circMGMT and its application in the preparation or screening of colorectal cancer therapeutic drugs
The circMGMT gene interference reduces tumor cell expression and combines lentiviral vector delivery, solves the problem of insufficient markers in colorectal cancer treatment, achieves efficient tumor suppression and diagnostic effects, and provides a new treatment strategy.
Patent Information
- Application Number
- CN202410676467.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-29
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2044-05-29
AI Technical Summary
The prior art lacks effective molecular mechanism understanding and highly specific and sensitive markers in the treatment methods for colorectal cancer, resulting in insufficient treatment strategies and difficult to effectively block the growth and metastasis of cancer cells.
The circMGMT gene was used as a target to reduce the expression level of circMGMT in tumor cells through siRNA or shRNA interference, and the lentiviral vector was used to transmit the circMGMT interference vector, and combined with reagents to detect the expression of circMGMT, a new colorectal cancer treatment strategy was developed.
It significantly reduces the clonal formation, invasion and migration capabilities of colorectal cancer cells, provides a diagnostic tool with high specificity and sensitivity, and inhibits tumor growth in animal models, providing new therapeutic ideas.
Smart Images

Figure CN118389518B_ABST
Abstract
Description
Technical field:
[0001] The present invention belongs to the technical field of tumor molecular biology, and specifically relates to the circMGMT gene and its application as a target in the preparation or screening of colorectal cancer therapeutic drugs, especially to the circMGMT nucleic acid fragment and its correlation with colorectal cancer tumor proliferation, invasion and migration, and its application in the treatment. Background technology:
[0002] Colorectal cancer (CRC) is a common digestive system malignancy with high morbidity and mortality, ranking fourth among malignant tumors in my country. The pathogenesis of CRC is complex, linked to genetics, immunity, inflammation, and abnormal activation of tumor-related signaling pathways. In recent years, the incidence and mortality of CRC in China have increased annually, with a younger age group, severely impacting the physical and mental health of patients. While significant progress has been made in the treatment of CRC with the continuous advancement of imaging and endoscopic techniques, a deeper understanding of the molecular mechanisms of CRC occurrence and progression remains urgent, along with the development of effective treatments to reduce mortality.
[0003] Circular RNA (circRNA) is a type of noncoding RNA that lacks a 5' cap and a 3' poly(A) tail. Instead, it forms a covalently closed single-stranded circular RNA molecule formed by reverse splicing. A growing number of studies have shown that circRNAs exert their regulatory effects in various ways: regulating RNA-binding proteins or directly regulating gene transcription. Some circRNAs can also directly translate and encode polypeptides for regulatory purposes. However, they are more commonly found to play a key role in the development and progression of cancer, acting as miRNA sponges, or competing for endogenous RNAs, and may serve as cancer biomarkers and new therapeutic targets. Therefore, research into the functions and mechanisms of circRNAs is of great scientific and clinical significance. Summary of the invention:
[0004] In response to the shortcomings of the existing technology, the present invention aims to provide the use of the circMGMT gene in the preparation or screening of colorectal cancer therapeutics. The present invention provides a new colorectal cancer marker, the circMGMT gene. The expression level of the circMGMT gene in colorectal cancer may be associated with the occurrence, progression, and prognosis of the disease, with high specificity and sensitivity. Based on this colorectal cancer marker, a new colorectal cancer therapeutic target is provided, and a therapeutic strategy targeting the circMGMT gene is developed, providing new ideas and directions for the treatment of colorectal cancer.
[0005] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:
[0006] A circMGMT, the sequence of which is shown in SEQ ID NO: 1.
[0007] The use of circMGMT described in the present invention in the preparation or screening of drugs for treating colorectal cancer.
[0008] The colorectal cancer treatment drug includes a preparation that reduces the expression level of circMGMT in tumor cells.
[0009] The preparation for reducing the expression level of the circMGMT gene in tumor cells comprises at least one of siRNA of the circMGMT gene and shRNA of the circMGMT gene.
[0010] The siRNA sequence is:
[0011] si-circMGMT-1:5'-CCCGUUUUCCAGCAAGCUCGG-3'
[0012] si-circMGMT-2:5'-CCGAGCUUGCUGGAAAACGGG-3'.
[0013] Control si-NC: 5'-UUCUCCGAACGUGUCACGU-3'.
[0014] The sequence of the shRNA is:
[0015] sh-circMGMT-1:5'-CCGAGCTTGCTGGAAAACGGG-3'
[0016] sh-circMGMT-2: 5'-CCCGTTTTCCAGCAAGCTCGG-3'.
[0017] Control shRNA: 5′-TTCTCCGAACGUGUCACGT-3′.
[0018] The present invention also provides a drug for treating colorectal cancer, including a preparation for reducing the expression level of circMGMT in tumor cells, wherein the circMGMT sequence is shown in SEQ ID NO: 1.
[0019] The preparation for reducing the expression level of the circMGMT gene in tumor cells comprises at least one of siRNA of the circMGMT gene and shRNA of the circMGMT gene.
[0020] Furthermore, the drug is prepared by using shRNA in the form of a lentiviral vector.
[0021] The lentiviral vector contains a circMGMT gene interference lentiviral vector, and the circMGMT gene interference lentiviral vector contains a gene segment encoding a circMGMT gene shRNA in a nucleic acid molecule for treating colorectal cancer.
[0022] The circMGMT gene interference lentiviral vector is packaged by viruses with the assistance of lentiviral packaging plasmids and cell lines.
[0023] The present invention also provides the use of a reagent for detecting the expression level of circMGMT in the preparation of a colorectal cancer detection preparation.
[0024] The present invention systematically identified and screened circMGMT, which is significantly overexpressed in colorectal cancer and affects the growth of colorectal cancer cells. Previous studies have found that circMGMT is highly expressed in colorectal cancer cell lines and clinical tissue samples. After knocking down circMGMT, the expression of circMGMT in the colorectal cancer cell line SW620 cells was reduced, and the cells' ability to form clones, invade, and migrate was also reduced. Further animal pilot experiments suggest that knocking down circMGMT can significantly inhibit the growth of colorectal cancer cells. The present invention provides a scientific basis for the use of circular RNA as a treatment strategy for colorectal cancer and offers new ideas for targeting circMGMT to improve the efficacy of colorectal cancer treatment.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] (1) The present invention provides a new colorectal cancer marker, the circMGMT gene. The expression level of the circMGMT gene in colorectal cancer may be associated with the occurrence, development, and prognosis of the disease. Compared with traditional colorectal cancer markers, the circMGMT gene may have higher specificity and sensitivity.
[0027] (2) This invention provides a novel therapeutic target for colorectal cancer, a therapeutic strategy targeting the circMGMT gene. Interference with the circMGMT gene may help block the growth, metastasis, and invasion of colorectal cancer cells, thereby providing new ideas and directions for the treatment of colorectal cancer. Description of the drawings:
[0028] Figure 1 A is the expression level of circMGMT in cancer tissues and adjacent tissues of colorectal cancer patients; Figure 1 B is the expression level of circMGMT in colorectal cancer cells; Figure 1C shows the expression levels of circMGMT in colorectal cancer cells SW620 and HCT116 after transfection with si-circMGMT. The results suggest that circMGMT is highly expressed in cancerous tissues compared to adjacent adjacent tissues from colorectal cancer patients, and also in colorectal cancer cell lines. CircMGMT expression levels were significantly decreased in SW620 and HCT116 cells after transfection with si-circMGMT. (Statistical analysis between the two groups was performed using an independent sample t-test; ** indicates p < 0.01, *** indicates p < 0.001.)
[0029] Figure 2 The sensitivity and specificity of circMGMT for the diagnosis of colorectal cancer were evaluated using a receiver operating characteristic (ROC) curve. The results showed that the area under the ROC curve reached 0.730, the specificity reached 80%, and the sensitivity reached 87.6%, indicating that circMGMT has good diagnostic efficacy for colorectal cancer.
[0030] Figure 3 To inhibit the proliferation and migration of colorectal cancer cells after knocking down circMGMT, Figure 3 A shows the cell proliferation of SW620 cells after transfection of si-NC and si-circMGMT; Figure 3 B shows the formation of cell clones after SW620 cells were transfected with si-NC and si-circMGMT; Figure 3 C shows the invasion and migration of SW620 cells after transfection with si-NC and si-circMGMT. The results suggest that compared with the si-NC group, si-circMGMT significantly reduced the colony formation, invasion, and migration abilities of SW620 cells after transfection with si-circMGMT. (Independent sample t-test was used for statistical analysis between the two groups; ** indicates p < 0.01).
[0031] Figure 4 Figure 2 shows tumor growth in nude mice following subcutaneous inoculation of sh-NC and sh-circMGMT-transfected SW620 cells. The results suggest that knockdown of circMGMT significantly inhibits the growth of colorectal cancer cells. (Statistical analysis between the two groups was performed using an independent-samples t-test; ** indicates p < 0.01.) Specific implementation method:
[0032] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.
[0033] Sample collection
[0034] Cancer tissues and adjacent tissues were collected from 35 colorectal patients. The collected clinical samples had complete clinical data, including the patient's name, gender, age, hospitalization number, pathological type, pathological stage, treatment status, etc. The consent of the subjects was obtained for all clinical samples.
[0035] Cell types: Human normal colon epithelial cells (NCM460) and human colorectal cancer cell lines (HT29, HCT116, SW620, SW480, Caco-2) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were maintained in an appropriate culture environment (5% CO2, 37°C) and cultured in high-glucose DMEM (supplemented with 10% FBS). Total RNA extraction and reverse transcription of tissue samples and cell lines
[0036] RNA was extracted from tissues or cells using an RNA extraction kit, the RNA concentration was measured using NanoDrop, and then reverse-transcribed into cDNA using a reverse transcription kit.
[0037] Reverse transcription was performed using a reverse transcription kit, and the system was as follows:
[0038]
[0039] Reaction conditions:
[0040] 42°C, 90 minutes; 95°C, 5 minutes; and cooling on ice to obtain a cDNA solution.
[0041] Fluorescence quantitative PCR: First, PCR detection was performed using primers for circMGMT (synthesized by Sangon Biotechnology Co., Ltd.) as follows:
[0042] F:5'-TCCCGTTTTCCAGCAAGCTC-3'
[0043] R:5'-AGTACCAAGTCGCAAACGGT-3'
[0044] The circMGMT sequence was confirmed to be correct by sequencing the PCR product. The relative expression of circMGMT was detected using SYBR Green Mixture with -actin as an internal reference.
[0045] Fluorescence quantitative PCR system
[0046]
[0047] PCR conditions
[0048]
[0049]
[0050] After the PCR process is completed, the Ct value of each PCR reaction is obtained and the Ct value is expressed as 2 -ΔΔCt The relative expression levels of circular RNAs were calculated.
[0051] Selection of circMGMT-specific siRNA
[0052] Based on the sequence of circMGMT, siRNA was designed to specifically knock down circMGMT.
[0053] The sequence is as follows:
[0054] si-circMGMT-1:5'-CCCGUUUUCCAGCAAGCUCGG-3'
[0055] si-circMGMT-2:5'-CCGAGCUUGCUGGAAAACGGG-3'
[0056] Control si-NC: 5'-UUCUCCGAACGUGUCACGU-3'
[0057] siRNA transfection cells: Colorectal cancer cell lines were plated in 24-well plates and transfected with 1ipo3000 transfection reagent (purchased from Thermo Fisher). 1 μL siRNA (10 μM) was added to each well. Cell RNA was extracted after 72 hours, and the expression of circMGMT was detected by real-time fluorescence quantitative PCR.
[0058] CCK-8 assay for cell proliferation
[0059] The colorectal cancer cell lines transfected with si-NC or si-circMGMT were counted and the number of cells was 1×10 3 The number of colorectal cancer cells per well was seeded into 96-well plates in 100 μL of complete culture medium and cultured in a 37°C incubator. At a 10% CCK-8 concentration (10 μL of CCK-8 solution was added to 100 μL of complete culture medium), 100 μL was added to the 96-well plate and incubated at 37°C for 2 hours. The absorbance (OD value) of each well was measured at a wavelength of 450 nm using a microplate reader.
[0060] Clone formation assay
[0061] Add 3 × 10 2Colorectal cancer cells were cultured for approximately 14 days, with the culture medium replaced every 3 days. The culture medium was then discarded from the wells, and the cells were washed 2-3 times with PBS. The cells were fixed with 4% paraformaldehyde for 10-15 minutes, then stained with 0.1% crystal violet for 10 minutes. Excess crystal violet was removed by aspiration, and the cells were rinsed with running water. Clusters of 50 or more cells were counted as one clone. The number of cell clones in the different treatment groups was calculated and statistically analyzed.
[0062] Transwell experiment
[0063] Take 250 μL of 2×10 5 A resuspended colorectal cancer cell suspension (in FBS-free medium) was added to the upper chamber of a Transwell chamber, and medium containing 10% FBS was added to the lower chamber. After incubation at 37°C for 1-2 days, the medium in the upper chamber was aspirated and the cells were washed twice with PBS. The cells were fixed with 4% paraformaldehyde for 10-15 minutes, then stained with 0.1% crystal violet for 10 minutes. Excess violet was aspirated and the cells were rinsed with running water. The number of cells that passed through the membrane below the upper chamber was observed under a light microscope and counted for statistical analysis.
[0064] Nude mouse tumor formation assay
[0065] Short hairpin RNA (shRNA) of sh-circMGMT and its negative control (sh-NC) were packaged into lentiviral vectors (GenePharma Co). SW620 cells infected with sh-circMGMT or sh-NC were injected subcutaneously in the right groin. 6 All mice were sacrificed after 28 days, and tumor nodes were dissected from each mouse to assess tumor weight.
[0066] sh-circMGMT-1:5'-CCGAGCTTGCTGGAAAACGGG-3'
[0067] sh-circMGMT-2: 5'-CCCGTTTTCCAGCAAGCTCGG-3'.
[0068] Control shRNA: 5′-TTCTCCGAACGUGUCACGT-3′.
[0069] The nucleic acid sequence of circMGMT is as follows:
[0070] CTCGGCCCCGCCCCCGCGCCCCGGATATGCTGGGACAGCCCGCGCCCCTAGAACGCTT
[0071] TGCGTCCCGACGCCCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGGTACTTGGA
[0072] AAAATGGACAAGGATTGTGAAATGAAACGCACCACACTGGACAGCCCTTTGGGGAAG
[0073] CTGGAGCTGTCTGGTTGTGAGCAGGGTCTGCACGAAATAAAGCTCCTGGGCAAGGGG
[0074] ACGTCTGCAGCTGATGCCGTGGAGGTCCCAGCCCCCGCTGCGGTTCTCGGAGGTCCGG
[0075] AGCCCCTGATGCAGTGCACAGCCTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATC
[0076] GAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTCCAGCAAG。
Claims
1. Use of a preparation for reducing the expression level of circMGMT in tumor cells in the preparation of a drug for treating colorectal cancer, wherein the circMGMT sequence is shown in SEQ ID NO: 1; The preparation for reducing the expression level of circMGMT gene in tumor cells comprises: at least one of siRNA of circMGMT gene and shRNA of circMGMT gene; The siRNA sequence is: si-circMGMT-1:5'- CCCGUUUUCCAGCAAGCUCGG-3' si-circMGMT-2: 5'-CCGAGCUUGCUGGAAAACGGG-3'; The sequence of the shRNA is: sh-circMGMT-1: 5'- CCGAGCTTGCTGGAAAACGGG-3'; sh-circMGMT-2: 5'- CCCGTTTTCCAGCAAGCTCGG-3'.
2. A drug for treating colorectal cancer, characterized in that: The invention also includes a preparation for reducing the expression level of circMGMT in tumor cells, wherein the circMGMT sequence is shown in SEQ ID NO: 1; The preparation for reducing the expression level of circMGMT gene in tumor cells comprises: at least one of siRNA of circMGMT gene and shRNA of circMGMT gene; The siRNA sequence is: si-circMGMT-1:5'- CCCGUUUUCCAGCAAGCUCGG-3' si-circMGMT-2: 5'-CCGAGCUUGCUGGAAAACGGG-3'; The sequence of the shRNA is: sh-circMGMT-1: 5'- CCGAGCTTGCTGGAAAACGGG-3'; sh-circMGMT-2: 5'- CCCGTTTTCCAGCAAGCTCGG-3'.
3. The drug according to claim 2, characterized in that shRNA is prepared using a lentiviral vector.
4. Use of a reagent for detecting circMGMT expression in the preparation of a colorectal cancer detection preparation, wherein the circMGMT sequence is shown in SEQ ID NO: 1.
Citation Information
Patent Citations
Colorectal cancer targeted therapy drug
CN112877433A
Application of circRNA-FOXK2 gene as target in preparation or screening of breast cancer treatment drugs
CN117398466A