Application of maize gene ZmEREB202 in controlling maize yield

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a maize gene ZmEREB202 in controlling maize yield, wherein the protein coded by the gene is shown as SEQ ID NO. 2. The gene is located on the 2nd chromosome of maize, and controls the ear length, the number of grains per row and the number of grains per ear of maize. By using the CRISPR / Cas9 technology to knock out the gene and inhibit the gene expression, the ear length and the number of grains per row of maize inbred lines under normal environment can be increased.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the application of the maize gene ZmEREB202 in controlling maize yield. The gene of this invention is located on the second chromosome of maize and controls important yield traits such as ear length and / or number of kernels per row. Background Technology

[0002] Maize yield is a complex quantitative trait controlled by multiple genes. Ear length, number of kernels per row, number of rows per ear, ear weight, and cob weight are important components of maize yield. Analyzing maize yield traits by breaking them down into different yield factors helps to elucidate the genetic basis of yield trait formation, enabling breeders to more effectively utilize genetic resources to design breeding strategies and achieve high-efficiency breeding. At a specific planting density, maize yield per unit area is determined by the kernel yield per ear and the number of ears; the kernel yield per ear is determined by the number of kernels per ear and the weight of 100 kernels; the number of kernels per ear is determined by the number of rows per ear and the number of kernels per row; ear length and ear diameter are significantly correlated with the number of kernels per row and the number of rows per ear, respectively. Referring to yield and related trait data of 32 different maize varieties published in Argentina from 1965 to 2016, a consistent maximum possible planting density was maintained in the experimental design, with three replicates in a randomized block design. The results showed that over the past 50 years of breeding, maize yield has increased at an average rate of 113 kg / ha / year. This increase in yield was positively correlated with the increase in the number of kernels per ear, but unrelated to changes in individual kernel weight. Ear biomass accumulation increased year by year, while the tasseling and silking interval shortened, and flowering time became more consistent. However, kernel formation efficiency remained unchanged. The gradual trends of all traits were as expected, indicating that the increase in the number of kernels per ear is a key reason for the year-on-year increase in yield. Understanding the genetic basis of ear length and row kernel number is crucial for comprehending the mechanism of maize yield formation and provides a theoretical basis for breeding practices.

[0003] Therefore, this study used genetic methods to isolate a gene, ZmEREB202, located on chromosome 2 of maize, which controls ear length and kernel number per row. This gene encodes an APETALA2 / ETHYLENE RESPONSE FACTOR (AP2 / ERF) transcription factor involved in ethylene signaling. Based on the genetic phenotype and related molecular biological analysis of transgenic materials, the biological function of this gene in controlling traits such as ear length, kernel number per row, and kernel number per ear was confirmed. Genetic transformation studies of ZmEREB202 can provide genetic resources and theoretical support for maize breeding. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the maize gene ZmEREB202 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO.2.

[0005] To achieve the above objectives, the present invention adopts the following technical measures:

[0006] Application of the maize gene ZmEREB202 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO.2;

[0007] The applications described above, specifically:

[0008] Application of reducing the expression of the maize gene ZmEREB202 in increasing maize yield;

[0009] Application of knocking out, suppressing or silencing the expression of the maize gene ZmEREB202 in improving maize yield;

[0010] In the above applications, preferably, the knockout is performed using the CRISPR / Cas9 system. The protein translated from the knocked-out gene has no original function, which can achieve the effect of increasing maize yield.

[0011] Preferably, the target site of the gRNA in the CRISPR / Cas9 system is GTTCGAGCGCGGCCTCGGAG AGG.

[0012] Application of increasing the expression level of the maize gene ZmEREB202 in reducing maize yield;

[0013] The above-described application involves introducing substances that enhance the expression of the ZmEREB202 gene in maize into maize.

[0014] In the above-described applications, preferably, the substance is a nucleic acid molecule containing the ZmEREB202 gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0015] The ZmEREB202 gene is shown in SEQ ID NO.1.

[0016] In the above-described applications, the control of corn yield is achieved by controlling ear length and / or the number of kernels per row.

[0017] Compared with the prior art, the present invention has the following advantages:

[0018] This invention cloned and confirmed the gene ZmEREB202, which controls ear length and kernel number per row, in maize. The relationship between ear length, kernel number per row, and the expression level of ZmEREB202 was demonstrated; reducing its expression level increased ear length and kernel number per row. The difference in kernel number per ear between transgenic and wild-type materials is attributed to a decrease in the protein level encoded by this gene due to editing of its coding region. Mechanistically, this gene is believed to participate in the ethylene signaling response in plants, increasing the ethylene response and thereby regulating the expression of downstream genes, ultimately controlling the differentiation activity of maize inflorescence meristems and affecting yield traits such as ear length and kernel number per row. Therefore, this invention provides a new genetic resource for maize yield improvement. Attached Figure Description

[0019] Figure 1 A schematic diagram of maize ZmEREB202 gene knockout material;

[0020] Where: A is a schematic diagram of the editing of the maize ZmEREB202 gene, in which ereb202-cr1 loses CG bases and ereb202-cr2 inserts G bases. These insertions and deletions of bases both lead to premature termination of protein translation.

[0021] B is a phenotypic diagram of maize ZmEREB202 gene knockout material, from left to right: wild-type family (WT) obtained from transgenic heterozygous plant, two ZmEREB202 gene-edited families ereb202-cr1 and ereb202-cr2;

[0022] C is a schematic diagram of the ear length of the maize ZmEREB202 gene knockout material. The bars from left to right are the wild-type family (WT), the two ZmEREB202 gene-edited families ereb202-cr1 and ereb202-cr2.

[0023] D is a schematic diagram of the number of rows and grains in the maize ZmEREB202 gene knockout material. The bars from left to right are the wild-type family (control), and the two ZmEREB202 gene-edited families ereb202-cr1 and ereb202-cr2.

[0024] Figure 2 A schematic diagram of the expression pattern of the maize ZmEREB202 gene;

[0025] Among them: A: ZmEREB202 is highly expressed in maize meristems; B: In situ hybridization results show that ZmEREB202 is specifically expressed in IM (inflorescence meristem), SPM (spikelet pair meristem), and SM (spikelet meristem) of 2mm young spikelets. Detailed Implementation

[0026] The following embodiments further define the present invention. Based on the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from its spirit and scope, so as to make it suitable for various uses and conditions. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all derived from commercial channels or publicly disclosed materials.

[0027] Example 1: ZmEREB202 Cloning

[0028] Total DNA was extracted from leaves of inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesisstreamlin es trait gene identification in maize. The Plant Cell, 2020, 32: 1397–1413). Primers 202-F and 202-R were designed based on the genome reference sequence of maize B73 (National Crop Germplasm Center). The ZmEREB202 gene was amplified by PCR and resequencing in KN5585 material, and the complete nucleotide sequence of the ZmEREB202 gene was obtained (SEQ ID NO.1). The protein encoded by this gene is shown in SEQ ID NO.2.

[0029] Total DNA was extracted from plant leaves using the CTAB method. The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, followed by 34 cycles of denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 60 s, and finally extension at 72℃ for 5 min.

[0030] Table 1. Primers and their sequences used in this invention

[0031]

[0032] Example 2: Genetic transformation of ZmEREB202 in maize

[0033] The genetic transformation to knock out the ZmEREB202 gene involved using ZmEREB202 from the transgenic recipient material KN5585 as the applied gene, with the sequence shown in SEQ ID NO.1. The transformation was performed using the CRISPR-P website (…). http: / / cbi.hzau.edu.cn / crisper / Gene target design was performed to obtain Guide RNA (Target: GTTCGAGCGCGGCCTCGGAGAGG). The ZmU6-Target-sgRNA fragment (SEQ ID NO.3) was synthesized using gene synthesis and constructed into the commercial pEASY-T1 vector.

[0034] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, primer ID 2). The CPB-ZmUbi-hspCas9 vector was linearized by HindIII digestion, and the fragments were recovered by electrophoresis gel extraction and detected. Guide RNA was ligated into the target vector CPB-ZmUbi-hspCas9 (CN113004383A) via homologous recombination. Finally, the clone was sequenced using CRI SPR vector detection primers (primer sequences are shown in Table 1, primer ID 3) to confirm that the target fragment had been ligated into the vector.

[0035] The correctly cloned plasmid was transformed into the maize inbred line KN5585 via Agrobacterium-mediated transformation (genetic transformation was performed by the Life Science and Technology Center of China Seed Group Co., Ltd.). Using specific ZmEREB202 gene detection primers (primer sequences are shown in Table 1, primer ID 4), two maize transformation events with KN5585 as the background were screened and obtained. Figure 1 (A) ereb202-cr1 and ereb202-cr2, where ereb202-cr1 lacks a CG base and ereb202-cr2 has an inserted G base. Both these insertions and deletions lead to premature termination of protein translation. Figure 1 (A). Furthermore, in 2023, the phenotypic values ​​of ear length and kernel number per row in maize from ZmER EB202 gene knockout families were investigated in Gansu. Figure 1 The results showed that, compared with WT, the loss of function of the Zm EREB202 gene increased the ear length of maize by 10.5% and 11.7% for ereb202-cr1 and ereb202-cr2, respectively. Figure 1 In the middle (C), the number of rows increased by 19.9% ​​and 14.9% respectively. Figure 1 Based on the above results, it is demonstrated that reducing the expression of the ZmE REB202 gene and decreasing the response of ethylene signal in young ears can increase ear length and number of kernels per row in maize, and the average kernel weight per ear is increased by ~12.3% compared with wild type.

[0036] Example 3: Expression analysis of ZmEREB202

[0037] Based on the maize B73 expression database, expression pattern analysis of the ZmEREB202 gene was performed. The ZmEREB202 gene showed high expression levels in maize meristems (FPKM). Figure 2 (A); Simultaneously, we used RNA in situ hybridization to verify the specific expression pattern of ZmEREB202 in ~2mm young spikelets (A). Figure 2 The primer sequence is shown in Table 1 (primer ID5). This gene is mainly highly expressed in the early IM, SPM and SM of maize young ears; therefore, ZmEREB202 affects traits such as ear length and number of kernels per row in maize.

Claims

1. Maize genes ZmEREB202 In the application of controlling ear length and / or kernel number in maize, the gene encodes the protein shown in SEQ ID NO.2, and the application process involves knocking out the maize gene. ZmEREB202 Increase corn ear length and / or number of kernels per row.

2. The application according to claim 1, characterized in that: The knockout was performed using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function.

3. The application according to claim 2, characterized in that: The target site of gRNA in the CRISPR / Cas9 system is GTTCGAGCGCGGCCTCGGAGAGG.

4. The application according to claim 1, characterized in that: The aforementioned ZmEREB202 The gene is shown in SEQ ID NO.1.

Images