A method for constructing a molecular ID card for plum germplasm and its application

Abstract

The present invention discloses a method for constructing a molecular identification card for plum germplasm and its application. The present invention uses 10 pairs of InDel-labeled core primers to effectively distinguish 72 plum germplasms. Bands amplified by the 10 pairs of InDel-labeled core primers, ID1-ID10, are then separated by the numbers 0-9, and sequentially arranged and combined to construct a QR-coded molecular identification card for plum germplasm. This method helps address the resource confusion caused by frequent hybridization and the presence of numerous transitional types among plum germplasms. It can quickly and accurately identify and authenticate specific plum germplasm species, and is of great significance for germplasm conservation, variety selection, and genetic diversity research.

Description

Technical Field

[0001] The invention belongs to the field of plant variety identification, and particularly relates to a method for constructing a molecular identity card for plum germplasm and its application. Background Art

[0002] China is the world's largest producer of plums. Plums have a long history of cultivation in my country, are highly adaptable, and are widely distributed across diverse ecological zones. Through long-term natural and artificial selection, they have accumulated rich genetic variation, forming diverse local plum varieties or types. With the introduction and exchange of plum resources across various regions in recent years, the identity of plum germplasm resources has often been confused to varying degrees, resulting in numerous instances of homonyms and homologous names. This has hindered the preservation, identification, and exchange of these resources, making systematic identification and classification of these resources crucial.

[0003] Currently, a variety of molecular markers have been applied to plum germplasm research, including genetic diversity assessment, kinship identification and germplasm analysis, genetic map construction, and marker-assisted breeding. As a third-generation molecular marker based on whole-genome sequencing, InDel markers offer advantages such as high specificity, excellent stability, simple detection methods, and affordability. They provide a powerful new tool for the classification and identification of plum varieties, enabling rapid, accurate, and economical identification of the genetic characteristics of plum germplasm at the molecular level, independent of environmental factors. Molecular identification technology for plants, a molecular identification technique developed with the development of molecular marker technology, is of great significance for the accurate identification of plant varieties and the protection of variety rights. However, research and application in plum varieties have not yet been reported. Summary of the Invention

[0004] The present invention aims to establish a method for rapidly and accurately identifying and evaluating plum germplasm resources using InDel molecular markers, as well as a plum germplasm-specific molecular ID. The method uses the resource feature analysis software IDanalysis 4.1 to analyze the band patterns amplified by InDel molecular marker primers. The band patterns are then quantified and combined to generate a string representation, creating a molecular ID for the plum germplasm. This approach addresses the existing technical challenges of rapid and effective plum germplasm identification, facilitating the selection and breeding of new plum varieties and the identification of plum germplasm.

[0005] The first object of the present invention is to provide an InDel molecular marker primer set for plum germplasm identification, comprising the following 10 pairs of primers:

[0006] Primer pair of marker ID1: its forward primer is shown as SEQ ID NO.1, and its reverse primer is shown as SEQ ID NO.2;

[0007] Primer pair of marker ID2: its forward primer is shown as SEQ ID NO.3, and its reverse primer is shown as SEQ ID NO.4;

[0008] Primer pair of marker ID3: the forward primer is shown in SEQ ID NO.5, and the reverse primer is shown in SEQ ID NO.6;

[0009] Primer pair of marker ID4: the forward primer is shown in SEQ ID NO.7, and the reverse primer is shown in SEQ ID NO.8;

[0010] Primer pair labeled ID5: the forward primer is shown in SEQ ID NO.9, and the reverse primer is shown in SEQ ID NO.10;

[0011] Primer pair of marker ID6: the forward primer is shown in SEQ ID NO.11, and the reverse primer is shown in SEQ ID NO.12;

[0012] Primer pair of marker ID7: the forward primer is shown in SEQ ID NO. 13, and the reverse primer is shown in SEQ ID NO. 14;

[0013] Primer pair of marker ID8: its forward primer is shown as SEQ ID NO.15, and its reverse primer is shown as SEQ ID NO.16;

[0014] Primer pair of marker ID9: the forward primer is shown in SEQ ID NO. 17, and the reverse primer is shown in SEQ ID NO. 18;

[0015] Primer pair labeled ID10: its forward primer is shown as SEQ ID NO.19, and its reverse primer is shown as SEQ ID NO.20.

[0016] The second object of the present invention is to provide a kit for plum germplasm identification, comprising the InDel molecular marker primer set for plum germplasm identification.

[0017] The third object of the present invention is to provide the use of the InDel molecular marker primer set for plum germplasm identification or the plum germplasm identification kit in plum germplasm identification.

[0018] A fourth object of the present invention is to provide a method for constructing a molecular ID card for plum germplasm, comprising the following steps:

[0019] S1. Extract DNA from plum plants of known germplasm;

[0020] S2. Using the DNA of the plum plant of known germplasm extracted in step S1 as a template, PCR amplification was performed using the InDel molecular marker primer set for plum germplasm identification or the plum germplasm identification kit, and the resulting PCR product was detected by agarose gel electrophoresis;

[0021] S3. The band pattern of the PCR product obtained by each pair of primers is digitally encoded, and then the band pattern encoding numbers of the PCR product amplified by each pair of primers are sequentially combined to construct a molecular ID card of the known plum germplasm;

[0022] The band patterns of the obtained PCR products are coded with numbers, where numbers from 1 to 9 represent different band patterns amplified by the same pair of primers, and 0 represents no band.

[0023] Preferably, the plum germplasm molecular ID card described in step S3 is converted into a plum germplasm molecular ID card in the form of a QR code.

[0024] Preferably, the plum germplasm is from early 1, Yunkai 1, bamboo silk plum, Guancun Sanhua plum, Ruyuan rhubarb plum, Shaoguan 6 wild plum, hard branch plum, white crisp chicken hemp plum, Ruyuan 1, Shangluo Sanhua plum, early bamboo plum, fragrant honey plum, scholar plum, Huami big honey plum, Yaoshan plum, Shaoguan 4 wild plum, early grass plum, beaded plum, March plum, Lingxi plum, big honey plum, Guangxi Dashui plum, rouge plum, corn plum, Lingyun chicken blood plum, Lingyun tung shell plum, Leye yellow shell plum, Leye small planting plum, Leye red bull heart plum, Huadong town blood red plum, Leye yellow skin plum, Leye bull Chicken Heart Plum, Leye Early-maturing Plum, Honey Plum, Honey Plum No. 1, Anshun Local Late-maturing Plum, April Plum, Ice Crisp Plum, Cotton Plum, Ziyun Local Red Plum, Crisp Red Plum, Yanhe Hollow Plum, Yellow Wax Plum, May Crisp, Jiang'an Plum, Tongliang Dragon Plum, Crooked-mouthed Plum, Yunnan Yellow Plum, Wufeng Hanlin Hollow Plum, Oil-headed Green, Ligustrum lucidum, Peach-shaped Plum, Jintang Plum, Hibiscus Plum, Younai, Goose Yellow Plum, Shandong Early Red, Jade Emperor Plum, Xinjiang Yellow Plum, Shangxian Plum, Purple-leaf Plum, Dahongpao, Late Golden Jade, Songxiang Peach Plum, Longyuan Honey Plum, Autumn Sweet Plum, Wei Di, Australian Cherry Plum, French Plum.

[0025] Preferably, the PCR amplification system is: 5 μL of 2×Flash PCR MasterMix (Dye), 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer, 20-60 ng of DNA template, and ddH2O to 10 μL; the amplification program is: pre-denaturation at 98°C for 2 minutes; 34 cycles of 94°C for 10 seconds, 55°C for 15 seconds, and 72°C for 10 seconds; and finally, extension at 72°C for 2 minutes.

[0026] A fifth object of the present invention is to provide a method for identifying plum germplasm, comprising the following steps:

[0027] S1. Extract DNA from the plum plant to be identified;

[0028] S2. Using the DNA of the plum plant to be identified extracted in step S1 as a template, PCR amplification was performed using the InDel molecular marker primer set for plum germplasm identification or the plum germplasm identification kit, and the resulting PCR product was detected by agarose gel electrophoresis;

[0029] S3. The band pattern of the PCR product obtained is digitally encoded. The band pattern encoding numbers of the PCR product amplified by each pair of primers are sequentially combined to obtain a digital coding combination of the band pattern of the plum germplasm to be identified;

[0030] S4. The stripe-type digital coding combination of the plum germplasm to be identified in step S3 is compared with the stripe-type digital coding combination of the known plum germplasm constructed in the same manner to determine the plum germplasm to be tested;

[0031] The band patterns of the obtained PCR products are coded with numbers, where numbers from 1 to 9 represent different band patterns amplified by the same pair of primers, and 0 represents no band.

[0032] Preferably, the plum germplasm is from early 1, Yunkai 1, bamboo silk plum, Guancun Sanhua plum, Ruyuan rhubarb plum, Shaoguan 6 wild plum, hard branch plum, white crisp chicken hemp plum, Ruyuan 1, Shangluo Sanhua plum, early bamboo plum, fragrant honey plum, scholar plum, Huami big honey plum, Yaoshan plum, Shaoguan 4 wild plum, early grass plum, beaded plum, March plum, Lingxi plum, big honey plum, Guangxi Dashui plum, rouge plum, corn plum, Lingyun chicken blood plum, Lingyun tung shell plum, Leye yellow shell plum, Leye small planting plum, Leye red bull heart plum, Huadong town blood red plum, Leye yellow skin plum, Leye bull Chicken Heart Plum, Leye Early-maturing Plum, Honey Plum, Honey Plum No. 1, Anshun Local Late-maturing Plum, April Plum, Ice Crisp Plum, Cotton Plum, Ziyun Local Red Plum, Crisp Red Plum, Yanhe Hollow Plum, Yellow Wax Plum, May Crisp, Jiang'an Plum, Tongliang Dragon Plum, Crooked-mouthed Plum, Yunnan Yellow Plum, Wufeng Hanlin Hollow Plum, Oil-headed Green, Ligustrum lucidum, Peach-shaped Plum, Jintang Plum, Hibiscus Plum, Younai, Goose Yellow Plum, Shandong Early Red, Jade Emperor Plum, Xinjiang Yellow Plum, Shangxian Plum, Purple-leaf Plum, Dahongpao, Late Golden Jade, Songxiang Peach Plum, Longyuan Honey Plum, Autumn Sweet Plum, Wei Di, Australian Cherry Plum, French Plum.

[0033] Preferably, the PCR amplification system is: 5 μL of 2×Flash PCR MasterMix (Dye), 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer, 20-60 ng of DNA template, and ddH2O to 10 μL; the amplification program is: pre-denaturation at 98°C for 2 minutes; 34 cycles of 94°C for 10 seconds, 55°C for 15 seconds, and 72°C for 10 seconds; and finally, extension at 72°C for 2 minutes.

[0034] Compared with the prior art, the present invention has the following advantages:

[0035] The present invention provides 10 pairs of representative InDel core primers, which serve as the basis for constructing a QR-coded molecular ID card for plum germplasm. The resulting QR-coded molecular ID card effectively distinguishes different plum germplasm accessions, particularly those with similar botanical traits. The QR-coded molecular ID card can be directly read via an information terminal, facilitating the scientific and standardized management of plum germplasm. Furthermore, the digitally constructed molecular ID card is more intuitive than complex base sequences, facilitating rapid identification and differentiation of different plum germplasm accessions.

[0036] This invention helps address the resource confusion caused by frequent inter-plasm hybridization and the presence of numerous transitional types. It can quickly and accurately identify and authenticate specific plum germplasm species, which is of great significance for germplasm conservation, variety selection, and genetic diversity research. This invention constructs a molecular identification card for plum germplasm materials based on indel markers, providing a simple and easily statistically robust method for distinguishing plum germplasms or varieties. It also provides a reference for plum germplasm resource management and the protection of new varieties. It has urgent practical needs and important implications for identifying and organizing plum germplasm resources, standardizing plum production and sales markets, and promoting the healthy and stable development of the plum industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a statistical diagram of polymorphic banding data.

[0038] Figure 2 This is a schematic diagram of using ID Analysis software.

[0039] Figure 3 This is a screenshot of the IGV software showing the regions of significantly different fragments in the resequencing plum germplasm materials.

[0040] Figure 4 This is the PCR amplification result of some plum germplasm materials using primer pair ID9-F / ID9-R.

[0041] Figure 5 This is an example diagram of the banding pattern encoding of the primer pair ID1-F / ID1-R. DETAILED DESCRIPTION

[0042] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0043] The InDel primers described in this study were first used to extract DNA from leaves of four plum germplasm accessions: two South China plum cultivars with distinct flesh color, 'Huami Damili' and 'Congzao No. 1,' and two Southwest China plum cultivars with distinct peel color, 'Fengtangli' and 'Wuyuecui,' respectively. Sequencing data were then aligned with the March plum reference genome (https: / / www.rosaceae.org / Analysis / 9450778), yielding 5,759 InDel sites with insertions / deletions greater than 50 bases and a sequencing depth greater than 10. Sequencing data were then further screened using IGV visualization software, selecting regions with significant differences and fragment sizes between 50 and 1,000 bp for primer design. This resulted in the initial identification of 53 InDel markers. Finally, the 53 pairs of InDel marker primers were used to perform PCR amplification on plum germplasm materials from various regions. Based on the readability and polymorphism of the amplified products in gel electrophoresis, 10 InDel markers with high polymorphism and stable amplification were finally screened using the resource feature analysis software ID analysis 4.1.

[0044] In the present invention, 10 pairs of InDel-labeled core primers are used to distinguish all 72 plum resources collected from different regions across the country.

[0045] Example 1

[0046] 1. Experimental Materials

[0047] All primers used were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; 2× Flash PCR MasterMix (Dye) from Kangwei Century was used as the PCR reagent, and the primer buffer was synthesized by Beijing Qingke Biotechnology Co., Ltd. A total of 72 plum germplasm accessions were collected from different regions in China; their information is shown in Table 1.

[0048] Table 1 Information on plum germplasm materials

[0049]

[0050]

[0051] 2. InDel site analysis and primer design and screening

[0052] Four plum germplasm accessions were selected: two South China plum cultivars with distinct flesh color, 'Huami Damili' and 'Congzao No. 1,' and two Southwest China plum cultivars with distinct peel color, 'Fengtangli' and 'Wuyuecui.' Leaf DNA was extracted and, after passing quality control, submitted to Beijing Novogene Technology Co., Ltd. for resequencing analysis. The raw data was quality-assessed using FastQC and aligned to the March plum reference genome (https: / / www.rosaceae.org / Analysis / 9450778) using the alignment tool BWA. Samtools was used to compare, sort, and index the results. Indel sites were detected and filtered using the HaplotypeCaller module in the variant detection tool GATK. The VariantFiltration tool in GATK can filter variant sites based on specified filtering criteria to remove low-quality or potential false positives. Low-quality sites were filtered out based on sequencing quality scores (such as Phred quality scores) and coverage depth was also filtered out. Sites with insertions / deletions greater than 50 bases and a sequencing depth greater than 10 were selected. False-positive sites were also filtered out based on the frequency of mutant alleles at indel sites and the structural features surrounding the indel sites (such as sequence context and repetitive sequences). If the mutant allele frequency of an indel site is very low, it may indicate a false-positive site. Indel sites were annotated using the tool Annovar. A total of 5759 sites with insertions / deletions greater than 50 bases and a sequencing depth greater than 10 were selected.

[0053] Based on the resequencing data, the InDel sites with insertion / deletion numbers greater than 50 and sequencing depth greater than 10 were identified and screened. The genome visualization software IGV (Integrative Genomics Viewer) was then used to further check and screen, and the segments with obvious differences in the four materials and fragment sizes between 50 bp and 1000 bp were selected (such as Figure 3 As shown in the figure, the sequence of about 1 kb upstream and downstream of the differential region was extracted, and primers were designed using Primer Premier 5 software. Primers with polymorphism (i.e., single band with obvious size difference) were selected (as shown in the figure). Figure 4 For example, Figure 4 The bands amplified by primer pair ID9-F / ID9-R were used for subsequent experiments and analysis. A total of 53 pairs of InDel-labeled primers were screened and PCR amplified on 72 plum germplasm materials.

[0054] 3. Extraction of genomic DNA from plum leaves

[0055] Newly sprouted leaves of plum trees were collected and genomic DNA was extracted using a modified CTAB method. The required reagents were as follows: 2% (w / v) CTAB extraction solution, 1 mol / L Tris-HCl (pH 8.0), 0.5 mol / L EDTA (pH 8.0), 4 mol / L NaCl, and β-mercaptoethanol. The steps for extracting genomic DNA from leaves using the CTAB method are as follows:

[0056] ① Take 0.3 g of young leaves, grind them in a ceramic mortar with liquid nitrogen, and transfer them to a 2 mL centrifuge tube. Preheat the 2% (W / V) CTAB extract at 65°C.

[0057] ② Add 800 μL of 2% (W / V) CTAB extraction solution (add 1.5 μL of β-mercaptoethanol to every 1 mL of 2% (W / V) CTAB), shake and mix well, incubate in a 55°C water bath for 30 min, and shake upside down every 10 min.

[0058] ③ Pre-cool on ice for 10 minutes, add an equal volume (800 μL) of a mixture of chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1), gently invert and mix 50-100 times, and centrifuge at 12000 rpm at 4°C for 10 minutes.

[0059] ④ Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, and mix thoroughly by inversion until a flocculent precipitate appears. Place on ice for 10 minutes, and centrifuge at 12,000 rpm for 10 minutes at 4°C.

[0060] ⑤ Remove the supernatant and let the flocculent precipitate at the bottom of the centrifuge tube. Gently rinse the precipitate once with a 70% ethanol aqueous solution, carefully pour off the supernatant, centrifuge briefly, discard the residual liquid, and dry at 37℃ with the lid open for 10 minutes.

[0061] ⑥ Add 50 μL ddH2O to the tube (add 1 μL RNase for every 10 μL ddH2O), gently pipette to dissolve the precipitate, and keep the fully dissolved DNA solution at 37°C for 30 minutes.

[0062] ⑦ Detect DNA concentration using a spectrophotometer and DNA quality using agarose gel electrophoresis, and store at -20℃ for later use.

[0063] 4. PCR amplification and agarose gel electrophoresis

[0064] PCR amplification of DNA from 72 plum accessions was performed using the 53 selected polymorphic InDel primer pairs. The PCR amplification system consisted of 5 μL of 2× Flash PCR MasterMix (Dye), 0.4 μL of a 10 μM upstream primer, 0.4 μL of a 10 μM downstream primer, 1 μL of DNA template (approximately 20-60 ng), and ddH₂O to a total volume of 10 μL. The PCR amplification procedure included a preliminary denaturation at 98°C for 2 min, followed by 34 cycles of 94°C for 10 s, 55°C for 15 s, and 72°C for 10 s, followed by a final extension at 72°C for 2 min. The resulting PCR products were analyzed by electrophoresis on a 1.5% (w / v) agarose gel, and the corresponding electrophoretic bands were identified.

[0065] 5. Data processing

[0066] The polymorphic bands amplified by 53 pairs of InDel marker primers were coded with Arabic numerals 19 according to the band type, and no band was recorded as 0 for statistics. Figure 1 Take this as an example to illustrate.

[0067] Line 1: "Number of samples / Number of primers" space "Name of the first primer" space "Name of the second primer" ...

[0068] Lines 2 to n: "Sample Name 1 to n-1" Space: Banding pattern code of the first primer Space: Banding pattern code of the second primer...

[0069] Open the resource feature analysis software ID Analysis 4.1, select Full Library Build from the menu bar tab, and a window ( Figure 2 ), click File to open the saved txt document. In the window, enter the number of resource types to be identified and the number of primers to select. (Note: The txt document already contains the information, so you don't need to fill it in.) Use the default values ​​for the percentage of missing primers and the primer similarity threshold. Select the zero allele in the eigenvalues ​​and the ChenRC correlation coefficient in the primer correlation coefficients. Click ID Analysis to run. The software then automatically removes unqualified primers or primers with excessively high similarity coefficients, deriving the minimum InDel marker core primers required to distinguish the 72 accessions and the banding code arranged according to the specific primers. This is used to construct a specific molecular ID for the plum germplasm resources. Use an online QR code generator (http: / / qrcode.cnaidc.com / index.htm) to convert the digital code of the plum molecular ID into a QR code.

[0070] The band patterns of the bands amplified by 53 pairs of InDel-labeled primers were counted. When coding the band patterns, no band was represented by 0, and the bands produced were represented by 1-9. Figure 5 For example, Figure 5The bands were obtained by PCR amplification using the primer pair ID1-F / ID1-R. The pair ID1-F / ID1-R produced double bands at positions 490 bp and 659 bp, coded as 1; a single band at only the 490 bp position was coded as 2; and a single band at only the 659 bp position was coded as 3. Specific band codes were incremented by a number depending on the situation (i.e., each new band pattern was represented by an additional digit; for example, a fourth band pattern was represented by the number 4), so that each primer pair corresponded to a single digit on the molecular ID card. Results were generated using ID Analysis 4.1, yielding the minimum primer combination and molecular ID code required to distinguish 72 samples.

[0071] Using the resource feature analysis software ID Analysis 4.1, we screened out at least 10 InDel markers that could distinguish the 72 samples. These 10 InDel markers are located on different chromosomes. Using the March Plum genome as a reference, their specific locations are shown below:

[0072] Marker ID1 is located on chromosome 2 at bp 20,504,667;

[0073] Marker ID2 is located on chromosome 6 at bp 3392066;

[0074] Marker ID3 is located on chromosome 2 at bp 12500445;

[0075] Marker ID4 is located on chromosome 1 at bp 49,049,772;

[0076] Marker ID5 is located on chromosome 3 at bp 1698465;

[0077] Marker ID6 is located on chromosome 4 at bp 7678285;

[0078] Marker ID7 is located on chromosome 2 at bp 31757195;

[0079] Marker ID8 is located on chromosome 1 at bp 50387422;

[0080] Marker ID9 is located on chromosome 3 at bp 29355454;

[0081] Marker ID10 is located at 8337435bp on chromosome 7.

[0082] Table 2 InDel marker core primer sequences

[0083] Primer name Primer sequence (5'-3') Sequence number ID1-F TGGAGGTTTGTAGTGAAG SEQ ID NO.1 ID1-R ATGGCAAGAAGTCCTATC SEQ ID NO.2 ID2-F AAACTGACTCGGAAAGGT SEQ ID NO.3 ID2-R TGCCATTGGTTCCCTACT SEQ ID NO.4 ID3-F CAGGAGTAGGCTCAAGAT SEQ ID NO.5 ID3-R TTATGATGGATGGGTATG SEQ ID NO.6 ID4-F ATCCCGTCAAACTCACTA SEQ ID NO.7 ID4-R TGGATTGAACCCATACAC SEQ ID NO.8 ID5-F CACCCACTAAGAGACG SEQ ID NO.9 ID5-R CCTTTGCGGAACACTTTA SEQ ID NO.10 ID6-F AGCCTGGTTGATTGTTGG SEQ ID NO.11 ID6-R CAAACGCACTACGCAAAC SEQ ID NO.12 ID7-F GAGGCTCAATCGTAGACA SEQ ID NO.13 ID7-R GATTCACGTTTGGGTTGT SEQ ID NO.14 ID8-F CCACTTGGTCAAGGTTAAATGTC SEQ ID NO.15 ID8-R GCAAATTGTAAGGGGTATGGTG SEQ ID NO.16 ID9-F GCACGCACCCTTTCTTTTCT SEQ ID NO.17 ID9-R CAGGGGCTTAGACAACCATCA SEQ ID NO.18 ID10-F CGGAAGAGGAGATGGTGGAA SEQ ID NO.19 ID10-R GAGACTCTCACAGAGGCATTTCA SEQ ID NO.20

[0084] PCR amplification was performed using 10 pairs of InDel-labeled core primers (Table 2). The 10 InDel markers (in the order ID1, ID2, ID3, ID4, ID5, ID6, ID7, ID8, ID9, and ID10) were combined to distinguish all the materials.

[0085] The specific coding rules for the bands amplified by different labeled core primers are as follows:

[0086] ID1: Primers that produce double bands at positions 490 bp and 659 bp are coded as 1 (i.e., band pattern 1), primers that produce only a single band at position 490 bp are coded as 2 (i.e., band pattern 2), and primers that produce only a single band at position 659 bp are coded as 3 (i.e., band pattern 3);

[0087] ID2: The primer that produces three bands at positions 362 bp, 450 bp, and 528 bp is coded as 1, the primer that produces only a single band at position 362 bp is coded as 2, the primer that produces only two bands at positions 362 bp and 528 bp is coded as 3, and the primer that produces only a single band at position 528 bp is coded as 4;

[0088] ID3: The code for the primer producing double bands only at positions 397 bp and 455 bp is 1, the code for the primer producing double bands only at positions 455 bp and 513 bp is 2, the code for the primer producing single band only at position 455 bp is 3, the code for the primer producing single band only at position 397 bp is 4, the code for the primer producing double bands only at positions 397 bp and 513 bp is 5, and the code for the primer producing single band only at position 513 bp is 6;

[0089] ID4: The primer that produces double bands only at positions 250 bp and 370 bp is coded as 1, the primer that produces a single band only at position 250 bp is coded as 2, and the primer that produces a single band only at position 370 bp is coded as 3;

[0090] ID5: The code for the primer producing double bands only at positions 254 bp and 326 bp is 1, the code for the primer producing single band only at position 254 bp is 2, and the code for the primer producing single band only at position 326 bp is 3;

[0091] ID6: The primer that produces double bands only at positions 516 bp and 690 bp is coded as 1, the primer that produces a single band only at position 516 bp is coded as 2, the primer that produces a single band only at position 690 bp is coded as 3, the primer that produces three bands at positions 516 bp, 690 bp, and 740 bp is coded as 4, and the primer that produces a single band only at position 603 bp is coded as 5;

[0092] ID7: The primer producing two bands at 482 bp and 567 bp was coded as 1, the primer producing only a single band at 482 bp was coded as 2, and the primer producing only a single band at 567 bp was coded as 3;

[0093] ID8: The primer that produces double bands at positions 90 bp and 155 bp is coded as 1, the primer that produces a single band at position 155 bp is coded as 2, and the primer that produces a single band at position 90 bp is coded as 3;

[0094] ID9: The primer that produces a single band at position 176 bp only is coded as 1, the primer that produces double bands at positions 176 bp and 237 bp is coded as 2, and the primer that produces a single band at position 237 bp only is coded as 3;

[0095] ID10: The primer that produces a single band only at the 183bp position is coded as 1, the primer that produces double bands only at the 112bp and 183bp positions is coded as 2, the primer that produces four bands at the 112bp, 183bp, 520bp and 753bp positions is coded as 3, the primer that produces a single band only at the 276bp position is coded as 4, the primer that produces double bands only at the 183bp and 520bp positions is coded as 5, and the primer that produces a single band only at the 112bp position is coded as 6.

[0096] According to the above encoding rules, the banding patterns of the 10 InDel markers from 72 plum accessions were encoded and combined sequentially to obtain the molecular IDs shown in Table 3. As shown in Table 3, the DNA molecular ID for 'Congzao 1' is 3231221223, indicating the following amplification patterns: band 3 when amplified with primers ID1-F / ID1-R, band 2 when amplified with primers ID2-F / ID2-R, and so on until the last primer. Similarly, the DNA molecular ID for 'Yunkai 1' is 1122111111, indicating band 1 when amplified with primers ID1-F / ID1-R, band 1 when amplified with primers ID2-F / ID2-R, and so on until the last primer.

[0097] Table 3 Molecular ID of plum germplasm materials

[0098] name Molecular ID card name Molecular ID card name Molecular ID card From the morning 1 3231221223 Guangxi Dashui Plum 3141313121 Tongliang Longli 1242152211 Yunkai No. 1 1122111111 Rouge Plum 1242122211 Crooked Mouth Li 3241122222 Bamboo Plum 1131113113 Corn Plum 1442221112 Yunnan yellow plum 1121121311 Guancun Sanhua Plum 3333121132 Lingyun Chicken Blood Plum 1252111221 Wufeng Hanlin Hollow Plum 1242153132 Ruyuan rhubarb plum 1221113136 Lingyun Tongke Plum 1341311122 Oily green 1242123132 Shaoguan No. 6 Wild Plum 1331111331 Leye yellow shell plum 1123111134 Li 1351113221 Hard-branched plum 3333222122 Leye small planting plum 1441151322 Peach-shaped plum 1121113111 Crispy Chicken with Plum Blossoms 1231213232 Leye Red Bull Heart Plum 1322123122 Jintang Plum 3222313332 Ruyuan No. 1 1333211231 Blood-red plums from Huadong Town 1323121134 Hibiscus plum 1261111122 Crispy Chicken with Plum 1131111221 Leye Huangpi Plum 1343321225 Yaunai 1132211221 Shangluo Sanhua Li 1222111111 Leye Beef and Chicken Heart Plum 1341321232 Goose Yellow Plum 1442153331 Early Bamboo Plum 3231121112 Leye Early-maturing Plum 1251111212 Shandong Early Red 1351112131 Fragrant honey plum 1133122231 Honey Plum 1111111111 Jade Emperor Plum 1122242131 Xue Lao Li 3333221112 Honey Plum No. 1 2242222211 Xinjiang yellow plum 1141111231 Huami Big Honey Plum 1131111135 Anshun local late-ripening plum 1212222211 Shangxian plum 2452121231 Yaoshan Plum 2331111135 April Lee 1212232212 Purple-leaf plum 3221323131 Shaoguan No. 4 Wild Plum 3232213232 Ice Crisp Plum 2212222211 Dahongpao 1132251231 Early Heli 1331111135 Cotton Plum 1321113131 Late Gold Jade 1321112131 Beaded Plum 2321112111 Ziyun local red plum 1122123122 Songxiang Taoli 1323113132 Lianma March Plum 3221221223 Crisp Red Plum 1122121222 Longyuan Honey Plum 1321122231 March Li Shisheng 3121113113 Yanhe hollow plum 1201311232 Autumn sweet plum 1321111131 Lingxi Li Shisheng 1221111133 Yellow wax plum 1122111121 Wei Di 1222213321 Ruyuan Lingxi Plum 1121111133 May Crisp 3432113231 Australian cherry plum 1152111231 Big Honey Plum 1323321111 Jiang An Li 1121111114 French Lee 3223323131

[0099] The obtained plum molecular ID card (Table 3) was used to generate a QR code using an online QR code generator. The resulting QR code can be used to obtain the banding pattern amplified by the 10 pairs of InDel core primers for the plum germplasm and the digital code corresponding to the banding pattern.

Claims

1. An InDel molecular marker primer set for plum germplasm identification, characterized in that: Includes the following 10 primer pairs: Primer pair of marker ID1: its forward primer is shown as SEQ ID NO.1, and its reverse primer is shown as SEQ ID NO.2; Primer pair of marker ID2: its forward primer is shown as SEQ ID NO.3, and its reverse primer is shown as SEQ ID NO.4; Primer pair of marker ID3: the forward primer is shown in SEQ ID NO.5, and the reverse primer is shown in SEQ ID NO.6; Primer pair of marker ID4: the forward primer is shown in SEQ ID NO.7, and the reverse primer is shown in SEQ ID NO.8; Primer pair labeled ID5: the forward primer is shown in SEQ ID NO.9, and the reverse primer is shown in SEQ ID NO.10; Primer pair of marker ID6: the forward primer is shown in SEQ ID NO.11, and the reverse primer is shown in SEQ ID NO.12; Primer pair of marker ID7: the forward primer is shown in SEQ ID NO. 13, and the reverse primer is shown in SEQ ID NO. 14; Primer pair of marker ID8: its forward primer is shown as SEQ ID NO.15, and its reverse primer is shown as SEQ ID NO.16; Primer pair of marker ID9: the forward primer is shown in SEQ ID NO. 17, and the reverse primer is shown in SEQ ID NO. 18; Primer pair labeled ID10: its forward primer is shown as SEQ ID NO.19, and its reverse primer is shown as SEQ ID NO.

20.

2. A kit for plum germplasm identification, characterized in that: Contains the InDel molecular marker primer set for plum germplasm identification according to claim 1.

3. Use of the InDel molecular marker primer set for plum germplasm identification according to claim 1 or the kit for plum germplasm identification according to claim 2 in plum germplasm identification.

4. A method for constructing a molecular identity card for plum germplasm, characterized in that: The following steps are involved: S1. Extract DNA from plum plants of known germplasm; S2. Using the DNA of the plum plant of known germplasm extracted in step S1 as a template, PCR amplification is performed using the InDel molecular marker primer set for plum germplasm identification according to claim 1 or the plum germplasm identification kit according to claim 2, and the resulting PCR product is detected by agarose gel electrophoresis; S3. The band pattern of the PCR product obtained by each pair of primers is digitally encoded, and then the band pattern encoding numbers of the PCR product amplified by each pair of primers are sequentially combined to construct a molecular ID card of the known plum germplasm; The band patterns of the obtained PCR products are coded with numbers, where numbers from 1 to 9 represent different band patterns amplified by the same pair of primers, and 0 represents no band.

5. The method for constructing a molecular ID card of plum germplasm according to claim 4, characterized in that: The plum germplasm molecular ID card described in step S3 is converted into a plum germplasm molecular ID card in the form of a QR code.

6. The method for constructing a molecular ID card of plum germplasm according to claim 4, characterized in that: The plum germplasm is from early 1, Yunkai 1, bamboo silk plum, Guancun Sanhua plum, Ruyuan rhubarb plum, Shaoguan 6 wild plum, hard branch plum, white crisp chicken hemp plum, Ruyuan 1, Shangluo Sanhua plum, early bamboo plum, fragrant honey plum, Xue Lao plum, Hua Mi big honey plum, Yaoshan plum, Shaoguan 4 wild plum, early grass plum, beaded plum, March plum, Lingxi plum, big honey plum, Guangxi Dashui plum, rouge plum, corn plum, Lingyun chicken blood plum, Lingyun tung shell plum, Leye yellow shell plum, Leye small planting plum, Leye red bull heart plum, Huadong town blood red plum, Leye yellow skin plum, Leye bull chicken Heart plum, Leye early-maturing plum, honey plum, honey plum No. 1, Anshun local late-maturing plum, April plum, ice crisp plum, cotton plum, Ziyun local red plum, crisp red plum, Yanhe hollow plum, yellow wax plum, May crisp, Jiang'an plum, Tongliang dragon plum, crooked-mouthed plum, Yunnan yellow plum, Wufeng Hanlin hollow plum, oil-headed green, plum, peach-shaped plum, Jintang plum, Hibiscus plum, Younai, goose yellow plum, Shandong early red, Yuhuang plum, Xinjiang yellow plum, Shangxian plum, purple-leaf plum, Dahongpao, late golden jade, Songxiang peach plum, Longyuan honey plum, autumn sweet plum, Weidi, Australian cherry plum, French plum.

7. The method for constructing a molecular ID card of plum germplasm according to claim 4, characterized in that: The PCR amplification system is as follows: 5 μL of 2×Flash PCR MasterMix (Dye), 0.4 μL of a 10 μM upstream primer, 0.4 μL of a 10 μM downstream primer, 20-60 ng of a DNA template, and ddH2O added to 10 μL; the amplification program is as follows: pre-denaturation at 98°C for 2 minutes; 34 cycles of 94°C for 10 seconds, 55°C for 15 seconds, and 72°C for 10 seconds; and finally, extension at 72°C for 2 minutes.

8. A method for identifying plum germplasm, characterized in that: The following steps are involved: S1. Extract DNA from the plum plant to be identified; S2. Using the DNA of the plum plant to be identified extracted in step S1 as a template, PCR amplification is performed using the InDel molecular marker primer set for plum germplasm identification according to claim 1 or the plum germplasm identification kit according to claim 2, and the resulting PCR product is detected by agarose gel electrophoresis; S3. The band pattern of the PCR product obtained is digitally encoded. The band pattern encoding numbers of the PCR product amplified by each pair of primers are sequentially combined to obtain a digital coding combination of the band pattern of the plum germplasm to be identified; S4. The stripe pattern digital coding combination of the plum germplasm to be identified in step S3 is compared with the stripe pattern digital coding combination of the known plum germplasm constructed in the same manner to determine the plum germplasm to be tested; The band patterns of the obtained PCR products are coded with numbers, where numbers from 1 to 9 represent different band patterns amplified by the same pair of primers, and 0 represents no band.

9. The method for identifying plum germplasm according to claim 8, characterized in that: The plum germplasm is from early 1, Yunkai 1, bamboo silk plum, Guancun Sanhua plum, Ruyuan rhubarb plum, Shaoguan 6 wild plum, hard branch plum, white crisp chicken hemp plum, Ruyuan 1, Shangluo Sanhua plum, early bamboo plum, fragrant honey plum, Xue Lao plum, Hua Mi big honey plum, Yaoshan plum, Shaoguan 4 wild plum, early grass plum, beaded plum, March plum, Lingxi plum, big honey plum, Guangxi Dashui plum, rouge plum, corn plum, Lingyun chicken blood plum, Lingyun tung shell plum, Leye yellow shell plum, Leye small planting plum, Leye red bull heart plum, Huadong town blood red plum, Leye yellow skin plum, Leye bull chicken Heart plum, Leye early-maturing plum, honey plum, honey plum No. 1, Anshun local late-maturing plum, April plum, ice crisp plum, cotton plum, Ziyun local red plum, crisp red plum, Yanhe hollow plum, yellow wax plum, May crisp, Jiang'an plum, Tongliang dragon plum, crooked-mouthed plum, Yunnan yellow plum, Wufeng Hanlin hollow plum, oil-headed green, plum, peach-shaped plum, Jintang plum, Hibiscus plum, Younai, goose yellow plum, Shandong early red, Yuhuang plum, Xinjiang yellow plum, Shangxian plum, purple-leaf plum, Dahongpao, late golden jade, Songxiang peach plum, Longyuan honey plum, autumn sweet plum, Weidi, Australian cherry plum, French plum.

10. The method for identifying plum germplasm according to claim 8, characterized in that: The PCR amplification system is as follows: 5 μL of 2×Flash PCR MasterMix (Dye), 0.4 μL of a 10 μM upstream primer, 0.4 μL of a 10 μM downstream primer, 20-60 ng of a DNA template, and ddH2O added to 10 μL; the amplification program is as follows: pre-denaturation at 98°C for 2 minutes; 34 cycles of 94°C for 10 seconds, 55°C for 15 seconds, and 72°C for 10 seconds; and finally, extension at 72°C for 2 minutes.

Images