGGCCGCCTACACATTGATCCTAGCAGAAGCACAGGCTGCAGGG

[0088] Primer7:AGGCGGCCGCAGACTGGACAGCCAAATGACGGGTAAGAGAG

[0089] Primer8

[0090] ATGACCGGTACACATCCCTCGGAGGCTGCGCCTGTCTTAGGTTGGAGTG

[0091] Primer9:GTTTGATACTCGACCTGTAAATCATCCTTTAGGTAAGAA

[0092] Primer10:CAGGTCGAGTATCAAACCAGGCCAG

[0093] All primers were purchased from Anshengda Company.

[0094] Example 2: Indication of CTNNB1 3'UTR splicing reporter vector

[0095] 1. Purpose:

[0096] Determine the indication of the CTNNB1 3'UTR splicing reporter vector.

[0097] 2. Methods:

[0098] 1. Use RT-PCR to determine the changes in splicing of the CTNNB1 3'UTR splicing reporter vector after antisense oligonucleotide (ASO) treatment; on the first day, 20,000 CTNNB1 3'UTR splicing reporter vector cells were plated in a 24-well plate, and on the second day, CTNNB1-ASO and NC-ASO (control group) were transfected into the reporter cells using Lipofectamine 2000 transfection reagent, with a final ASO concentration of 100μM. The medium was changed 6 hours after transfection, and the cell RNA was extracted using an RNA extraction kit 72 hours later. Take 500ng of total RNA and use a reverse transcription kit for 10μl system reverse transcription. After obtaining cDNA, it was diluted 10 times and amplified by PCR. The PCR system includes 1μl diluted cDNA, 1μl 10μM Primer11 and 1μl 10μM Primer12, 10μl DNA polymerase mix, and 7μl sterile water. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ for 30 s; 58℃ for 30 s; 72℃ for 30 s; 30 cycles; 72℃ for 5 min; 4℃ storage. Take 10 μl of PCR product and add it to 1% agarose gel, run it at 160V for 30 min, and take pictures and record ( Figure 3 a).

[0099] The ASO sequences were purchased from Suzhou Hongxun Biotechnology Co., Ltd.

[0100] NC-ASO sequence: A*U*G*A*A*C*G*U*G*A*A*U*U*G*C*U*C*A*A, where * represents –O-CH3;

[0101] CTNNB1-ASO sequence: C*U*U*A*C*C*U*A*A*A*G*G*A*U*G*A*U*U*U*A*C, where * represents –O-CH3;

[0102] Lipofectamine 2000 was purchased from Thermo Fisher, product number 11668027;

[0103] RNA extraction kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd., product number RC-112

[0104] The reverse transcription kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd., product number R312;

[0105] The DNA polymerase mix used in the PCR system was purchased from Nanjing Novozyme Biotechnology Co., Ltd., product number P112;

[0106] Primer11:GCTGTACAAGCCTAGCTATCG

[0107] Primer12:CCCTTGCTCACGGGTTTGAT

[0108] The PCR product of the full-length CTNNB1 3'UTR in the reporter vector was 791 bp in length, and the PCR product of the spliced ​​3'UTR was 327 bp in length.

[0109] 2. Use flow cytometry to analyze the fluorescence changes of CTNNB1 3'UTR splicing reporter vector after antisense oligonucleotide (ASO) treatment; on the first day, 20,000 CTNNB1 3'UTR splicing reporter vector cells were plated in a 24-well plate, and on the second day, CTNNB1-ASO and NC-ASO (control group) were transfected into the reporter cells using Lipofectamine 2000 transfection reagent, with a final ASO concentration of 100 μM. The medium was changed 6 hours after transfection, and the cells were digested into single cells 72 hours later. The changes in red and green fluorescence intensity of the reporter cells were analyzed using flow cytometry ( Figure 3 b).

[0110] 3. Results and Conclusions

[0111] After ASO treatment of cells, splicing inhibition occurred in the 3'UTR of the CTNNB1 reporter gene. This is consistent with the known effect of ASO on CTNNB1 3'UTR splicing. At the same time, compared with the control group, the green fluorescence of ASO-treated cells was significantly reduced, while the internal reference red fluorescence remained basically unchanged. The above results show that the reporter vector can correctly reflect the splicing of CTNNB1 3'UTR.

[0112] Example 3: CTNNB1 3'UTR splicing reporter vector sensitivity detection

[0113] 1. Purpose:

[0114] Determining the sensitivity of the CTNNB1 3'UTR splicing reporter vector.

[0115] 2. Methods:

[0116] 1. Use RT-PCR to determine the splicing changes of CTNNB1 3'UTR splicing reporter vector treated with different concentrations of spliceosome inhibitor Pladienolide B; on the first day, 200,000 CTNNB1 3'UTR splicing reporter vector cells were plated in a 24-well plate, and on the second day, the reporter cells were treated with different concentrations of Pladienolide B (25nM, 50nM, 75nM, 100nM, 150nM, 200nM, 250nM, 500nM, 1μM) and an equal volume of DMSO (control group). After 24 hours, the cellular RNA was extracted using an RNA extraction kit. Take 500ng of total RNA and use a reverse transcription kit for 10μl system reverse transcription. After obtaining cDNA, dilute it 10 times. The PCR system includes 1μl diluted cDNA, 1μl 10μM Primer11 and 1μl 10μM Primer12, 10μl DNA polymerase mix, and 7μl sterile water. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ for 30 s; 58℃ for 30 s; 72℃ for 30 s; 30 cycles; 72℃ for 5 min; 4℃ storage. Take 10 μl of PCR product and add it to 1% agarose gel, run it at 160V for 30 min, and take pictures and record ( Figure 4 a);

[0117] Pladienolide B was purchased from Taoshu Biotechnology Co., Ltd., product number T16551.

[0118] 2. Use flow cytometry to analyze the fluorescence changes of the CTNNB1 3'UTR splicing reporter vector after treatment with different concentrations of Pladienolide B;

[0119] On the first day, 200,000 CTNNB1 3'UTR splicing reporter vector cells were plated in a 24-well plate. On the second day, the reporter cells were treated with different concentrations of Pladienolide B (25nM, 50nM, 75nM, 100nM, 150nM, 200nM, 250nM, 500nM, 1μM) and an equal volume of DMSO (control group). After 24 hours, the cells were digested into single cells, and the expression intensity of green fluorescence (FITC-A) and red fluorescence (PE-Texas Red-A) after treating CTNNB1 3'UTR splicing reporter vector with different concentrations of spliceosome inhibitor Pladienolide B was detected by flow cytometry. Figure 4 b).

[0120] 3. Results and Conclusions

[0121] Under normal culture conditions, the internal reference red fluorescence and green fluorescence of the reporter vector were both expressed, but after treatment with more than 50nM Pladienolide B, the ratio of green fluorescence to red fluorescence in the cells was significantly reduced, and CTNNB1 3'UTR splicing was inhibited. The higher the concentration, the higher the degree of splicing inhibition, and the more obvious the reduction in the ratio of green fluorescence to red fluorescence. This shows that the reporter vector has high sensitivity.

[0122] Example 4: Application of CTNNB1 3'UTR splicing reporter vector

[0123] 1. Purpose:

[0124] Splicing reporter vectors were used to screen for potential new anticancer drug small molecules that regulate CTNNB1 splicing.

[0125] 2. Methods:

[0126] 1. Screening of drug-like small molecule library using CTNNB1 3'UTR splicing reporter vector

[0127] Amplify reporter cells in 15 cm plates in advance to obtain enough reporter cells for screening. Each complete 384-well plate requires about 1 million cells. A total of 16 384-well plates are required for this experiment.

[0128] Remove the small molecule compound library source plate from the -20°C freezer 2 hours in advance, equilibrate to room temperature, and centrifuge at 1,000×g for 5 minutes to ensure that no compound remains on the foil seal. Remove the foil seal from the source plate. Use Echo650 to transfer 25nL of the 10mM compound stock solution to a special 384-well plate with a glass bottom with low autofluorescence for high-content imaging. Seal the compound plate with a new foil seal. There are no corresponding small molecules in columns 1, 2, 23, and 24. Add 25nL DMSO alone to column 2 and 25nL 100nM Pladienolide B to column 23 as a positive control. Store the cell culture plate with the added compounds at 4°C. The plate should be equilibrated to room temperature before adding cells.

[0129] Dilute the cells to 5x10 4 / mL into a sterile container to prepare 300mL of cell solution.

[0130] Using a BioTek MultiFlo FX multi-function dispenser with a 50 mL tube, add 50 μL of the prepared cell suspension to each well of a 384-well plate to which compounds have been added in advance, skipping columns 1 and 24. After the plate is covered, centrifuge the plate at 200 × g for 1 minute in a tabletop centrifuge and place it in a 37°C, 5% CO2 incubator for 24 hours.

[0131] The small molecule drug compound library was purchased from Life Chemical Company and belongs to Life Chemicals pre-plated diversity sets;

[0132] The 384-well plate was purchased from PerkinElmer, product number 6057300.

[0133] 2. Use high-content imaging detection method to detect the changes in the fluorescence intensity of the reporter vector

[0134] After 24 hours of culture, live cells were analyzed using the Opera Phenix High Content Imaging System (PerkinElmer). Images were acquired using a 10x microscope in wide-field mode with two filter combinations at 5% CO2 and 37°C. Filters designed for Alexa Fluor 488 (GFP: excitation: 460nm-490nm, emission 500nm-550nm) and Alexa Fluor 594 (RFP: excitation: 560nm-630nm, emission 580nm-620nm) were used to measure reporter fluorescence intensity. Three images were collected per well to allow scoring of each test condition.

[0135] Image analysis was performed using Harmony High Content Analysis Software 4.1. The “Select Cell Population” function of the software was used to set the fluorescence intensity threshold to identify the total cell population. At the same time, the dual-color (GFP / RFP) fluorescence intensity ratio of the cells was measured to evaluate the differences in reporter vector splicing after different small molecule treatments. The final output features in the analysis protocol included the total number of cells in all wells, and the average intensity of green fluorescence and red fluorescence of each cell in the well ( Figure 5 a and b).

[0136] 3. RT-PCR and Western blot experiments were used to detect the regulation of CTNNB1 by the positive small molecule Hit1, and the cytotoxicity of the positive small molecule was detected by MTT experiment.

[0137] (1) RT-PCR was used to determine the effect of Hit1 on splicing of endogenously expressed CTNNB1 3'UTR in HEK293T cells

[0138] On the first day, 200,000 CTNNB1 3'UTR splicing reporter vector cells were plated in a 24-well plate. On the second day, the reporter cells were treated with 10 μM Hit1 and an equal volume of DMSO (control group). After 24 hours, the cellular RNA was extracted using an RNA extraction kit. 500 ng of total RNA was taken and reverse transcribed using a reverse transcription kit in a 10 μl system. After obtaining cDNA, it was diluted 10 times and then amplified by PCR. The PCR system included 1 μl of diluted cDNA, 1 μl of 10 μM Primer13 and 1 μl of 10 μM Primer14, 10 μl of DNA polymerase mix, and 7 μl of sterile water. The PCR amplification conditions were: pre-denaturation at 95°C for 5 min; 95°C for 30 s; 58°C for 30 s; 72°C for 30 s; 30 cycles; 72°C for 5 min; and storage at 4°C. Take 10 μl of PCR product and add it to 1% agarose gel, run at 160 V for 30 minutes, and take pictures and record ( Figure 6 a).

[0139] Primer13:TATGGACCCCATGATGGAAC

[0140] Primer14:CAAGCAAGGCTAGGGTTTGA

[0141] The full-length PCR product of endogenous CTNNB1 was 731 bp, and the PCR product after 3'UTR splicing was 267 bp.

[0142] (2) Western blot was used to detect the regulation of Hit1 on CTNNB1 protein

[0143] On the first day, 500,000 CTNNB1 3'UTR splicing reporter cells were plated in a 6-well plate. On the second day, cells were treated with 5 μM, 10 μM Hit1 and an equal volume of DMSO (control group). After 24 hours, cells were lysed to prepare protein samples, and the expression of CTNNB1 protein was detected by Western blot. At the same time, GAPDH protein was used as an internal reference ( Figure 6 b).

[0144] CTNNB1 and GAPDH antibodies were purchased from Wuhan Abotek Biotechnology Co., Ltd., product numbers: AC001 (GAPDH), A19657 (CTNNB1).

[0145] (3) Using MTT to determine the cytotoxicity of positive small molecules

[0146] On the first day, 8000 reporter cells were seeded in each well of a 96-well plate, and cell culture medium containing 200nM, 1μM, 5μM, 10μM, 20μM, and 50μM Hit1 was added to treat the reporter cells for 24 hours before conducting an MTT experiment. The specific steps were as follows: the cell culture medium was aspirated, 50μl of 1mg / ml MTT working solution was added to each well, and the cells were placed in an incubator for incubation for 4 hours, and then the working solution was aspirated, 100μl of DMSO was added to each well, and the cells were placed in a carbon dioxide incubator for incubation for 10 minutes to fully dissolve the crystals, and then the 96-well plate was taken out and the OD value was measured at 570nm using an enzyme reader ( Figure 6 c).

[0147] 3. Results and Conclusion

[0148] The fluorescence intensity of the reporter cells was different under different small molecule culture conditions. A positive small molecule Hit1 was screened from a library of 5120 drug-like small molecules. Hit1 can inhibit the splicing of CTNNB13'UTR in HEK293T, reduce protein expression, and inhibit cell proliferation. This shows that the fluorescent reporter vector is practical and can show the difference in fluorescence intensity under different small molecule treatment conditions, reflecting the effects of different small molecules on CTNNB13'UTR, and at the same time screen out potential anti-cancer small molecules.

[0149] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions in the specification are only to illustrate the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A reporter vector for target gene 3'UTR splicing, characterized in that: The reporter vector comprises a nucleic acid construct having a structure of Formula I from the 5' end to the 3' end: P1-X1-L1-X2-X3-X4 Type I in, P1 is the promoter; X1 is the internal reference fluorescent protein; L1 is the target gene fragment T and a partial sequence U of its 3'UTR; said L1 is the sequence shown in SEQ ID No: 1; X2 is a reporter fluorescent protein, and the reporter fluorescent protein is a d2-modified fluorescent protein; X3 is the RNA nuclear export signal; X4 is a polyA signal; and Each "-" is independently a bond or a nucleotide linking sequence.

2. The reporting vector according to claim 1, characterized in that The internal reference fluorescent protein and the reporter fluorescent protein are fluorescent proteins of different colors.

3. The reporter carrier according to claim 2, characterized in that The internal reference fluorescent protein and the reporter fluorescent protein are selected from green fluorescent protein, yellow fluorescent protein, red fluorescent protein and blue fluorescent protein.

4. The reporting vector according to claim 3, characterized in that The reporter fluorescent protein is green fluorescent protein, and the internal reference fluorescent protein is red fluorescent protein.

5. The reporting vector according to claim 4, characterized in that The green fluorescent protein is d2EGFP, and the red fluorescent protein is mCherry, mKate2, or DsRed.

6. The reporting carrier according to claim 1 or 2, characterized in that The promoter is selected from the group consisting of CMV promoter, CAG promoter, PGK promoter, EF1α promoter or a combination thereof.

7. The reporting carrier according to claim 1 or 2, characterized in that The polyA signal is selected from the group consisting of polyA of BGH, polyA of SV40, polyA of PGK or a combination thereof.

8. The reporting carrier according to any one of claims 1 or 2, characterized in that The RNA nuclear export signal is selected from MPMV-CTE, HIV-RRE or a combination thereof.

9. The reporting vector according to claim 1, characterized in that The nucleic acid construct has the sequence shown in SEQ ID No:

5.

10. The reporter vector according to claim 1, characterized in that The reporter vector is a plasmid.

11. The reporting vector according to claim 10, characterized in that The plasmid is a plasmid constructed from the PB6-CMV plasmid.

12. The method for using the reporting carrier according to any one of claims 1 to 11, characterized in that: The reporter vector is transfected into cells and expressed; and the splicing regulation of the 3'UTR of the target gene is determined by the fluorescence intensity of the internal reference fluorescent protein and the reporter fluorescent protein.

13. The method of use according to claim 12, characterized in that: The cells are animal embryonic cells or human cancer cells.

14. The method of use according to claim 13, characterized in that: The animal embryonic cells or human cancer cells are embryonic kidney cells HEK-293T, human breast cancer cells MCF-7, liver cancer cells HepG2, or liver cancer cells BEL-7404.

15. The method for preparing a reporter carrier according to any one of claims 1 to 11, characterized in that: The method comprises: (1) Amplifying and obtaining the gene fragments of X1, L1, X2, X3 and X4 respectively; (2) The gene fragments of X1, L1, X2, X3 and X4 are sequentially integrated into the vector from the 5' end to the 3' end through homologous recombination.

Images