A tekt5 gene non-expressing xenotransplant donor pig and a preparation method thereof

By knocking out the TEKT5 gene using CRISPR-Cas9 gene editing technology, the problem of immune rejection in xenotransplantation has been solved, enabling long-term survival of donor pig organs and tissues in humans and improving the success rate of xenotransplantation.

CN118415139BActive Publication Date: 2026-01-30CHONGQING JITANG BIOTECHNOLOGY RES INST CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310844013.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-11
Publication Date
2026-01-30
Estimated Expiration
2043-07-11

AI Technical Summary

Technical Problem

Severe immune rejection occurs in xenotransplantation, especially when miniature pig organs are transplanted into humans, where unknown immune rejection risk factors exist, affecting the long-term survival of the pig's tissues or organs after implantation.

Method used

By knocking out the TEKT5 gene using CRISPR-Cas9 gene editing technology, the TEKT5 gene is not expressed in the organs, tissues, or cells of donor pigs. This reduces its ability to bind to human recipient IgG and IgM, enhances resistance to human complement-mediated cytotoxicity, and prolongs survival time after xenotransplantation.

Benefits of technology

It effectively reduces the binding capacity of donor tissue and organ cells to human recipient IgG and IgM, enhances resistance to human complement-mediated cytotoxicity, prolongs survival time after xenotransplantation, increases the survival rate of xenogeneic cells, and improves the feasibility of xenotransplantation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118415139B_ABST
    Figure CN118415139B_ABST
Patent Text Reader

Abstract

This invention provides a xenotransplant donor pig that does not express the TEKT5 gene and its preparation method. The TEKT5 gene can cause the risk of xenogeneic immune rejection. The invention also utilizes the CRISPR / Cas9 system to knock out the TEKT5 gene, verifying that the lack of TEKT5 gene expression can effectively reduce the binding ability of donor pig organs, tissues and / or cells to recipient IgG and IgM, improve the ability of donor pig organs, tissues and / or cells to resist recipient complement-mediated cytotoxicity, and prolong the recipient survival time of donor pig organs, tissues and / or pig cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of animal genetic engineering, specifically involving a type of... TEKT5 Xenotransplant donor pigs that do not express genes and their preparation methods. Background Technology

[0002] Organ transplantation is an effective treatment for patients with end-organ failure and is widely used in clinical practice; however, it is limited by the shortage of human organ donors. Xenotransplantation, which uses organs from other species to completely replace living organs, can fundamentally solve the organ supply problem once activated, and has become one of the most anticipated solutions. Numerous studies have confirmed that, in xenogeneic organ-derived animal models, miniature pig organs are morphologically and genetically similar to human organs. In particular, the Yucatan and Göttingen miniature pigs are the most widely used experimental animal models, from which many research results have been derived. However, current research indicates that transplanting miniature pig organs into humans results in a much more severe immune rejection reaction than autologous or allogeneic transplantation. This is because many unknown risk factors that induce immune rejection affect the long-term survival of the pig's tissue or organ after implantation, including the allologous genes that cause rejection.

[0003] Currently regarding TEKT5 The genetic research is as follows: TEKT5 Knockout led to G1 arrest and apoptosis in ovarian cancer cells, as well as a decrease in acetylated α-tubulin levels, followed by β-III-tubulin cleavage and upregulation of HDAC6 in α-tubulin deacetylation. Tubulin dissociation caused SMAD3 to translocate to the nucleus, resulting in SMAD3 nuclear accumulation. These results collectively indicate... TEKT5 It negatively regulates the expression of HDAC6, thereby maintaining the cell cycle by stabilizing tubulin. TEKT5 By controlling the stability of tubulin, the growth and survival of cancer cells can be promoted. TEKT5 In addition to being expressed in normal adult testicular tissue, it has been detected in several cancers, including colon cancer, stomach cancer, liver cancer, lung cancer, and prostate cancer. Summary of the Invention

[0004] This invention has found that TEKT5 Genes can cause the risk of xenoimmune rejection. TEKT5 The absence of gene expression can effectively reduce the binding capacity of donor pig tissues and / or organ cells to recipient IgG and IgM, enhance the ability of donor tissues and / or organ cells to resist recipient complement-mediated cytotoxicity, and prolong the survival time of donor pig tissues and / or organs after xenotransplantation. Based on the above, this invention provides a xenotransplantation donor pig, wherein the organs, tissues, or cells of the donor pig... TEKT5 The gene is not expressed, and the recipient is a person.

[0005] The present invention TEKT5 Gene non-expression can be achieved through gene knockout, gene knock-in, point mutation, deletion mutation, and combinations thereof.

[0006] The present invention TEKT5 Genes can be suppressed through gene silencing.

[0007] The gene knockout described in this invention is achieved using a CRISPR-Cas9 gene knockout system, the system comprising: TEKT5 The gene knockout vector includes vector one and vector two. Vector one is linked to sgRNA1, and the specific target sequence of sgRNA1 is GGCTGATGGGTGACTCCATG. Vector two is linked to sgRNA2, and the specific target sequence of sgRNA2 is GGAGCTGAACTGTCCATTGC.

[0008] The present invention TEKT5 Methods for constructing gene knockout vectors:

[0009] The nucleotide sequence of the encoding gene of the synthesized sgRNA1 is shown in SEQ ID NO.1, and its complementary strand is shown in SEQ ID NO.2. The DNA sequence of the single-stranded sgRNA is then annealed to form an sgRNA1 oligonucleotide chain. The oligonucleotide is then ligated into the PX330 plasmid vector.

[0010] The nucleotide sequence of the gene encoding sgRNA2 is shown in SEQ ID NO.3, and its complementary strand is shown in SEQ ID NO.4. The DNA sequence of the single-stranded sgRNA is then annealed to form an sgRNA2 oligonucleotide chain. The oligonucleotide is then ligated into the PX330 plasmid vector.

[0011] The present invention TEKT5 A gene knockout vector is introduced into transformed cells, which are used to prepare donor pigs for xenotransplantation. The organs, tissues, or cells of the donor pigs... TEKT5 The gene is not expressed.

[0012] The present invention also provides a method for preparing xenotransplantation donors, comprising transplanting the transformed cells into enucleated oocytes to form nuclear transfer oocytes, and then transplanting the nuclear transfer oocytes into the oviducts of surrogate pigs.

[0013] This invention also provides a method for delaying, reducing, or preventing rejection, separation, or adverse reactions to xenotransplanted organs or tissues in human recipients, the method comprising the use of tissues or organs from donor pigs. TEKT5Genetic modification is performed on donor pigs or their tissues and organs to alter their genetic makeup. TEKT5 The gene is not expressed.

[0014] The organs of the xenotransplant donors described in this invention include liver, lung, kidney, or skin.

[0015] The tissues of the xenotransplant donor described in this invention include nerves.

[0016] The beneficial effects are as follows:

[0017] This invention is the first discovery TEKT5 Genes can cause the risk of xenotransplantation immune rejection. Based on this, a xenotransplantation donor pig is provided, which achieves xenotransplantation donor status through gene knockout or gene silencing. TEKT5 Gene not expressed, TEKT5 Gene non-expression can effectively reduce the binding capacity of donor tissues and / or organ cells to human recipient IgG and IgM, enhance the ability of donor tissues and / or organ cells to resist complement-mediated cytotoxicity in human recipients, and prolong the survival time of donor tissues and / or organs after xenotransplantation.

[0018] This invention also utilizes the CRISPR / Cas9 system to design dual sgRNA knockout. TEKT5 Gene knockout cell lines obtained can be used as donors for somatic cell nuclear transfer. TEKT5 Knockout effectively reduced the binding capacity of porcine kidney cells to human IgG and IgM, enhanced the ability of porcine kidney cells to resist human complement-mediated cytotoxicity, and facilitated deep tissue exploration. TEKT5 Gene biology functions provide valuable research tools.

[0019] Risk factors determined by this invention TEKT5 Gene knockout increases the chances of xenogeneic cell survival, further improving the feasibility of xenotransplantation. Attached Figure Description

[0020] Figure 1 To knock out TEKT5 Diagram illustrating the identification of positive clones of the gene;

[0021] Figure 2 wild pig kidney cells and TEKT5 Image showing cell survival of knockout porcine kidney cells after incubation with human serum;

[0022] Figure 3 wild pig kidney cells and TEKT5 A graph showing the binding ability of knockout porcine kidney cells to human IgG and IgM. Detailed Implementation

[0023] The present invention is further illustrated by the following embodiments, which are not intended to limit the invention in any way. Any modifications or alterations made to the present invention that are easily implemented by those skilled in the art without departing from the technical solutions of the present invention shall fall within the scope of the claims of the present invention.

[0024] Example 1, Construction TEKT5 Gene knockout vector.

[0025] porcine kidney cells TEKT5 Gene knockout was achieved using the CRISPR / Cas9 system, and the sgRNAs used included sgRNA1 and sgRNA2. The DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 2; the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 4.

[0026] For pigs TEKT5 The sgRNA sequence of the gene (NCBI accession number: 100620428) was synthesized as follows: the DNA sequences of the four single-stranded sgRNAs were annealed to form two targeted pig DNA sequences. TEKT5 Oligonucleotide chains of sgRNAs at different gene sites were obtained; then, these oligonucleotides were ligated into the PX330 plasmid vector to obtain... FNDC1 Gene knockout vector.

[0027] sgRNA-F1 sequence: 5-CACCGGCTGATGGGTGACTCCATG -3; SEQ ID NO: 1

[0028] sgRNA-R1 sequence: 5-AAACCATGGAGTCACCCATCAGCC -3; SEQ ID NO: 2

[0029] sgRNA-F2 sequence: 5-CACCGGAGCTGAACTGTCCATTGC-3; SEQ ID NO: 3

[0030] sgRNA-R2 sequence: 5-AAACGCAATGGACAGTTCAGCTCC-3. SEQ ID NO: 4

[0031] Example 2, Preparation TEKT5 Gene knockout porcine kidney cells.

[0032] After sequencing verification of the constructed sgRNA expression vector pair, the target plasmid was extracted and precipitated with ethanol. The purified sgRNA expression vector at a certain concentration was introduced into porcine kidney cells via electroporation transfection. After 12 hours of culture, the medium was changed. After 72 hours, the genome of each group of cells was extracted, and cell clones were obtained by limiting dilution. Then, PCR reaction was performed using specific primers. The sgRNA cleavage of the cells was evaluated by analyzing the sequencing peak patterns. (See [link to relevant documentation]). Figure 1 Obtain positive homologous and knockout clones.

[0033] Example 3, Detection TEKT5 The resistance of knockout porcine kidney cells to human complement-mediated cytotoxicity.

[0034] wild pig kidney cells and TEKT5 When the confluence of knockout porcine kidney cells reached approximately 70%, human serum was diluted 1:3 with DMEM and incubated for 45 minutes. The supernatant was discarded, and the cells were washed twice with PBS and stained with propidium iodide (PI) staining solution for 10 minutes. Subsequently, cell death was detected by flow cytometry (see [reference needed]). Figure 2 Compared with PK cells, after incubation with 75% serum TEKT5 Gene knockout cells can significantly reduce the toxicity of human serum to pig cells.

[0035] Example 4, Detection TEKT5 The binding capacity of knockout porcine kidney cells to human IgG and IgM.

[0036] Pancreatic enzymes digest wild pig kidney cells and TEKT5 Knockout porcine kidney cells were transferred to 1.5 mL centrifuge tubes and washed twice with PBS. Human serum, inactivated at 56°C for 1 hour, was diluted 1:4 with PBS and incubated at room temperature. After 30 minutes, the cells were washed twice with PBS, and a 1:200 dilution of fluorescently labeled human IgG or IgM antibody was added. The cells were incubated at room temperature for 30 minutes. After washing with PBS, flow cytometry was performed. TEKT5 For the binding affinity of knockout porcine kidney cells to human IgG and IgM, see [reference needed]. Figure 3 Compared to PK cells, TEKT5 Knockout porcine kidney cells showed significantly reduced binding to human IgG or IgM.

[0037] As can be seen from the above embodiments: knockout TEKT5 Genetic modification can effectively reduce the binding capacity of porcine kidney cells to human IgG and IgM, and enhance the ability of porcine kidney cells to resist human complement-mediated cytotoxicity.

[0038] The present invention has also verified through embodiments. TEKT5The gene knockout experiments on pig lung cells and pig liver cells yielded the same conclusions as those on pig kidney cells regarding their resistance to human complement-mediated cytotoxicity and their ability to bind to human IgG and IgM.

[0039] The present invention has also verified through embodiments. TEKT5 The resistance of gene-silenced porcine kidney cells to human complement-mediated cytotoxicity and their binding ability to human IgG and IgM yielded the same experimental results as those obtained with gene knockout methods.

[0040] This invention also provides a method for preparing transgenic pigs for xenotransplantation, which yields transgenic pigs. TEKT5 Gene knockout pig kidney, lung, or liver cells are transplanted into enucleated oocytes to form nuclear transfer eggs, which are then transplanted into the oviducts of surrogate pigs. Transgenic piglets for xenotransplantation are then born from pregnant sows. These piglets serve as donor animals for interspecies organ and cell transplantation.

[0041] Therefore, the transgenic cloned pig of this invention can be used as a donor animal for interspecies organ and cell transplantation.

[0042] The vector of the present invention may contain primer sequences, for example, it may contain a CAG promoter. Furthermore, it may utilize promoters that are typically considered equivalent to the CAG promoter, such as the EF1α promoter, which are capable of expression in mammals. Additionally, it may use mammalian tissue-specific promoters such as the ICAM2 promoter, with the CAG promoter as one type of gene expression promoter, for expressing foreign genes.

[0043] In this invention, "transgenic" refers to the process of introducing DNA into a host and enabling the DNA to replicate as an extrachromosomal factor or through chromosomal integration. Transgenic includes any method of introducing nucleic acid molecules into an organism, cell, tissue, or organ, and can be carried out using appropriate standard techniques known in the relevant field, depending on the host cell, such as electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol, DEAE-dextran, cationic liposomes, and lithium acetate-dimethyl sulfoxide, but is not limited to these. To distinguish between transformation of eukaryotic cells using plasmid or non-plasmid naked DNA and transformation as a form of cell tumorigenesis, the term "transfection" is also used, and both have the same meaning in this invention.

[0044] The present invention provides a method for preparing transgenic pigs for xenotransplantation and transgenic cloned pigs for xenotransplantation produced by the above method, including the steps of transplanting the above-mentioned transformed cells into enucleated oocytes to form nuclear transfer oocytes; and the steps of transplanting the above-mentioned nuclear transfer oocytes into the oviducts of surrogate pigs.

[0045] In this invention, "nuclear transplantation" refers to a gene manipulation technique that artificially combines the nuclear DNA of other cells with a cell without a nucleus to form the same traits, and can use methods known in the technical field to which this invention pertains.

[0046] In this invention, "nuclear transplanted egg" refers to an egg cell that has been introduced or fused with donor cells.

[0047] In this invention, "enucleated oocyte" refers to an oocyte whose nucleus has been removed.

[0048] In this invention, the term "organ" refers to a collection of tissues connected by structural units to perform a common function. An organ can be a solid organ. A solid organ is an internal organ with fixed tissue consistency, neither hollow (e.g., gastrointestinal organs) nor liquid (e.g., blood). Examples of solid organs include the heart, kidneys, liver, lungs, pancreas, spleen, and adrenal glands.

[0049] In this invention, the term "tissue" refers to a cellular-organic intermediate between cells and organs. A tissue is a population of similar cells originating from the same source and performing a specific function. Organs are then formed through the functional aggregation of multiple tissues. Examples of tissues considered in this invention include, but are not limited to, connective tissue, muscle tissue, nervous tissue, epithelial tissue, and mineralized tissue. Blood, bone, tendons, ligaments, fat, and cellular tissue are examples of connective tissue, which can be further classified as fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Muscle tissue is divided into three distinct categories: visceral or smooth muscle, present on the inner walls of organs; skeletal muscle, typically attached to bones, producing large-amplitude movements; and cardiac muscle, present in the heart, which contracts to pump blood through the body. Cells containing central and peripheral nerve cells are classified as neural (or neuronal) tissue. In the central nervous system, neural tissue forms the brain and spinal cord. In the peripheral nervous system, neural tissue forms cranial and spinal nerves, including motor neurons.

[0050] In this invention, the terms "transformation" and "transfection" refer to the process of transferring or introducing exogenous nucleic acids into host cells. "Transformed" cells are cells that have been transfected, transformed, or transduced using exogenous nucleic acids. These cells include primary cells of the subject and their progeny.

[0051] The present invention will now be described in detail through embodiments. These embodiments are merely illustrative and the invention is not limited thereto.

Claims

1.A method for preparing a transgenic donor pig for xenotransplantation, comprising: transplanting transformed cells into enucleated oocytes to form a nuclear transfer egg, and transplanting the nuclear transfer egg into the oviduct of a surrogate pig; the transformed cells are introduced with a TEKT5 gene knockout vector, and the transformed cells are used to prepare a donor pig for xenotransplantation, wherein the TEKT5 gene of the donor pig is not expressed; the TEKT5 gene knockout vector comprises vector 1 and vector 2, the vector 1 is connected with sgRNA1, and the specific targeting sequence of the sgRNA1 is GGCTGATGGGTGACTCCATG; the vector 2 is connected with sgRNA2, and the specific targeting sequence of the sgRNA2 is GGAGCTGAACTGTCCATTGC, and the non-expression of the TEKT5 gene is achieved by gene knockout; and the recipient of the organ, tissue or cell of the xenotransplantation donor pig is a human.

Citation Information

Patent Citations

  • Combination cell-based therapies

    CN113164574A

  • RXR-alpha gene knockout cell line with stable and low RXR-alpha protein expression and production method thereof

    US20210222203A1