A protein against soybean cyst nematode and its coding gene and application
The GmC2H2-2like gene was screened by transcriptome analysis and a recombinant vector was constructed to achieve its overexpression in soybean, which solved the problem of soybean cyst nematode disease control and significantly improved soybean resistance.
Patent Information
- Application Number
- CN202410271328.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-11
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-03-11
AI Technical Summary
In the current technology, soybean cyst nematode disease is difficult to control effectively, resulting in severe soybean yield reduction. The genetic basis of disease-resistant varieties is narrow, and there is a lack of effective gene mining methods.
The GmC2H2-2like gene resistant to soybean cyst nematode was screened by transcriptome analysis. The recombinant vector pCAMBIA3300-GmC2H2-2like was constructed and soybeans were transformed using Agrobacterium-mediated transformation to achieve overexpression of the GmC2H2-2like gene and improve soybean resistance to cyst nematode.
It significantly reduced the number of root nematodes in soybeans and improved soybean resistance to cyst nematode disease, demonstrating the important role of the GmC2H2-2like gene in disease resistance.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant disease resistance, and particularly relates to a protein resistant to soybean cyst nematode disease and an encoding gene and application thereof. BACKGROUND
[0002] Soybean cyst nematode (SCN) is a worldwide soybean disease caused by soil-borne parasitic nematodes, which can cause a 30-50% reduction in soybean yield under normal circumstances, and even absolute yield reduction in severe cases. SCN has the characteristics of wide distribution, serious damage, long survival time of its hibernating body (cyst), and numerous physiological races, and is a soil-borne disease that is extremely difficult to control. In the long process of breeding practice, the application of a small number of SCN-resistant germplasm resources has caused the limitation of a narrow genetic basis of disease-resistant variety resources. Many studies have shown that transcriptome analysis based on RNA-seq has become one of the most effective strategies for analyzing the genetic basis of complex trait variation, especially the interaction between plants and pests. In the research of anti-soybean cyst nematode genes, the transcriptome of different soybean resistant and susceptible varieties under nematode stress can be used to screen genes that regulate soybean cyst nematode resistance. For example, HG type 1.2.5.7 (2nd physiological race), HG type 0 (3rd physiological race), HG type 1.2.3.5.7 (4th physiological race) and the like are used for transcriptome sequencing analysis of Harbin small black soybean (resistant to disease), grey skin branch black soybean (resistant to disease), Wuzhai black soybean (resistant to disease), Peking (resistant to disease), Lee (susceptible), Essex (susceptible) and soybean Williams 82 (Glycine max cv. Williams), and the expression fold change (Fold Change) of different groups of differentially expressed genes at the transcription level is obtained, and it is found that the differentially expressed genes are distributed in disease resistance defense, cell structure, signal transduction, cell wall repair, protein degradation pathway and the like. Therefore, the interaction between soybean and SCN is detected by transcriptome analysis, which is an effective way to mine new genes resistant to soybean cyst nematode. SUMMARY
[0003] The application provides a soybean gene resistant to soybean cyst nematode, which solves the technical problem of how soybean resists cyst nematode.
[0004] The technical scheme of the application is as follows:
[0005] A protein resistant to soybean cyst nematode disease, wherein the sequence of the protein is shown as SEQ ID NO. 1.
[0006] The encoding gene of the above-mentioned protein resistant to soybean cyst nematode disease.
[0007] Further, the sequence of the encoding gene is shown as SEQ ID NO. 2.
[0008] A recombinant vector containing the above-mentioned coding gene.
[0009] Further, the starting vector of the recombinant vector is pCAMBIA3300.
[0010] A recombinant microbial cell carrying the above-mentioned gene or expressing the above-mentioned protein.
[0011] A method for preparing a soybean cyst nematode-resistant plant, and the specific steps of the method are as follows:
[0012] Step 1: connecting the gene shown in SEQ ID NO. 2 with the vector pCAMBIA3300 to obtain a recombinant vector;
[0013] Step 2: transforming the recombinant vector of step 1 into Agrobacterium to obtain a recombinant Agrobacterium;
[0014] Step 3: introducing the recombinant Agrobacterium of step 2 into soybean to obtain a transgenic soybean plant, and obtaining a positive transgenic soybean plant after identification.
[0015] A method for improving the resistance of soybean to soybean cyst nematode by infecting a plant overexpressing the gene shown in SEQ ID NO. 3 with soybean cyst nematode.
[0016] The above-mentioned protein resistant to soybean cyst nematode, the above-mentioned gene, the above-mentioned recombinant vector, the above-mentioned recombinant microbial cell or the soybean plant overexpressing the gene shown in SEQ ID NO. 3 are applied in controlling the resistance of soybean to cyst nematode.
[0017] Advantages of the present application
[0018] The average number of transgenic positive root female worms of pCAMBIA3300-GmC2H2-2like is 2.60 per cm, which is lower than that of the control group, and the average number of female worms in the root system of the control group is 5.1 per cm, and there is a very significant difference between the transgenic positive root and the negative control root, which confirms that the GmC2H2-2like gene has a significant effect on improving the resistance of soybean cyst nematode. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 Bioinformatics analysis of GmC2H2-2like gene, wherein A is signal peptide prediction, B is phosphorylation analysis, C is protein transmembrane region analysis, D is protein secondary structure, E is protein hydrophobicity, F is subcellular localization analysis, and G is protein tertiary structure.
[0020] Figure 2 Phylogenetic tree of GmC2H2-2like gene;
[0021] Figure 3 GmC2H2-2like gene encoding protein interaction network;
[0022] Figure 4 GmC2H2-2like gene expression prediction in soybean, where A is gene level transcript abundance profile, B is gene expression matrix, C is gene expression abundance median and mean bar plot;
[0023] Figure 5 GmC2H2-2like gene promoter and gene structure analysis, where A is GmC2H2-2like domain protein conserved domain, B is GmC2H2-2like gene promoter region analysis;
[0024] Figure 6 C2H2 transcription factor and target gene regulatory network expression graph;
[0025] Figure 7 DNA extraction from the root of Dongnong L-10;
[0026] Figure 8 Cloning of GmC2H2-2like gene, where M is DL2000, 1-10 is PCR product;
[0027] Figure 9 Transformation of plant expression vector into DH5α E. coli, where M is DL2000, 1-10 is PCR product;
[0028] Figure 10 GmC2H2-2like protein subcellular localization analysis;
[0029] Figure 11 GmC2H2-2like fluorescent quantitative PCR results, where A is SCN stress treated soybean germplasm Dongnong L-10, B is untreated soybean germplasm Dongnong L-10;
[0030] Figure 12 PCR detection results of GmC2H2-2like gene overexpression plant, where M is DL2000 (+) DNA molecular weight standard, 1 is positive control, 2-4 is transgenic plant;
[0031] Figure 13 Bar test paper strip detection of GmC2H2-2like transgenic positive seedlings overexpression;
[0032] Figure 14Transgenic positive root and empty vector pCAMBIA3300 overexpression root phenotype control, where A is wild type control, B is pCAMBIA3300-GmC2H2-2like transgenic positive seedling. DETAILED DESCRIPTION
[0033] The following examples facilitate a better understanding of the present application, but do not limit the present application. The experimental methods in the following examples are all conventional methods unless otherwise specified. The pharmaceutical reagents used in the following examples are all obtained from conventional biochemical reagent stores unless otherwise specified.
[0034] Plant variety: Dongnong L-10 (disease-resistant), Dongnong 50 (disease-susceptible).
[0035] The disease-resistant soybean variety Dongnong L-10 is described in the article by Wu D P, Zhao Y, Sheng B H, et al. Genetic model analysis of Dongnong L-10 to soybean cyst nematode race 3 [J]. Soybean Science, 2016, 35(3): 6. DOI: 10.11861 / j.issn.1000-9841.2016.03.0367.
[0036] The disease soil variety is soybean cyst nematode HG type 1.2.3.5.7 (race 3), which is described in the article by Wu D P, Zhao Y, Sheng B H, et al. Genetic model analysis of Dongnong L-10 to soybean cyst nematode race 3 [J]. Soybean Science, 2016, 35(3): 6. DOI: 10.11861 / j.issn.1000-9841.2016.03.0367, and is collected from the experimental field of the Soybean Institute of Northeast Agricultural University.
[0037] Example 1
[0038] Bioinformatics analysis of GmC2H2-2like gene and cloning thereof.
[0039] 1) Bioinformatics analysis of the coding sequence of GmC2H2-2like gene, which encodes 410 amino acids, has a molecular weight of 45.77 ku, an isoelectric point PI = 8.73, a chemical formula of C 1979 H 3106 N 580 O 618 S 27 , and a fatty coefficient of 67.12. The number of negatively charged residues (Asp + Glu) is 33, and the number of positively charged residues (Arg + Lys) is 40. The results show that the protein has no signal peptide and is a non-secretory protein Figure 1 A) ; GmC2H2-2like protein has 47 potential phosphorylation sites Figure 1B), in which 8 threonine (Thr), 32 serine (Ser) sites, 7 tyrosine (Tyr); the protein does not exist transmembrane transport Figure 1 C), there is no cell migration phenomenon. Protein secondary structure shows that there are four spatial configurations Figure 1 D), which include alpha-helix (25.61%), random coil (57.32%), extended chain (13.66%) and beta-turn (3.14%) 4 structures, random coil and alpha-helix account for the highest proportion. Hydrophilic and hydrophobic analysis shows that the lowest peak appears at positions 202 and 810 Figure 1 E), which is the most hydrophilic position of the protein; the highest peak appears at position 810, which is the most hydrophobic position of the protein. Subcellular localization prediction results Figure 1 F) shows that 60.9% is distributed in the nucleus, 34.8% is distributed outside the cell (including the cell wall), and 4.3% is distributed in the mitochondria, and the remaining small amount is distributed in the cytoskeleton, the results show that the protein is mainly located in the nucleus. The tertiary structure of the protein is highly consistent with the prediction results of the secondary structure, and the three-dimensional structure of the protein has a high homology of 89.62% with the homologous protein of Arabidopsis thaliana Figure 1 G).
[0040] GmC2H2-2like gene phylogenetic tree analysis shows that: GmC2H2-2like gene exists in a variety of plants Homologous genes. Homologous alignment of soybeans, coffee beans, Arabidopsis and other plants can be divided into three branches, in which the target gene has the highest homology with the soybean GlymaLee.11G156300 gene Figure 2 )。
[0041] String database analysis of GmC2H2-2like gene shows that the encoded protein has multiple interactions, and the number of interaction nodes is 11 Figure 3 ). With red circle (GmC2H2-2like) as the center, there are multiple interaction relationships between proteins. There are 10 proteins that directly interact with GmC2H2-2like protein, in which K7L537_SOYBN contains an ARID domain protein, which is closely related to growth and development and tissue-specific expression. HMG encodes chromatin structure and function and plays an important role in gene expression regulation process, the results show that GmC2H2-2like gene is widely involved in plant growth and development and stress regulation processes.
[0042] The SoybeanExpressionAtlas database encompasses transcripts and gene-level transcript abundance matrices from 5481 publicly available RNA-seq samples. This study analyzed the expression of GmC2H2-2like proteins in soybean, using a color scale of 0-15. Among different parts of Arabidopsis thaliana, the nuclear region showed the highest relative expression level. Figure 4 A) The gene localization results in Arabidopsis thaliana show that it is located on chromosome 5 (4B). The bar graphs of mean and median abundance (4C) indicate that the gene is highly expressed in seeds, roots, and pods, with the highest relative expression in roots. This suggests that it may be involved in the regulation of root growth and development.
[0043] Gene sequences were searched on the phytozomeV2.0 website, and a 2000bp region upstream of the TSS of the GmC2H2-2like gene was selected. Plant CARE analysis of the promoter region showed that ( Figure 5 B, Table 1) shows multiple light-response, hormone-response, abiotic stress, and stress-response-related elements. Among these, the CAAT-box and TATA-box core elements are the most numerous. These elements bind to upstream genes and jointly participate in the regulatory expression of the GmC2H2-2like gene. Elements such as Box 4, Box II, AE-box, GT1-motif, and LAMP-element respond to light signals. Elements such as MYB, MYC, CAT-box, and TATC-box respond to abiotic stress and hormone signals, thereby affecting GmC2H2-2like gene expression. This gene contains multiple disease-related and hormone-response elements; therefore, it can be inferred that this gene is involved in soybean disease resistance.
[0044] In NCBI's Conserved Domains, selecting CD-search and inputting the gene coding sequence revealed that the conserved domain is a zinc finger structure, with two conserved cysteine and histidine residues coordinating the zinc ion. There are four zinc finger binding sites. It belongs to the Zf-C2H2 superfamily. Figure 5 A).
[0045] To investigate the regulatory relationship between C2H2 transcription factors and differentially expressed genes under soybean cyst nematode stress, the binding sites of the upstream 2000 bp sequences of four differentially expressed genes were analyzed and predicted using the PlantTFDB online analysis website. The results showed that the four C2H2 transcription factor family genes (Glyma.11G192400, Glyma.12G179000, Glyma.19G234500, and Glyma.13G321800) regulate 11, 23, 25, and 26 genes, respectively. There is little overlap in the target genes regulated by members of the C2H2 transcription factor family; most genes are regulated by only one member. Figure 6 Further research and analysis of the target genes revealed that many of them function in response to drought stress, salt stress, heavy metal stress, and biotic and abiotic stresses in soybeans.
[0046] 2) Using the soybean cyst nematode resistant variety Dongnong L-10 as material, samples were taken when the first set of trifoliate compound leaves emerged, DNA was extracted, and detected by agarose gel electrophoresis. Figure 7 The DNA banding was clear, and the OD260 / OD280 ratio detected by ultraviolet spectrophotometer was between 1.8, indicating that the DNA had good integrity and high purity.
[0047] 3) Target gene CDS cloning. Using the Phytozome v12.1 database, the soybean Williams 82 (Glycinemax Wm82.a2.v1) gene sequence was retrieved and BLAST aligned to obtain GmC2H2-2-like CDS sequence information. Primers for gene cloning (primer 1) were designed using Primer 5.0 software. PCR was performed using cDNA as a template. The reaction system was as follows: pre-denaturation 98℃, 5 min; denaturation 98℃, 10 sec; annealing 57.8℃, 5 sec; extension temperature: 68℃, 5 sec / kb, for a total of 38 cycles, stored at 4℃. After the reaction, the PCR product was analyzed by agarose gel electrophoresis and the target fragment was purified by gel extraction. Figure 8 The PCR reaction system is as follows:
[0048]
[0049] Primer 1 Overexpression Primer
[0050] GmC2H2-2like-F:TCGAGCTCCGTCGACAAGCTTATGATGCCAAAGGCCACAAT(SEQ ID NO.1)
[0051] GmC2H2-2like-R: GCCCTTGCTCACCATAAGCTTTCTTAAACCACCAGCAATAT (SEQ ID NO. 2)
[0052] Primer 2 Subcellular primer
[0053] subC2H2-2like-F: ACGGGGGACTCTTGACCATGGATGATGCCAAAGGCCACAAT (SEQ ID NO. 3)
[0054] subC2H2-2like-R: TACTAGTCAGATCTACCATGGTCTTAAACCACCAGCAATAT (SEQ ID NO. 4)
[0055] Primer 3 Quantitative PCR primer
[0056] RTC2H2-2like-F: CCTCATCACCTTCACACTCATC (SEQ ID NO. 5)
[0057] RTC2H2-2like-R: GGAGACAAGAACACCAACTAGG (SEQ ID NO. 6)
[0058] Gene sequence of GmC2H2-2like (SEQ ID NO. 7):
[0059]
[0060] GmC2H2-2 like amino acid sequence (SEQ ID NO. 8):
[0061] MMPKATISTTPTNDFQELHMFPAAVNNEYLVSPSLEASSSSSPSHSSSNSLLFYLSLLKDKLGQLHNLVGVLVSPQQNLPESTPTAISTINNTIQEIIVAATSMRFTCQQMISSSPSGTNTINELHQQQIDHGRLLPPSHHESNFINNNRGVPSNINIVSHINRGQSFLSNSIEGEASLDWFAESYNNSNSGNNYFNPKDDEAANIINNIMGETSDDIIELDAADLLAKYSYFCQVCGKGFKRDANLRMHMRAHGEEYKTSAALRNPMKKNNKKESNLLFLGAEGSVTKRYSCPQQGCRWNQRHAKFQPLKSMICAKNHYKRSHCPKMYMCNRCNQKQFSVLSDLRTHEKHCGDYPKWQCSCGTTFSRKDKLMGHITLFAGHTPVPNINGMSSYMGKSEVQQNNIAGGLR*.
[0062] Example 2
[0063] Construction of vector and transformation of E. coli
[0064] 1) The recovered gel product was ligated with the cloning vector pCAMBIA3300 according to the instructions of TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0 kit, and the E. coli competent cell DH5α was transformed (2) The positive clones were screened by blue-white selection, and the positive clones were identified by colony PCR. Figure 9), and the single clone product was picked and cultured in a bacterial solution. The positive clone primer was used to identify the E. coli solution, and 1 μL of the cultured bacterial solution was selected as a template for PCR amplification. The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec; annealing at 58°C for 30 sec; extension at 72°C for 1 min / kb, for a total of 35 cycles; final extension at 72°C for 5 min, and storage at 4°C. After the reaction program was completed, 2% agarose gel electrophoresis was used for detection and separation, and about 500 μL of the bacterial solution from the correct band was sent to Beijing Huada Gene Technology Co., Ltd. for base sequencing. The final GmC2H2-2like gene fragment size was 1233 bp, indicating that the GmC2H2-2like gene was successfully connected to the expression vector and transformed into E. coli. The sequencing qualified E. coli solution was extracted for E. coli plasmid DNA according to the steps of TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0.
[0065] Example 3
[0066] Subcellular localization and fluorescent quantitative PCR
[0067] 1) Subcellular localization
[0068] The recombinant plasmid pCAMBIA1302-GmC2H2-2like was successfully transformed into the Agrobacterium competent cell GV3101 (p-soup). To determine the specific localization of the GmC2H2-2like gene in the cell, the Agrobacterium was injected into the lower epidermis of young tobacco. The Agrobacterium containing pCAMBIA1302-GFP was used as a negative control group. The distribution of the GFP (green fluorescent tag) protein in the plant was observed under an inverted microscope. Figure 10 The results showed that green fluorescence appeared in the nuclear membrane in the control group containing pCAMBIA1302-GFP tobacco, indicating that the cell membrane, cytoplasm, and nucleus all expressed to some extent. The pCAMBIA1302-GmC2H2-2like was the brightest in the nucleus of the tobacco, and the GmC2H2-2like gene encoded protein was mainly expressed in the nucleus, which was a nuclear localization protein, highly consistent with the bioinformatics prediction results.
[0069] 2) Fluorescent quantitative PCR
[0070] The housekeeping gene Actin4 (AF049106) was used as a fluorescent quantitative internal reference gene. The results of real-time fluorescent quantitative PCR showed that the GmC2H2-2like gene was expressed in different tissue parts of soybean, and the specific expression amount is shown in Table 2. Figure 11The GmC2H2-2like gene is up-regulated in different tissues such as roots, stems and leaves after SCN stress treatment, especially in the roots.
[0071] Example 4
[0072] The recombinant vector is transformed into Agrobacterium tumefaciens.
[0073] 1) 1 μL pCAMBIA3300-GmC2H2-2like recombinant plasmid is added to EHA105 competent cells (100 μL), and then the mixture is gently blown with a pipette gun, transferred to the bottom of a 1 mm point transfer cup, and then placed in an electric shock tank; the preset parameters Agrobacterium are used for electric shock reaction; then 500 μL of SOC medium is immediately transferred to the electric shock cup, gently mixed, and then the liquid is sucked into a 1.5 mL EP tube; it is placed at 28°C, 150 rpm, and the h is recovered; 100 μL is evenly smeared on a plate with kanamycin (kan) and streptomycin (str) resistance genes Bar as a screening marker; after 24 h of dark culture at 28°C, single colonies are picked for bacterial liquid PCR verification, and a target band of 1233 bp is obtained, proving that pCAMBIA3300-GmC2H2-2like has been successfully transferred into Agrobacterium tumefaciens. Figure 12 ).
[0074] Example 5
[0075] Verification of the function of the candidate gene.
[0076] 1) Soybean genomic DNA extraction. In this study, the SDS-minimal extraction method was used for soybean genomic DNA extraction.
[0077] 2) The pCAMBIA3300-GmC2H2-2like recombinant is transformed into SCN susceptible variety Dongnong 50 by Agrobacterium tumefaciens-mediated soybean cotyledon node transformation method, a total of 1000 explants are transformed, the genomic DNA of regenerated plants and Bar test strips are extracted, and a total of 3 transgenic lines are screened and seeds are collected for further expansion to the stable generation. Figure 13 ).
[0078] 3) Acid fuchsin staining method. Histological examination of SCN infection showed that on the 15th day after inoculation, nematodes had begun to feed, and the invasion and development of nematodes in the roots were observed using the international acid fuchsin staining method, which included 1) rinsing: the residual soil of the roots was rinsed clean with clean water; 2) soaking: the roots were soaked in 3% NaClO aqueous solution for 1 h (this time can be adjusted according to the degree of decolorization, and the decolorization is faster with a slightly higher concentration of NaClO), ensuring that the roots were completely decolorized; 3) root staining: after the roots were rinsed clean with tap water, they were soaked in distilled water for 15 min, and the acid fuchsin staining solution (mother liquor: 3.5 g fuchsin, 250 mL glacial acetic acid, 750 mL distilled water) was boiled, and the decolorized roots were placed in the fuchsin and boiled for 45 s-2 min (the time was shortened as much as possible under the condition of good coloring, and the root system was relatively firm), and the roots were wiped with a water-absorbing paper when taken out, and observed.
[0079] 4) 15 plants of each of the positive plants carrying the pCAMBIA3300-GmC2H2-2like transgene and wild-type plants were inoculated with 3# physiological egg suspension for identification, and 1000 SCN were inoculated per pot, and the plants were planted in SCN disease soil. After 15 days, the roots were washed with water, and the acid fuchsin staining method was used to count under a 20x and 100x optical microscope, 5-6 lateral roots were taken from each plant for repetition, the average number of female worms per plant was calculated, and paired t-test was used. Statistical analysis of the number of nematodes per unit area of root showed that the number of nematodes in the roots of the soybean plants overexpressing GmC2H2-2like (2.6) was significantly lower than that of the wild-type Dongnong 50 (5.1) (P<0.01), indicating that GmC2H2-2like has the effect of inhibiting cyst nematodes. The t-test difference analysis of the average number of cyst nematodes per unit area of the overexpression group and the control group showed that the means of the two groups were 2.630 and 5.060, respectively, the standard deviations were 0.500 and 0.667, respectively, the test result t value was 10.921, and the mean P value (two-tailed) was 0.005, indicating that there was a significant difference in the average number of cyst nematodes per unit area between the overexpression group and the control group, and the overexpression of GmC2H2-2like could improve the resistance of soybean to cyst nematodes (Table 2).
[0080] Table 1 Analysis of GmC2H2-2like gene promoter cis-acting elements
[0081]
[0082]
[0083] Table 2 Average number of female worms per cm of plant root -1 )
[0084]
Claims
1. A method of producing a plant resistant to soybean cyst nematode, comprising, The specific steps of the method are as follows: Step 1: connecting the gene shown in SEQ ID NO. 7 with the vector pCAMBIA3300 to obtain a recombinant vector; Step 2: transforming the recombinant vector in step 1 into Agrobacterium to obtain a recombinant Agrobacterium; Step 3: introducing the recombinant Agrobacterium in step 2 into soybean to obtain transgenic soybean plants, and obtaining positive transgenic soybean plants after identification.
2. Application of the protein against soybean cyst nematode disease shown in SEQ ID NO. 8, the gene shown in SEQ ID NO. 7, the recombinant vector containing the gene shown in SEQ ID NO. 7, the recombinant microbial cell carrying the gene shown in SEQ ID NO. 7 or the soybean plant overexpressing the gene shown in SEQ ID NO. 7 in improving the resistance of soybean to cyst nematode disease.