A method for simultaneously monitoring the efficiency of RNA extraction, reverse transcription, and qPCR

Abstract

The present invention provides a method for monitoring RNA extraction, reverse transcription, qPCR efficiency and data homogenization, which includes RNA extraction, cDNA synthesis and fluorescence quantitative PCR, characterized in that: a DAF external reference gene with a sequence of SEQ ID No.1 is added in the operation of RNA extraction; an EAT external reference gene with a sequence of SEQ ID No.2 is added before cDNA synthesis after RNA extraction; an SKN external reference gene with a sequence of SEQ ID No.3 is added before fluorescence quantitative PCR after cDNA synthesis; the Ct values ​​of the DAF external reference gene, the EAT external reference gene and the SKN external reference gene are determined by fluorescence quantitative PCR; and whether the result is credible is judged based on whether the Ct value increases or not. The method of the present invention can improve the reliability of data, enable researchers to interpret experimental results more accurately, and can be used as an important tool for standardizing experimental data to help eliminate variations caused by experimental operations, sample processing and other non-biological factors.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and medicine, and relates to a method that can be used to monitor RNA extraction, reverse transcription, qPCR process efficiency and subsequent data homogenization, which facilitates the study of various disease-related RNAs and has broad scientific research value and application prospects. Background Art

[0002] Methods for monitoring RNA extraction, reverse transcription, and qPCR efficiency and data normalization are important to ensure the reliability and accuracy of experimental results. Commonly used monitoring methods include assessing RNA quality and purity using the UV absorption ratio method, checking RNA integrity by agarose gel electrophoresis, constructing a standard curve to assess qPCR efficiency, and using internal reference genes such as β-actin or GAPDH for relative quantification. Although these methods are widely used, they are often cumbersome and complex. When problems occur in one or more processes of RNA extraction, reverse transcription, or qPCR, it is difficult to trace the specific problem link from the experimental results alone.

[0003] Therefore, developing a fast and cost-effective method to monitor the efficiency of RNA extraction, reverse transcription and qPCR and to perform data normalization has important scientific research value and application prospects. Such a method will simplify the experimental process, improve the reliability of the data, and enable researchers to interpret the experimental results more accurately. Correct operation and data analysis strategies are essential for the interpretation and reproducibility of experimental results. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for monitoring RNA extraction, reverse transcription, qPCR efficiency and data homogenization. The method can improve the reliability of data and enable researchers to interpret experimental results more accurately.

[0005] In order to solve the above technical problems, the present invention provides a new method, the core technical point of which is to add nematode-derived external reference genes in RNA extraction, reverse transcription and qPCR, respectively. These external reference gene sequences are derived from important housekeeping genes in nematodes:

[0006] DAF: controls aging and lifespan, and is involved in embryonic development and metabolic regulation.

[0007] EAT: related to food intake and energy metabolism, affecting the lifespan of nematodes.

[0008] SKN: Participates in stress response and antioxidant response, affecting lifespan and metabolic regulation.

[0009] Determine whether the experimental results are reliable by monitoring external reference genes.

[0010] Specifically, the present invention relates to a method for monitoring RNA extraction, reverse transcription, qPCR efficiency and data normalization, which includes RNA extraction, cDNA synthesis and fluorescent quantitative PCR, characterized in that:

[0011] In the RNA extraction process, a DAF external reference gene with a sequence of SEQ ID No. 1 was added;

[0012] After RNA extraction and before cDNA synthesis, the EAT external reference gene with the sequence of SEQ ID No. 2 was added;

[0013] After cDNA synthesis and before fluorescence quantitative PCR, the SKN external reference gene with the sequence of SEQ ID No.3 was added;

[0014] The Ct values ​​of the DAF external reference gene, the EAT external reference gene, and the SKN external reference gene were determined by fluorescence quantitative PCR; if the Ct value of the DAF external reference gene increased, it indicated that the RNA extraction efficiency was low; if the Ct value of the EAT external reference gene increased, it indicated that the cDNA synthesis efficiency was low; if the Ct value of the SKN external reference gene increased, it indicated that the fluorescence quantitative PCR efficiency was low; if the Ct values ​​of the DAF external reference gene, the EAT external reference gene, and the SKN external reference gene did not increase, it indicated that the results were credible;

[0015] The sequences of the forward and reverse primers for fluorescent quantitative PCR are as follows:

[0016] DAF fluorescence quantitative PCR forward primer: 5-GTGATCGTGTGAATGTTCG-3 (SEQ ID NO: 4);

[0017] DAF fluorescence quantitative PCR reverse primer: 5-ATTCGCGGAAAACAGGATT-3 (SEQ ID NO: 5);

[0018] EAT fluorescence quantitative PCR forward primer: 5-CGGCTCATCAACAGGAACCA-3 (SEQ ID NO: 6);

[0019] EAT fluorescent quantitative PCR reverse primer: 5-TAAGTTTCAGACCCGCTACGTG-3 (SEQ ID NO: 7);

[0020] SKN fluorescence quantitative PCR forward primer: 5-CAACTTTCCGTAGAAACGAG-3 (SEQ ID NO: 8);

[0021] SKN fluorescent quantitative PCR reverse primer: 5-ACATAATTTCAGTGATTCGTCA-3 (SEQ ID NO: 9).

[0022] In a preferred embodiment of the present invention, the sample used for RNA extraction is a serum or plasma sample.

[0023] In a preferred embodiment of the present invention, the RNA extraction comprises the following steps:

[0024] 1) Pretreatment: Serum or plasma was used as the sample and pretreated with SDS. 250uL of the sample was mixed with an equal volume of 10% sodium dodecyl sulfate solution (SDS) and incubated at 4°C for 1h.

[0025] 2) Mix the pre-treated sample and Trizol reagent in a 1:1 ratio in a centrifuge tube without RNase contamination. After thorough mixing, place at room temperature for 5 minutes to allow the reaction to proceed fully. After five minutes, add 5 μL of the external reference gene DAF at a concentration of 1 fmol / μL;

[0026] 3) Perform chloroform layered extraction: add one-fifth of the volume of chloroform to the sample mixed with Trizol, shake briefly for 15 seconds and let stand for 2 minutes to allow phase separation; then centrifuge at 12,000 times gravity acceleration at 4°C for 15 minutes, and then transfer the upper liquid to a new RNase-free centrifuge tube;

[0027] 4) Add isopropanol in a volume ratio of 2:1 to the upper liquid after layered extraction, mix gently and place at room temperature for 10 minutes; then centrifuge at 12,000 times gravity acceleration at 4°C for 10 minutes, remove the supernatant, and leave the white RNA precipitate. Wash the precipitate with 1 mL of 75% ethanol solution, centrifuge again at 4°C at 12,000 times gravity acceleration for 15 minutes, and discard the supernatant;

[0028] 5) After the RNA precipitate is naturally air-dried, add 15-25 μL of DEPC water to dissolve the precipitate to obtain the purified serum / plasma RNA sample.

[0029] In a preferred embodiment of the present invention, the cDNA synthesis comprises the steps of:

[0030] 1) Add 5 μL of III SuperMix;

[0031] 2) Depending on the concentration of RNA, add 10pg to 5μg of total RNA, add 1μL of the external reference gene EAT with a concentration of 1fmol / μL, dilute to 20μL with RNase-free water, mix well and centrifuge;

[0032] 3) Perform the first-strand cDNA synthesis in a PCR instrument, and set the reaction parameters at 25°C for 5 min, 55°C for 15 min, and 85°C for 5 min.

[0033] In a preferred embodiment of the present invention, the fluorescent quantitative PCR comprises the following steps:

[0034] 1) Add 1 μL of 0.2 fmol / μL external reference gene SKN to cDNA;

[0035] 2) Configuration of fluorescence quantitative PCR reaction system: Use 25 μL Hieff Universal BlueqPCR SYBR Green Master Mix, add 1 μL of Forward Primer and 1 μL of Reverse Primer, both at a concentration of 10 μM. The volume and concentration of template DNA are determined according to experimental requirements. Use ddH2O to dilute the total volume of the mixture to 50 μL.

[0036] 3) Fluorescence quantitative PCR reaction parameter settings: pre-denaturation, 95°C, 2 min; denaturation, 95°C, 10 sec, annealing / extension, 60°C, 30 sec; denaturation, annealing and extension for 40 cycles in total; melting curve stage: follow the instrument setting program.

[0037] The beneficial effects of the present invention are at least as follows: (1) The external reference genes designed by the present invention can be used as quality control indicators to help confirm whether the RNA extraction and reverse transcription steps are successful and whether the efficiency is consistent. If the expression level of the external reference gene remains relatively stable between different samples, this indicates that the extraction and reverse transcription steps have good repeatability and reliability. (2) In qPCR, the external reference gene can be used to monitor the reaction efficiency. By comparing the amplification curve of the external reference gene with the amplification curve of the target gene, it is possible to evaluate whether the PCR reaction has achieved the expected efficiency, which is crucial for quantitative analysis. (3) The external reference genes designed by the present invention provide a stable baseline for correcting for variations between samples, such as differences in RNA concentration, changes in efficiency during reverse transcription or PCR. This allows for more accurate comparison of the relative expression levels of the target gene in different samples. (4) The external reference genes of the present invention can be used as an important tool for standardizing experimental data, helping to eliminate variations caused by experimental operations, sample processing and other non-biological factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is the data result analysis process of the design method of the present invention;

[0039] Figure 2This is the result of fluorescence quantitative PCR of different concentrations of external reference gene (EAT); from left to right: 10pmol / μL, 10fmol / μL, 1fmol / μL.

[0040] Figure 3 Specificity evaluation of qPCR amplification products (external reference gene DAF);

[0041] Figure 4 Specificity evaluation of qPCR amplification products (external reference gene EAT);

[0042] Figure 5 Specificity evaluation of qPCR amplification products (external reference gene SKN). DETAILED DESCRIPTION

[0043] In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be purchased through commercial channels.

[0045] Embodiment 1:

[0046] The samples used in the following examples are all isolated clinical serum samples.

[0047] The experimental reagents are all commonly used molecular biology reagents, mainly including: Trizol reagent, chloroform, isopropanol, ethanol and other conventional biochemical reagents, all purchased from Shanghai Bioengineering Company. Ⅲ1st strand cDNA synthesis reverse transcription premix, real-time quantitative PCR amplification premix (Hieff Universal Blue qPCR SYBR Green Master Mix), proteinase K, and sodium dodecyl sulfate (SDS) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0048] 1. RNA Extraction

[0049] 1) Preprocessing stage:

[0050] ① Take a serum or plasma sample, mix 250uL of the sample with the same volume of 10% sodium dodecyl sulfate solution (SDS), and incubate at 4°C for 1 hour.

[0051] ② Mix the pretreated sample with Trizol reagent in a 1:1 ratio in a centrifuge tube without RNase contamination, place at room temperature for 5 minutes, and then add 5 μL of the external reference gene DAF (concentration of 1 fmol / μL).

[0052] External reference gene DAF sequence:

[0053] 5-CAGGUAGCCGGUGAUCGUGUGAAUGUUCGCAAAUAUAUCCUUCAACUCGGACGCCAUUCCCGAAUCCUGUUUUC CGCGAAUCUCGAUCGUCAGAUUUCCGAAAAAAAAAAAAAAAAAAAAA-3 (SEQ ID NO: 1)

[0054] 2) Chloroform layered extraction:

[0055] ① Add one-fifth volume of chloroform to the sample mixed with Trizol, shake briefly for 15 seconds and let stand for 2 minutes to allow phase separation.

[0056] ② Centrifuge at 12,000 times gravity for 15 minutes at 4°C and transfer the upper layer of liquid to a new RNase-free centrifuge tube.

[0057] 3) Isopropanol precipitation:

[0058] ① Add isopropanol (volume ratio 2:1) to the upper layer of liquid after layer extraction and leave it at room temperature for 10 minutes.

[0059] ② Centrifuge at 12,000 times gravity for 10 minutes at 4°C, remove the supernatant, and leave the white RNA precipitate.

[0060] ③ Wash the precipitate with 1 mL of 75% ethanol solution, centrifuge again at 12,000 x g for 15 min at 4°C, and discard the supernatant.

[0061] 4) RNA dissolution: After the RNA precipitate is naturally air-dried, add 15-25 μL of DEPC water to dissolve the precipitate to obtain the purified serum / plasma RNA sample.

[0062] 2. cDNA Synthesis

[0063] 1) Join III SuperMix (5 μL).

[0064] 2) Depending on the RNA concentration, add 10pg to 5μg of total RNA, add 1μL of the external reference gene EAT (concentration is 1fmol / μL), dilute to 20μL volume with RNase-free water, mix well and centrifuge.

[0065] External reference gene EAT sequence: 5-CUCUUCUCGCCGCGGUCUGCAGAAUGUGUGCUCCGGGCGGCUCAUCAACAGGAACCAUGGAAGCCAUUCAAGGAAC ACGUAGCGGGUCUGAAACUUAUUAAAAAAAAAAAAAAAAAAAAA-3 (SEQ ID NO: 2)

[0066] 3) Perform the first-strand cDNA synthesis in a PCR instrument, and set the reaction parameters at 25°C for 5 min, 55°C for 15 min, and 85°C for 5 min.

[0067] 3. Fluorescence quantitative PCR

[0068] 1) Add the external reference gene SKN (1 μL, concentration 0.2 fmol / μL) into the cDNA.

[0069] External reference gene SKN sequence:

[0070] 5-TGGTAGCGTGATCCACTGGATGAGCCAACTTTCCGTAGAAACGAGACTCGTGAGTTCCGGTTGAGCTCTCTGA CGTGTATCGTGGAGATTCCGAAGAGAGGCGAGAGCACGTTGATGACGAATCACTGAAATTATGTAATTATTGAACT-3 (SEQ ID NO: 3)

[0071] 2) Fluorescence quantitative PCR reaction system configuration:

[0072] ① Use 25 μL of Hieff Universal Blue qPCR SYBR Green Master Mix.

[0073] ②Add 1μL of Forward Primer and 1μL of Reverse Primer, both at a concentration of 10μM.

[0074] ③ Determine the volume and concentration of template DNA according to experimental requirements, and dilute the total volume of the mixture to 50 μL using ddH2O.

[0075] 3) Fluorescence quantitative PCR reaction parameter setting:

[0076] ①Pre-denaturation, 95℃, 2min.

[0077] ② Denaturation, 95℃, 10sec; annealing / extension, 60℃, 30sec, cycle 40 times.

[0078] l Melting curve stage: proceed according to the instrument setting program.

[0079] 4) External reference gene primer sequence:

[0080] DAF fluorescence quantitative PCR:

[0081] - Forward primer: 5-GTGATCGTGTGAATGTTCG-3 (SEQ ID NO: 4)

[0082] - Reverse primer: 5-ATTCGCGGAAAACAGGATT-3 (SEQ ID NO: 5)

[0083] EAT fluorescence quantitative PCR:

[0084] - Forward primer: 5-CGGCTCATCAACAGGAACCA-3 (SEQ ID NO: 6)

[0085] - Reverse primer: 5-TAAGTTTCAGACCCGCTACGTG-3 (SEQ ID NO: 7)

[0086] SKN fluorescent quantitative PCR:

[0087] - Forward primer: 5-CAACTTTCCGTAGAAACGAG-3 (SEQ ID NO: 8)

[0088] - Reverse primer: 5-ACATAATTTCAGTGATTCGTCA-3 (SEQ ID NO: 9)

[0089] The data result analysis process of the present invention is as follows Figure 1 As shown, the Ct values ​​of the DAF external reference gene, the EAT external reference gene, and the SKN external reference gene are determined by fluorescent quantitative PCR; if the Ct value of the DAF external reference gene increases, it means that the RNA extraction efficiency is low; if the Ct value of the EAT external reference gene increases, the cDNA synthesis efficiency is low and the number of target nucleic acids is reduced; if the Ct value of the SKN external reference gene increases, it means that the efficiency of fluorescent quantitative PCR is low. Therefore, if the Ct values ​​of the DAF external reference gene, the EAT external reference gene, and the SKN external reference gene do not increase, the results are credible. Conversely, an increase in the Ct value generally indicates that the initial number of target nucleic acids in the sample decreases, and thus more cycles are required to reach the threshold. The reduction in the initial number of target nucleic acids in the sample may be due to low sample concentration, low extraction efficiency, sample degradation, and the like. The experimental results of the embodiments of the present invention are shown in FIG. Figure 2-5 shown. Figure 3-5The melting curve analysis shown can distinguish between specific PCR products and non-specific products (such as primer dimers). Specific products usually show a single, obvious peak on the melting curve, while non-specific products may show multiple peaks at different temperatures. The three experimental result graphs in this experiment are all single peaks, and the peak shape is consistent, indicating that these amplification products have good consistency and specificity in different samples.

[0090] The above describes the preferred embodiments of the present invention, but it is not intended to limit the present invention. Those skilled in the art may make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present invention.

Claims

1. A method for monitoring RNA extraction, reverse transcription, qPCR efficiency and data homogenization, comprising RNA extraction, cDNA synthesis and fluorescent quantitative PCR, characterized in that: In the RNA extraction process, a DAF external reference gene with a sequence of SEQ ID No. 1 was added; After RNA extraction and before cDNA synthesis, the EAT external reference gene with the sequence of SEQ ID No. 2 was added; After cDNA synthesis and before fluorescence quantitative PCR, the SKN external reference gene with the sequence of SEQ ID No.3 was added; The Ct values ​​of the DAF external reference gene, the EAT external reference gene, and the SKN external reference gene were determined by fluorescence quantitative PCR; if the Ct value of the DAF external reference gene increased, it indicated that the RNA extraction efficiency was low; if the Ct value of the EAT external reference gene increased, it indicated that the cDNA synthesis efficiency was low; if the Ct value of the SKN external reference gene increased, it indicated that the fluorescence quantitative PCR efficiency was low; if the Ct values ​​of the DAF external reference gene, the EAT external reference gene, and the SKN external reference gene did not increase, it indicated that the results were credible; The sequences of the forward and reverse primers for fluorescent quantitative PCR are as follows: DAF fluorescence quantitative PCR forward primer: 5-GTGATCGTGTGAATGTTCG-3; DAF fluorescence quantitative PCR reverse primer: 5-ATTCGCGGAAAACAGGATT-3; EAT fluorescence quantitative PCR forward primer: 5-CGGCTCATCAACAGGAACCA-3; EAT fluorescence quantitative PCR reverse primer: 5-TAAGTTTCAGACCCGCTACGTG-3; SKN fluorescence quantitative PCR forward primer: 5-CAACTTTCCGTAGAAACGAG-3; SKN fluorescence quantitative PCR reverse primer: 5-ACATAATTTCAGTGATTCGTCA-3.

2. The method according to claim 1, wherein the sample for RNA extraction is a serum or plasma sample.

3. The method according to claim 1, wherein the RNA extraction comprises the following steps: 1) Pretreatment: Serum or plasma was used as the sample and pretreated with SDS. 250uL of the sample was mixed with an equal volume of 10% sodium dodecyl sulfate solution (SDS) and incubated at 4°C for 1h. 2) Mix the pre-treated sample and Trizol reagent in a 1:1 ratio in a centrifuge tube without RNase contamination. After thorough mixing, place at room temperature for 5 minutes to allow the reaction to proceed fully. After five minutes, add 5 μL of the external reference gene DAF at a concentration of 1 fmol / μL; 3) Perform chloroform layered extraction: add one-fifth of the volume of chloroform to the sample mixed with Trizol, shake briefly for 15 seconds and let stand for 2 minutes to allow phase separation; then centrifuge at 12,000 times gravity acceleration at 4°C for 15 minutes, and then transfer the upper liquid to a new RNase-free centrifuge tube; 4) Add isopropanol in a volume ratio of 2:1 to the upper layer of the liquid after layered extraction, mix gently and place at room temperature for 10 minutes; then centrifuge at 12,000 times gravity acceleration at 4°C for 10 minutes, remove the supernatant, and leave the white RNA precipitate; wash the precipitate with 1 mL of 75% ethanol solution, centrifuge again at 4°C at 12,000 times gravity acceleration for 15 minutes, and discard the supernatant; 5) After the RNA precipitate is naturally air-dried, add 15-25 μL of DEPC water to dissolve the precipitate to obtain the purified serum / plasma RNA sample.

4. The method according to claim 1, wherein the cDNA synthesis comprises the following steps: 1) Add 5 μL of III SuperMix; 2) Depending on the concentration of RNA, add 10pg to 5μg of total RNA, add 1μL of the external reference gene EAT with a concentration of 1fmol / μL, dilute to 20μL with RNase-free water, mix well and centrifuge; 3) Perform the first-strand cDNA synthesis in a PCR instrument, and set the reaction parameters at 25°C for 5 min, 55°C for 15 min, and 85°C for 5 min.

5. The method according to claim 1, wherein the fluorescent quantitative PCR comprises the following steps: 1) Add 1 μL of 0.2 fmol / μL external reference gene SKN to cDNA; 2) Configuration of fluorescence quantitative PCR reaction system: Use 25 μL Hieff Universal Blue qPCRSYBR Green Master Mix, add 1 μL of Forward Primer and 1 μL of Reverse Primer, both at a concentration of 10 μM. The volume and concentration of template DNA are determined according to experimental requirements. Use ddH2O to dilute the total volume of the mixture to 50 μL. 3) Fluorescence quantitative PCR reaction parameter settings: pre-denaturation, 95°C, 2 min; denaturation, 95°C, 10 sec, annealing / extension, 60°C, 30 sec; denaturation, annealing and extension for 40 cycles in total; melting curve stage: follow the instrument setting program.

Images