Penaeus vannamei beta-glucosidase gene molecular marker and application thereof
By screening SNP molecular markers of the β-glucosidase gene in Litopenaeus vannamei, the problem of Litopenaeus vannamei's unsuitable growth in low-temperature environments has been solved, enabling the breeding of cold-resistant varieties and promoting the healthy development of Litopenaeus vannamei aquaculture.
Patent Information
- Application Number
- CN202410704768.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-03
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-06-03
AI Technical Summary
Litopenaeus vannamei is not suited to growing in low-temperature environments and is prone to disease. Current technology lacks effective molecular marker-assisted breeding methods to select cold-resistant varieties.
Based on the screening of single nucleotide polymorphism (SNP) molecular markers using the β-glucosidase gene of Litopenaeus vannamei, the genotype was determined by PCR amplification and sequencing, and individuals with cold-resistant traits were selected for breeding.
This has enabled the efficient and accurate breeding of cold-resistant and stress-resistant Litopenaeus vannamei varieties, providing a theoretical basis for low-temperature aquaculture of Litopenaeus vannamei and promoting the healthy development of the industry.
Smart Images

Figure CN118374607B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of breeding of Litopenaeus vannamei, and particularly relates to a beta-glucuronidase gene molecular marker of Litopenaeus vannamei and application thereof. BACKGROUND
[0002] Litopenaeus vannamei, also known as Penaeus vannamei, has been introduced into China and rapidly developed in coastal cities of China due to its fast growth, high yield, good economic benefits, wide salinity, and delicious taste, and has become the highest-yield shrimp variety in China. Litopenaeus vannamei is a subtropical animal, and its suitable growth temperature range is 20-30℃. When the temperature is lower than 20℃, the appetite and immunity of Litopenaeus vannamei will decrease, the resistance to viruses and parasites will also decrease, and various diseases are prone to occur. When the temperature is higher than 30℃, the metabolism of Litopenaeus vannamei will accelerate, but long-term high-temperature environment will cause disorder of Litopenaeus vannamei, and affect the growth and immunity. Therefore, the environmental problems increase the difficulty of breeding of Litopenaeus vannamei in northern China and the short annual suitable breeding time of Litopenaeus vannamei causes the economic depression of the shrimp breeding industry.
[0003] Beta-glucuronidase, also known as beta-D-glucuronoside glucoside hydrolase, alias gentiobiosidase, cellobias (CB or beta-G), and prunasinase, widely exists in animals, plants, and microorganisms, is one of key enzymes in the process of cellulose saccharification, is an important component in the cellulose-decomposing enzyme system, can hydrolyze the terminal non-reducing beta-D-glucoside bond and release beta-D-glucose and corresponding ligand, and is one of important members in the sugar metabolic pathway in organisms. Beta-glucuronidase can participate in the metabolism of cellulose and various physiological and biochemical pathways. It has been found that screening of strains with high-efficiency beta-glucuronidase from microorganisms has important significance for the utilization of cellulose resources. In addition, abnormal function of the enzyme can cause metabolic diseases, and the enzyme is also a target of various drugs and inhibitors for regulating the sugar chemical metabolism in organisms.
[0004] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by single nucleotide variation at the genome level, has the advantages of large number, wide distribution, strong representation, good genetic stability, high-throughput, and high degree of automation for detection and analysis, has been widely applied to the construction of genetic maps of animals and plants, QTL positioning, and analysis of functional genes, and effectively promotes molecular marker-assisted breeding, but there is few reports on application of SNPs to breeding of cold-tolerant varieties of Litopenaeus vannamei. SUMMARY
[0005] In view of the above, the present application discloses a kind of Penaeus vannamei β-glucuronidase gene molecular markers, based on the SNP molecular marker of the beta-glucuronidase gene of Penaeus vannamei, the SNP molecular marker is used as the functional marker of the cold tolerance of Penaeus vannamei, for breeding and obtaining the Penaeus vannamei variety with cold tolerance.
[0006] The present application is realized by adopting the following technical solutions:
[0007] A kind of Penaeus vannamei β-glucuronidase gene molecular markers, it includes any one or more of molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K, molecular marker L, molecular marker M, molecular marker N, molecular marker O and molecular marker P;
[0008] The molecular marker A is located at the 4174 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, and is recorded as D.4174 G>C, the base of the site is C or G, and the mutation type is C / G heterozygous, G / G homozygous;
[0009] The molecular marker B is located at the 4179 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, and is recorded as D.4179 G>A, the base of the site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, G / G homozygous;
[0010] The molecular marker C is located at the 4201 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, and is recorded as D.4201 A>G, the base of the site is A or G, and the mutation type is A / A homozygous, A / G heterozygous;
[0011] The molecular marker D is located at the 4220 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, and is recorded as D.4220 A>T, the base of the site is A or T, and the mutation type is A / A homozygous, A / T heterozygous;
[0012] The molecular marker E is located at the 4222 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, and is recorded as D.4222 G>A, the base of the site is A or G, and the mutation type is A / G heterozygous, G / G homozygous;
[0013] The molecular marker F is located at the 4225 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, and is recorded as D.4225 A>G, the base of the site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, G / G homozygous.
[0014] The molecular marker G is located at the 4229 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4229 A>G, the base of the site is A or G, and the mutation type is A / A homozygous, A / G heterozygous;
[0015] The molecular marker H is located at the 4254 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4254 C>T, the base of the site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, T / T homozygous;
[0016] The molecular marker I is located at the 4291 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4291 G>A, the base of the site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, G / G homozygous;
[0017] The molecular marker J is located at the 4297 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4297 C>T, the base of the site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, T / T homozygous;
[0018] The molecular marker K is located at the 4380 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4380 C>T, the base of the site is C or T, and the mutation type is C / C homozygous, C / T heterozygous;
[0019] The molecular marker L is located at the 4497 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4497 A>G, the base of the site is A or G, and the mutation type is A / A homozygous, A / G heterozygous;
[0020] The molecular marker M is located at the 4524 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4524 T>C, the base of the site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, T / T homozygous;
[0021] The molecular marker N is located at the 4526 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4526 G>A, the base of the site is A or G, and the mutation type is A / G heterozygous, G / G homozygous;
[0022] The molecular marker O is located at the 4536 bp site of the nucleotide sequence shown in SEQ. 1 in the sequence listing, recorded as D.4536 G>A, the base of the site is A or G, and the mutation type is A / G heterozygous, G / G homozygous;
[0023] The molecular marker P is located at the 4574 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4574 G>A, the base of the site is A or G, and the mutation type is A / G heterozygous, G / G homozygous.
[0024] The nucleotide sequence shown in sequence 1 in the sequence listing is the nucleotide sequence of the gene beta-glucuronidase gene.
[0025] The application of the Penaeus vannamei β-glucuronidase gene molecular marker is to use the Penaeus vannamei β-glucuronidase gene molecular marker for selection breeding of Penaeus vannamei with cold tolerance traits. Specifically, the genomic DNA of the muscle tissue of the Penaeus vannamei to be tested is extracted, then the genomic DNA is used as template DNA for PCR amplification and purification of the PCR amplification product, and then the purified amplification product is sequenced to determine the genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F, the molecular marker G, the molecular marker H, the molecular marker I, the molecular marker J, the molecular marker K, the molecular marker L, the molecular marker M, the molecular marker N, the molecular marker O and the molecular marker P.
[0026] When the genotype of molecular marker A is the disadvantage genotype CC or CG genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker B is the disadvantage genotype GG genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker C is the advantage genotype AG genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker D is the disadvantage genotype AT or TT genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker E is the advantage genotype AG genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker F is the advantage genotype AA or AG genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker G is the disadvantage genotype AG or GG genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker H is the advantage genotype CC genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker I is the advantage genotype GG genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker J is the advantage genotype CC genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker K is the disadvantage genotype CT or TT genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker L is the advantage genotype AG genotype, select the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker M is the disadvantage genotype CC or CT genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker N is the disadvantage genotype AA or AG genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker O is the disadvantage genotype AA or AG genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding; when the genotype of molecular marker P is the disadvantage genotype AA or AG genotype, then avoid selecting the individual as a back-up parent for Penaeus vannamei breeding.
[0027] In the PCR amplification process, the primer set for detecting the molecular marker of the β-glucosidase gene of Penaeus vannamei comprises primer F and primer R, the sequence of the primer F is GTATGATCGCACTTTTTACGTGC (sequence 2 in the sequence listing), and the sequence of the primer R is CCTGGGTACACTACATTCAGTCT (sequence 3 in the sequence listing).
[0028] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upper primer F at a concentration of 10 μmol / L, 2 μL of primer R at a concentration of 10 μmol / L, and 20 μL of ddH2O.
[0029] The PCR amplification reaction procedure includes the following steps:
[0030] S1. Pre-denaturate at 94℃ for 3 min;
[0031] S2. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s.
[0032] S3. Extend at 72℃ for 10 minutes.
[0033] Compared with existing technologies, this technical solution has the following advantages:
[0034] 1. Based on the analysis and screening of the beta-glucuronidase gene in Litopenaeus vannamei, this invention provides SNP molecular markers that are closely related to the cold resistance trait of Litopenaeus vannamei. These markers can be applied to the breeding of new cold-resistant varieties of Litopenaeus vannamei, which is beneficial to promoting the research and application of cold-resistant and stress-resistant aquaculture of Litopenaeus vannamei.
[0035] 2. This invention utilizes SNP technology to molecularly mark the β-glucosidase gene of Litopenaeus vannamei, thereby selecting individuals with superior genotypes for Litopenaeus vannamei breeding. This allows for the accurate and efficient breeding of Litopenaeus vannamei varieties with strong cold resistance and stress tolerance, providing a sound theoretical basis for the research and improvement of new low-temperature tolerant varieties of Litopenaeus vannamei, and laying the foundation for promoting the healthy development of the industry. Attached Figure Description
[0036] Figure 1 These are partial sequences of the product obtained from amplifying the beta-glucuronidase gene in the examples. 'a' represents positions 108-114, showing the CG and GG peaks at the D.4174 G>C site; 'b' represents positions 113-119, showing the AA, AG, and GG peaks at the D.4179 G>A site; 'c' represents positions 135-141, showing the AA and AG peaks at the D.4201 A>G site; and 'd' represents positions 152-158, showing the AA and AT peaks at the D.4220 A>T site.
[0037] Figure 2is a partial fragment sequence of the product amplified from the beta-glucuronidase gene in the example, e represents the 154th to 161st position, wherein the AG, GG peak figure of D.4222 G>A site is shown; f represents the 160th to 164th position, wherein the AA, AG, GG peak figure of D.4225 A>G site is shown; g represents the 163rd to 169th position, wherein the AA, AG peak figure of D.4229 A>G site is shown; h represents the 188th to 194th position, wherein the CC, CT, TT peak figure of D.4254 C>T site is shown.
[0038] Figure 3 is a partial fragment sequence of the product amplified from the beta-glucuronidase gene in the example, i represents the 226th to 232nd position, wherein the AA, AG, GG peak figure of D.4291 G>A site is shown; j represents the 231st to 237th position, wherein the CC, CT, TT peak figure of D.4297 C>T site is shown; k represents the 316th to 322nd position, wherein the CC, CT peak figure of D.4380 C>T site is shown; 1 represents the 430th to 436th position, wherein the AA, AG peak figure of D.4497 A>G site is shown.
[0039] Figure 4 is a partial fragment sequence of the product amplified from the beta-glucuronidase gene in the example, m represents the 456th to 462nd position, wherein the CC, CT, TT peak figure of D.4524 T>C site is shown; n represents the 462nd to 468th position, wherein the AG, GG peak figure of D.4526 G>A site is shown; o represents the 470th to 476th position, wherein the AG, GG peak figure of D.4536 G>A site is shown; p represents the 508th to 514th position, wherein the AG, GG peak figure of D.4574 G>A site is shown. DETAILED DESCRIPTION
[0040] The present application is further illustrated by the following examples, but not as a limitation to the present application. The specific experimental conditions and methods not specified in the following examples, and the technical means adopted are generally conventional means familiar to those skilled in the art.
[0041] Example: The specific process of screening the Penaeus vannamei β-glucuronidase gene molecular marker described in the present application is as follows:
[0042] (1) Select 120 body weight of about 3 grams of white shrimp in South America, after 2 days of temporary culture, carry out cold tolerance experiment under 9.5-10.5℃ stress condition, take the first 40 dead shrimps as low temperature sensitive group, and take the last 40 still alive shrimps as low temperature tolerant group;
[0043] (2) Randomly select 5 white shrimps in South America in the low temperature sensitive group and the low temperature tolerant group, extract muscle tissue and extract genomic DNA by using the conventional phenol extraction method, and store the obtained genomic DNA at-20℃ for standby;
[0044] (3) According to the nucleotide sequence of the beta-glucuronidase gene of the white shrimp in South America, the primer F and the primer R are designed, and then the SNP site located in the beta-glucuronidase gene is amplified and screened;
[0045] The sequence of the primer F is: GTATGATCGCACTTTTTACGTGC.
[0046] The sequence of the primer R is: CCTGGGTACACTACATTCAGTCT.
[0047] The PCR amplification system is composed of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.
[0048] The reaction program of the PCR amplification includes the following steps:
[0049] S1, pre-denaturation at 94℃ for 3min;
[0050] S2, denaturation at 94℃ for 30s, annealing at 60℃ for 30s, extension at 72℃ for 45s, for 35 cycles;
[0051] S3, extension at 72℃ for 10min;
[0052] (4) After the PCR amplification product is detected by 1% agarose gel electrophoresis, it is purified and sequenced, and the sequencing results are analyzed by using DNAstar software, including nucleotide sequence alignment and peak graph analysis, and the related SNPs sites are screened out; the sequence of the PCR amplification product of one sample is as follows:
[0053] GTATGATCGCACTTTTTACGTGCCTGTGAGATGGCAAGCTGACAAGCAGAGAGTTGTTCTTCGTCTTGGGTCTGCCCATTACAACTCAGTCATTGTGAGTATTACCTATGGTACAGTATAGATATATGTTTTAGATTATATTTGTAAGAGTCCAGAATGAAGATAAATAATTTGAATATTTTTGTATAACCACATATTCTTACCGTTAAAATTATCACTCAGAAAGAAAAGGATTCCACAATTTTCAGTACATCAATGGTGTAGCTGTGACGTCCCATGAAGGAGGACATCTCCCCATAATGGCTGAGATAGCGGGCAGTCTTAAATTCGGAAAGGAGAACCTCATTACTGTGGCCATCAACAACACTTTGACGCCCAGCACGATACCTCAGGGAAAGATTGTCTACCATAACGACACTACGAAGCAAGTTCTATGACTTTGTGGTTGTATTTGATTTTGTTGATGAAATAGGTTAAGAAAAACTCTGGTCAGGATTATCAGATTAATAAGAGACTGAATGTAGTGTACCCAGG;
[0054] wherein the 111th position is D.4174 G>C, the 116th position is D.4179 G>A, the 138th position is D.4201 A>G, the 157th position is D.4220 A>T, the 159th position is D.4222 G>A, the 162nd position is D.4225 A>G, the 166th position is D.4229 A>G, the 191st position is D.4254 C>T, the 228th position is D.4291 G>A, the 234th position is D.4297 C>T, the 317th position is D.4380 C>T, the 434th position is D.4497 A>G, the 461st position is D.4524 T>C, the 463rd position is D.4526 G>A, the 473rd position is D.4536 G>A, and the 511st position is D.4574 G>A;
[0055] (5) According to the screened SNPs, the sensitive group and the resistant group of the white shrimp are detected and genotyped according to the above method, the samples of different SNP sites in the sensitive group and the resistant group are counted, the genotype frequency and the allele frequency are calculated, and the independence test is carried out by chi-square analysis, and the chi-square analysis results are shown in Tables 1-3;
[0056] According to the analysis of Table 1, the genotype polymorphism of each molecular marker site has a significant influence on the cold tolerance of Penaeus vannamei: the cold tolerance disadvantageous individuals of molecular marker A are CC and CG genotypes; the cold tolerance disadvantageous individuals of molecular marker B are GG genotypes; the cold tolerance advantageous individuals of molecular marker C are AG genotypes; the cold tolerance disadvantageous individuals of molecular marker D are AT and TT genotypes; the cold tolerance advantageous individuals of molecular marker E are AG genotypes; the cold tolerance advantageous individuals of molecular marker F are AA and AG genotypes; the cold tolerance disadvantageous individuals of molecular marker G are AG and GG genotypes; the cold tolerance advantageous individuals of molecular marker H are CC genotypes; the cold tolerance advantageous individuals of molecular marker I are GG genotypes; the cold tolerance advantageous individuals of molecular marker J are CC genotypes; the cold tolerance disadvantageous individuals of molecular marker K are CT and TT genotypes; the cold tolerance advantageous individuals of molecular marker L are AG genotypes; the cold tolerance disadvantageous individuals of molecular marker M are CC and CT genotypes; the cold tolerance disadvantageous individuals of molecular marker N are AA and AG genotypes; the cold tolerance disadvantageous individuals of molecular marker O are AA and AG genotypes; and the cold tolerance disadvantageous individuals of molecular marker P are AA and AG genotypes.
[0057] The present application extracts DNA from the appendage muscle tissue of Penaeus vannamei, which does not have too much influence on the body of the shrimp. Breeding can be carried out by using the method of molecular assisted breeding, for example, using the method of gene knockout or gene editing to process the varieties obtained after the molecular markers.
[0058] Table 1: Results of chi-square analysis of part of the sites
[0059]
[0060] Table 2: Results of chi-square analysis of part of the sites
[0061]
[0062] Table 3: Results of chi-square analysis of part of the sites
[0063]
[0064] In addition, it should be understood that, although the present specification is described in terms of embodiments, not every embodiment contains only one independent technical solution, and the description of the specification is only for the sake of clarity, and those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that those skilled in the art can understand.
Claims
1. Use of a Penaeus vannamei β-glucosidase gene molecular marker, characterized in that: the Penaeus vannamei β-glucosidase gene molecular marker comprises molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K, molecular marker L, molecular marker M, molecular marker N, molecular marker O and molecular marker P; the molecular marker A is located at the 4174 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4174G>C, the base of the site is C or G, and the mutation type is C / G heterozygote, G / G homozygote; the molecular marker B is located at the 4179 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4179G>A, the base of the site is A or G, and the mutation type is A / A homozygote, A / G heterozygote, G / G homozygote; the molecular marker C is located at the 4201 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4201A>G, the base of the site is A or G, and the mutation type is A / A homozygote, A / G heterozygote; the molecular marker D is located at the 4220 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4220A>T, the base of the site is A or T, and the mutation type is A / A homozygote, A / T heterozygote; the molecular marker E is located at the 4222 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4222G>A, the base of the site is A or G, and the mutation type is A / G heterozygote, G / G homozygote; the molecular marker F is located at the 4225 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4225A>G, the base of the site is A or G, and the mutation type is A / A homozygote, A / G heterozygote, G / G homozygote; the molecular marker G is located at the 4229 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4229A>G, the base of the site is A or G, and the mutation type is A / A homozygote, A / G heterozygote; the molecular marker H is located at the 4254 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4254C>T, the base of the site is C or T, and the mutation type is C / C homozygote, C / T heterozygote, T / T homozygote; the molecular marker I is located at the 4291 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4291G>A, the base of the site is A or G, and the mutation type is A / A homozygote, A / G heterozygote, G / G homozygote; the molecular marker J is located at the 4297 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is recorded as D.4297C>T, the base of the site is C or T, and the mutation type is C / C homozygote, C / T heterozygote, T / T homozygote. The molecular marker K is located at the 4380th site of the nucleotide sequence shown in SEQ.1 in the sequence listing, recorded as D.4380C>T, the base of the site is C or T, the mutation type is C / C homozygous, C / T heterozygous; The molecular marker L is located at the 4497th site of the nucleotide sequence shown in SEQ.1 in the sequence listing, recorded as D.4497A>G, the base of the site is A or G, the mutation type is A / A homozygous, A / G heterozygous; The molecular marker M is located at the 4524th site of the nucleotide sequence shown in SEQ.1 in the sequence listing, recorded as D.4524T>C, the base of the site is C or T, the mutation type is C / C homozygous, C / T heterozygous, T / T homozygous; The molecular marker N is located at the 4526th site of the nucleotide sequence shown in SEQ.1 in the sequence listing, recorded as D.4526G>A, the base of the site is A or G, the mutation type is A / G heterozygous, G / G homozygous; The molecular marker O is located at the 4536th site of the nucleotide sequence shown in SEQ.1 in the sequence listing, recorded as D.4536G>A, the base of the site is A or G, the mutation type is A / G heterozygous, G / G homozygous; The molecular marker P is located at the 4574th site of the nucleotide sequence shown in SEQ.1 in the sequence listing, recorded as D.4574G>A, the base of the site is A or G, the mutation type is A / G heterozygous, G / G homozygous; The application is the use of the Penaeus vannamei β-glucosidase gene molecular marker in the selection breeding of Penaeus vannamei with cold tolerance traits, specifically, the genomic DNA of the muscle tissue of the Penaeus vannamei to be tested is extracted, the genomic DNA is used as template DNA for PCR amplification and purification of the PCR amplification product, and then the purified amplification product is sequenced to determine the genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F, the molecular marker G, the molecular marker H, the molecular marker I, the molecular marker J, the molecular marker K, the molecular marker L, the molecular marker M, the molecular marker N, the molecular marker O and the molecular marker P. When the genotype of molecular marker A is the disadvantage genotype CC or CG genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker B is the disadvantage genotype GG genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker C is the advantage genotype AG genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker D is the disadvantage genotype AT or TT genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker E is the advantage genotype AG genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker F is the advantage genotype AA or AG genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker G is the disadvantage genotype AG or GG genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker H is the advantage genotype CC genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker I is the advantage genotype GG genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker J is the advantage genotype CC genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker K is the disadvantage genotype CT or TT genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker L is the advantage genotype AG genotype, select the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker M is the disadvantage genotype CC or CT genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker N is the disadvantage genotype AA or AG genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker O is the disadvantage genotype AA or AG genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding; when the genotype of molecular marker P is the disadvantage genotype AA or AG genotype, then avoid selecting the individual as a reserve parent for Penaeus vannamei breeding.
2. The use of the Penaeus vannamei β-glucosidase gene molecular marker according to claim 1, characterized in that: In the PCR amplification process, the primer set for detecting the molecular marker of the β-glucosidase gene of Penaeus vannamei comprises primer F and primer R, the sequence of the primer F is GTATGATCGCACTTTTTACGTGC, and the sequence of the primer R is CCTGGGTACACTACATTCAGTCT.
3. The use of the white shrimp (Litopenaeus vannamei) β-glucosidase gene molecular marker according to claim 2, characterized in that: The PCR amplification system is composed of the following components: 25 μL of 2 × Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.
4. The use of the white shrimp (Litopenaeus vannamei) β-glucosidase gene molecular marker according to claim 1, characterized in that: The reaction procedure of the PCR amplification comprises the following steps: S1, pre-denaturation at 94℃ for 3 min; S2, denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 45 s, and 35 cycles; S3, extension at 72℃ for 10 min.
Citation Information
Patent Citations
Compound traditional Chinese medicine powder decoction formula for improving low-temperature resistance of Penaeus vannamei
CN105497174A
Litopenaeus vannamei Na,K-ATPase Alpha subunit gene amplification primers and method and Litopenaeus vannamei Na,K-ATPase Alpha subunit gene SNP-marked screening amplification primers and method
CN106978426A